ID: 1162343539

View in Genome Browser
Species Human (GRCh38)
Location 19:10106520-10106542
Sequence GCGGAGCTGCGCCTGGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 285}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162343539_1162343550 27 Left 1162343539 19:10106520-10106542 CCCGCGCCCAGGCGCAGCTCCGC 0: 1
1: 0
2: 0
3: 25
4: 285
Right 1162343550 19:10106570-10106592 CACTCGTTCGTGTTCACGCGAGG 0: 1
1: 0
2: 0
3: 1
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162343539 Original CRISPR GCGGAGCTGCGCCTGGGCGC GGG (reversed) Exonic