ID: 1162344091

View in Genome Browser
Species Human (GRCh38)
Location 19:10109821-10109843
Sequence CACCCTTCCCACAGTGCGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162344091 Original CRISPR CACCCTTCCCACAGTGCGTC AGG (reversed) Intronic
901493211 1:9607124-9607146 GAGCCTTCCCACAGAGCGGCCGG - Intronic
902799681 1:18821448-18821470 AGCCCTTCTCACAGGGCGTCAGG - Intergenic
904118666 1:28180610-28180632 CACCAATCCCACAGTGGGTCTGG + Intronic
904504032 1:30936103-30936125 CACCCTTCCCAGAGTCCCTGAGG - Intronic
904505496 1:30949532-30949554 CACCCTTCCCAGAGTCCCTGAGG - Intronic
915268103 1:154733026-154733048 CACCTTTCCCACAGTATGTGTGG + Exonic
918070058 1:181128129-181128151 CACCCTGCCCATAGTGAGACAGG - Intergenic
918423621 1:184387250-184387272 CCTCCTCCCCACAGTGTGTCCGG - Exonic
920762772 1:208801622-208801644 CTCCCATCCTACAGTGGGTCAGG + Intergenic
922773822 1:228205975-228205997 CACCCTGGGCACAGTGCCTCCGG + Intronic
923024600 1:230194690-230194712 CACTCTCCCCACAGTGCCACAGG + Intronic
1063362241 10:5468206-5468228 CACCCTTCCCACAAGGTGTCAGG + Intergenic
1065132552 10:22636781-22636803 GCCCCTTCCCACAGTGACTCTGG + Intronic
1065417065 10:25499850-25499872 CTCCCTTCCCACAGTGACGCAGG - Intronic
1069880273 10:71588316-71588338 ATCCCTTCCCACAGTCAGTCTGG + Intronic
1076399929 10:130175848-130175870 CACCATGCCCACAGTGGGCCTGG - Intronic
1076933236 10:133548501-133548523 CACCCTTCCAAGAGTGAGACAGG + Intronic
1077445573 11:2589113-2589135 CACCCTTCCCTCAGTACAGCCGG - Intronic
1077466463 11:2735964-2735986 CGCCCTTCCTCCAGTGTGTCTGG + Intronic
1077664178 11:4093311-4093333 AACCCTGCCCACAGAGCTTCTGG - Intergenic
1080451134 11:32379858-32379880 CAACCTCCCCACAGTGAGTCAGG - Intergenic
1083180877 11:60984392-60984414 CTCCCTTTCCACTGTGCCTCTGG + Intronic
1083297829 11:61724754-61724776 CACCCATCCCACAGTGCTCTGGG + Intronic
1084088097 11:66863948-66863970 CACCCTTCCCACAGGTGTTCCGG - Exonic
1087536259 11:99449870-99449892 GACCCTTCCCACACTGATTCTGG - Intronic
1094770457 12:33652325-33652347 CAACCTTCCCAAATTGCTTCTGG - Intergenic
1096158756 12:49359375-49359397 CACCCTTTCCATAGTCCATCTGG + Intergenic
1097218199 12:57430663-57430685 CCCCCTCCCCACAGGCCGTCCGG + Intronic
1099989423 12:89708109-89708131 CTCCCCTCCCGCAGTGCGTCTGG + Intronic
1100476747 12:94942173-94942195 CACTGTCCCCACAGTGCCTCAGG - Intronic
1102251102 12:111388124-111388146 CTCTCTTCCCAGAGTGCGCCAGG + Intergenic
1104676868 12:130717023-130717045 CCCCCTTCCCACAGAACTTCAGG + Intergenic
1115653946 14:35424830-35424852 AACCCTTAGCACAGTGCGTTTGG + Intergenic
1115765325 14:36617446-36617468 CACCCTCACCCCAGTGCCTCTGG + Intergenic
1118461292 14:65989427-65989449 CAACTTTCCCACAGAGCCTCAGG - Intronic
1119216098 14:72870234-72870256 CACCCTGACAACAGTGTGTCAGG + Intronic
1121706556 14:96000269-96000291 CACACTTCCAACTGTGGGTCTGG - Intergenic
1121707633 14:96010957-96010979 CACCCTTCCCACAGCTCCACTGG + Intergenic
1126329041 15:47512241-47512263 CACCTTTCCCACATTGCATATGG + Intronic
1129484983 15:75862170-75862192 GGCCCATCCCACAGTGAGTCTGG - Intronic
1130096700 15:80861522-80861544 CTCCCTTCCCACATTGGGCCAGG + Intronic
1130597639 15:85258186-85258208 CAGTCTTCCCACAGTGAGACCGG - Intergenic
1132783669 16:1642465-1642487 CAGACTTCCCAGAGTGGGTCTGG + Intronic
1133091534 16:3408143-3408165 CACCCTTCCCCCAGAGCTGCTGG - Intronic
1134609532 16:15597475-15597497 CAGCTTTCCCACAGTGCTTCTGG + Intronic
1138562901 16:57812611-57812633 CACCCTCCCCACATTCCTTCAGG - Intronic
1141579963 16:84990625-84990647 CCCCCTCCCCAGGGTGCGTCAGG - Exonic
1146372854 17:32276017-32276039 CACCCCTTCCAGAGTGCCTCAGG + Intronic
1146974128 17:37096554-37096576 CATCCTTCCCAGAGAGGGTCAGG + Intronic
1150319469 17:64200381-64200403 AACCATTTCCACAGTGCTTCAGG + Intronic
1150379606 17:64710114-64710136 CAGCCTTCCAACACTGCTTCAGG + Intergenic
1150623046 17:66822787-66822809 AATTCTTCCCACAGTGCCTCTGG + Intergenic
1157390957 18:47302953-47302975 CTCCCCTCCGACAGTGGGTCAGG - Intergenic
1160975569 19:1790646-1790668 CCCCCTTCCCACTGTGCCTTGGG + Intronic
1162344091 19:10109821-10109843 CACCCTTCCCACAGTGCGTCAGG - Intronic
1163554737 19:17985408-17985430 CACCCTTCCCGCAGTAGGTGTGG - Exonic
1163625692 19:18388272-18388294 CTGTCTTCCCACAGTGCGGCTGG + Exonic
1166702517 19:44890617-44890639 GGCCCTTCCCAGAGTGCCTCGGG - Intronic
928238655 2:29567662-29567684 AACCATTCCCAAGGTGCGTCTGG + Intronic
929588586 2:43131158-43131180 CACCCTGCCCACAGTGAGCCTGG - Intergenic
929999953 2:46854568-46854590 CACCCATCCCACACTGCCTGGGG - Intronic
933629433 2:84639133-84639155 CACCATGCCCACAGTGGGTATGG - Intronic
934519066 2:95007846-95007868 CCCCAATCCCACAGTGCTTCTGG - Intergenic
938074356 2:128323755-128323777 CCCCCTCCCCACAGTGCCACAGG - Intergenic
938104877 2:128523099-128523121 CACCCCTCACACACTGCGGCAGG - Intergenic
939426520 2:142045218-142045240 TACCATTCCCACAGTGCTTCAGG + Intronic
942619687 2:177833945-177833967 CACCATTCCCCCAGTGCATGTGG - Intronic
946016436 2:216607737-216607759 CACCCTCCCCACTGTGTGCCTGG - Intergenic
947543651 2:230995607-230995629 CTCCCCTCCCACAGTGCGGGAGG + Intergenic
947619624 2:231581323-231581345 GACCCTTCCCACATTGCTACTGG + Intergenic
948302415 2:236917663-236917685 GACCCTCCCCACATTGCTTCTGG - Intergenic
948762471 2:240200738-240200760 GTCCCTTCCCACAGTGCAGCTGG - Intergenic
1172775021 20:37402316-37402338 CACCCTCCCCACACTTCTTCAGG - Intronic
1174064515 20:47854824-47854846 AACCCTTCCCACTGTGCCCCCGG - Intergenic
1174435008 20:50500000-50500022 TCCCCTTCCCACAGTGAGTCTGG + Intergenic
1175148222 20:56912507-56912529 CACCCTACCCAAAGTGCTCCTGG + Intergenic
1177852659 21:26366996-26367018 GTCCCATCCCACAGTGAGTCAGG - Intergenic
1180046530 21:45308847-45308869 CACCCTGCCCACGGTGCCACAGG - Intergenic
1181456864 22:23064740-23064762 CCCCCTTCCCACAGAGCCCCAGG - Intronic
1181633653 22:24164386-24164408 CATCCATCCCACAGGGCATCTGG + Exonic
1183490942 22:38115327-38115349 CCCCCTTAGCACAGTGCTTCAGG + Intronic
1183733652 22:39631752-39631774 CACTCTGCCCTCAGTGCCTCTGG - Intronic
1184918090 22:47587042-47587064 CACCATTCCCACAGTGAGGCAGG + Intergenic
950725386 3:14913806-14913828 CACCCTTCTCAAAGAGCTTCAGG - Intronic
952625004 3:35393016-35393038 CCCCATTCCCACAGTGCATGTGG - Intergenic
953828166 3:46272157-46272179 CACCCTACCCCCAGTGCAGCTGG - Intergenic
954461312 3:50628642-50628664 CAGCCTTCCCACAGAGGGCCGGG - Intronic
955338128 3:58103945-58103967 CTTCCTTCCCACAGAGGGTCTGG + Exonic
955948197 3:64215326-64215348 CACCCTTCCCTCAGTACTTCAGG + Intronic
956491848 3:69780862-69780884 GTCCCTTCCCACAGTGAATCTGG - Intronic
956882700 3:73527184-73527206 CATCCTTACCACTGTGCATCAGG - Intronic
959665768 3:108919066-108919088 CACCCTCTCCACAGTGTGTAAGG + Intronic
962006617 3:131356170-131356192 GATCCTTCCCACACTGCCTCGGG + Intergenic
967205313 3:187114251-187114273 GACCCTTCCCTCAGAGCCTCGGG - Intergenic
968552359 4:1230121-1230143 CACCCCGTCCACACTGCGTCTGG - Intronic
968664028 4:1810934-1810956 CACACATCCCTCAGGGCGTCTGG + Intergenic
985895889 5:2749876-2749898 CACCGTTCCCCCCGTGAGTCTGG + Intronic
987887946 5:23835189-23835211 CACCCTTCCAAGATTGAGTCAGG + Intergenic
989198377 5:38738206-38738228 GCCCCTTCCCACATTGAGTCTGG + Intergenic
993886156 5:93418111-93418133 CACCTATTCCACAGTGCATCAGG - Intergenic
999753517 5:154647597-154647619 CACTCTTCCCACACTGTGCCTGG + Intergenic
1001199126 5:169699862-169699884 CACCCAGCCCACAGGGCCTCTGG - Intronic
1001284966 5:170416153-170416175 CAGCCTTCCCAGAGTGAGGCTGG - Intronic
1001774016 5:174315318-174315340 CACCCTTCCCACACAGCCACAGG - Intergenic
1003336383 6:5176652-5176674 CACACTTCCTTCAGTGCTTCAGG - Intronic
1005368869 6:25108661-25108683 CAGCCTTCCCCCATTGGGTCTGG + Intergenic
1005700897 6:28399497-28399519 CTCCCTCCCCAAAGTGCGTTGGG - Intronic
1006913508 6:37579375-37579397 CACCCTTCCTACTCTGCATCTGG + Intergenic
1008054888 6:46936091-46936113 CACCCTAGGCACAGTGTGTCGGG + Intronic
1010653173 6:78479300-78479322 AACACTTACCACAGTGTGTCTGG - Intergenic
1011663472 6:89613923-89613945 CACCCTTCCCACAAGGCTACCGG + Intronic
1012384024 6:98656246-98656268 CTCCTTTCTCACAGTGCTTCAGG + Intergenic
1013080992 6:106812867-106812889 CACCCTCCCAACAGTGAGGCAGG + Intergenic
1016633217 6:146256419-146256441 CACTCCTCCCCCAGTGTGTCTGG + Intronic
1017685147 6:156906061-156906083 CCCCCTTTCCACAGTGCTCCTGG - Intronic
1018254402 6:161904070-161904092 GTCCCTTCCCACAGTGAGCCTGG + Intronic
1019377201 7:699127-699149 CACCCTTCCCACCTTGCCTGTGG - Intronic
1022645801 7:32227667-32227689 CACTCTTCCCACACTGAATCAGG + Intronic
1028135570 7:87220133-87220155 CACCCCTCCCGCAGGGCGGCGGG + Intronic
1033241029 7:139680300-139680322 CACCCTCCCCACAGCGTGGCTGG + Intronic
1035556192 8:569024-569046 CACCAGTCCCACAGTGCACCAGG - Intergenic
1035842663 8:2829145-2829167 CACCCTCCCCAGAATGGGTCTGG - Intergenic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1038358477 8:26854140-26854162 CACCTTTCTCACAGTCCCTCAGG - Intronic
1038820021 8:30943593-30943615 CACCCTTCCCACCGCTTGTCTGG - Intergenic
1047033799 8:120913070-120913092 CACCTTCCCCACAGGGCGGCTGG - Intergenic
1047408978 8:124608743-124608765 CACCCTCCACACAGTGCCCCAGG - Intronic
1048510477 8:135057359-135057381 CATCCTTCCCACGGTGCGTGAGG - Intergenic
1053222339 9:36322865-36322887 GTCCCTTCCCACAGTGCACCAGG + Intergenic
1058280016 9:103102998-103103020 CACTCTTCCCCCAGTGCAGCCGG - Intergenic
1062416134 9:136451227-136451249 CAGCCTGCCCACGGTGCGCCTGG - Intronic
1186467847 X:9797796-9797818 CACCCCACCCACTGTGCCTCCGG - Intronic
1188180122 X:27044997-27045019 CGCGCTTCCCACAGTCAGTCAGG + Intergenic
1189947737 X:46196261-46196283 CCCCATTCCCACAGTGCATTTGG - Intergenic
1190336399 X:49265350-49265372 CACCCCTCCCACAGAGGGTGAGG + Intergenic
1191257271 X:58285060-58285082 CACCCATCCCAGAGTTGGTCGGG - Intergenic