ID: 1162344708

View in Genome Browser
Species Human (GRCh38)
Location 19:10112466-10112488
Sequence CCCTCCTTCGGGAGGATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 137}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162344708_1162344719 9 Left 1162344708 19:10112466-10112488 CCCCCCATCCTCCCGAAGGAGGG 0: 1
1: 0
2: 1
3: 11
4: 137
Right 1162344719 19:10112498-10112520 TCACCGTCATCAGGTGGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 59
1162344708_1162344718 3 Left 1162344708 19:10112466-10112488 CCCCCCATCCTCCCGAAGGAGGG 0: 1
1: 0
2: 1
3: 11
4: 137
Right 1162344718 19:10112492-10112514 TTTTTCTCACCGTCATCAGGTGG 0: 1
1: 0
2: 1
3: 13
4: 122
1162344708_1162344720 10 Left 1162344708 19:10112466-10112488 CCCCCCATCCTCCCGAAGGAGGG 0: 1
1: 0
2: 1
3: 11
4: 137
Right 1162344720 19:10112499-10112521 CACCGTCATCAGGTGGCGCAGGG 0: 1
1: 0
2: 0
3: 2
4: 45
1162344708_1162344717 0 Left 1162344708 19:10112466-10112488 CCCCCCATCCTCCCGAAGGAGGG 0: 1
1: 0
2: 1
3: 11
4: 137
Right 1162344717 19:10112489-10112511 AGATTTTTCTCACCGTCATCAGG 0: 1
1: 0
2: 1
3: 4
4: 115
1162344708_1162344722 15 Left 1162344708 19:10112466-10112488 CCCCCCATCCTCCCGAAGGAGGG 0: 1
1: 0
2: 1
3: 11
4: 137
Right 1162344722 19:10112504-10112526 TCATCAGGTGGCGCAGGGTATGG 0: 1
1: 0
2: 0
3: 11
4: 90
1162344708_1162344724 17 Left 1162344708 19:10112466-10112488 CCCCCCATCCTCCCGAAGGAGGG 0: 1
1: 0
2: 1
3: 11
4: 137
Right 1162344724 19:10112506-10112528 ATCAGGTGGCGCAGGGTATGGGG 0: 1
1: 0
2: 0
3: 1
4: 120
1162344708_1162344723 16 Left 1162344708 19:10112466-10112488 CCCCCCATCCTCCCGAAGGAGGG 0: 1
1: 0
2: 1
3: 11
4: 137
Right 1162344723 19:10112505-10112527 CATCAGGTGGCGCAGGGTATGGG 0: 1
1: 0
2: 1
3: 6
4: 92
1162344708_1162344725 18 Left 1162344708 19:10112466-10112488 CCCCCCATCCTCCCGAAGGAGGG 0: 1
1: 0
2: 1
3: 11
4: 137
Right 1162344725 19:10112507-10112529 TCAGGTGGCGCAGGGTATGGGGG 0: 1
1: 0
2: 1
3: 14
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162344708 Original CRISPR CCCTCCTTCGGGAGGATGGG GGG (reversed) Intronic
901069105 1:6508437-6508459 TCCTGCATCGGGAGGCTGGGTGG - Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903805246 1:26000586-26000608 TGTTCCTTCTGGAGGATGGGTGG - Intergenic
904302237 1:29561778-29561800 CCCTCCTTAGGGTGGCTGTGAGG - Intergenic
905627007 1:39495746-39495768 CCCTCCTGAGGGAGGAAGGATGG + Intronic
905669929 1:39785025-39785047 CCCTCCTGAGGGAGGAAGGATGG - Intronic
906127233 1:43434388-43434410 GCCTGATTCGGGAGGATGGGGGG + Exonic
908125339 1:61024783-61024805 CCCTACTTTGAGAGGATCGGTGG - Intronic
913071689 1:115304675-115304697 GCCTCCTTCTGGAGGCTGAGAGG - Intronic
914474658 1:148013463-148013485 CCCTCCGAAGGAAGGATGGGCGG + Intergenic
915430142 1:155860107-155860129 CCCTCCTTCTGGGGGAGGAGAGG + Intronic
918757299 1:188355197-188355219 CCCTCCTACGAGAGGTTGAGTGG - Intergenic
919539498 1:198829984-198830006 GCCTCCTTCCAGAGGGTGGGGGG + Intergenic
920674275 1:208028670-208028692 CCCTGCTGCGGGAGGAAGGGTGG - Intronic
1067274540 10:44822036-44822058 CCCTTCTTCTGGAGCTTGGGTGG - Intergenic
1070888231 10:79923134-79923156 CCTTCCTTCATGTGGATGGGAGG + Intergenic
1074020737 10:109579998-109580020 ACCTCCTTGGGAAGGATGAGTGG - Intergenic
1077213528 11:1384364-1384386 CCCGCCTTTGGGTGGGTGGGTGG - Intergenic
1079126512 11:17721520-17721542 CCATCCCTCGGGCGGGTGGGCGG - Exonic
1079287892 11:19156052-19156074 GCATCCTGCGGGTGGATGGGAGG + Intronic
1083362055 11:62116603-62116625 CACTCCCTCTGGAGGCTGGGAGG + Intergenic
1083397169 11:62400028-62400050 ACCTCATTCTGGAGGATGGGTGG - Intergenic
1083749361 11:64752914-64752936 CCCTCCTCCAGGTGGATGCGAGG + Intronic
1084457019 11:69273763-69273785 CCCTCCTCCTGGAGGATAGTGGG + Intergenic
1084550924 11:69841125-69841147 CCCTGCTGCAGGAGGAAGGGAGG + Intergenic
1084743607 11:71154722-71154744 CCCTCCTCTGGGAGCGTGGGTGG - Intronic
1084743631 11:71154789-71154811 CCCTCTTCTGGGAGCATGGGCGG - Intronic
1084743656 11:71154859-71154881 CCCTCCTCTGGGAGCGTGGGCGG - Intronic
1084743681 11:71154926-71154948 CCCTCCTCTGGGAGCGTGGGCGG - Intronic
1084743862 11:71155430-71155452 CCCTCCTCTGGGAGCGTGGGCGG - Intronic
1089135110 11:116242704-116242726 TCCTCCTTTTGGAGGATGGATGG - Intergenic
1089586663 11:119513799-119513821 CCCTCCTGGGGGAGGAGGGGTGG + Intergenic
1089864343 11:121618530-121618552 CGCTCCTTCTGGAGGAGAGGCGG - Intronic
1091727386 12:2855404-2855426 CCCACGTTTGGGAGGGTGGGAGG + Intronic
1103058637 12:117841334-117841356 CGGTCCTGAGGGAGGATGGGAGG - Intronic
1105955676 13:25280451-25280473 CCCTCCTTAGGGGTGAGGGGTGG - Intronic
1106917004 13:34526570-34526592 CCCTCCCTCAGGAGTCTGGGAGG - Intergenic
1110702996 13:78571544-78571566 CCCTGCTCCTGAAGGATGGGAGG - Intergenic
1116849627 14:49894275-49894297 CTCTCCTTCCAGGGGATGGGTGG - Exonic
1117424561 14:55580652-55580674 TCGTCCTTGGGGAGGGTGGGGGG - Intronic
1118713776 14:68544860-68544882 GCCTTCTTTGGCAGGATGGGAGG - Intronic
1119647322 14:76357092-76357114 CCCTCATTGGGGAGGAGTGGCGG - Intronic
1120021752 14:79538780-79538802 CCCTCCTTCTGTAAAATGGGGGG + Intronic
1122830156 14:104392037-104392059 CCCTCCTGCGGCAGGAAAGGGGG + Intergenic
1129100246 15:73255438-73255460 CCCTCCTTGAGGAAGACGGGAGG - Intronic
1132987660 16:2776567-2776589 CACTCCTTCGGGTGGAGGGTGGG - Intronic
1134042159 16:11076899-11076921 CCCTCCTACAAGAGGGTGGGAGG - Intronic
1135096430 16:19568471-19568493 CCATCCTTCGGGAAGGTGAGAGG - Intronic
1135272975 16:21084962-21084984 ACCTGCATCGGGGGGATGGGGGG - Intronic
1136294960 16:29296264-29296286 ACGTCCTTGGGAAGGATGGGTGG - Intergenic
1138506983 16:57483250-57483272 CATTCCTTCTGGAGGATGGTGGG - Intronic
1138537137 16:57666208-57666230 CCCCCATTCTGGAAGATGGGGGG - Intergenic
1139557095 16:67719229-67719251 CCTTCCTTAAGGCGGATGGGTGG - Exonic
1139583114 16:67884831-67884853 CCCTCCCTCCGGGGGCTGGGCGG + Exonic
1140475836 16:75238876-75238898 CCTGCCTTTGGGAGGCTGGGAGG - Intronic
1142100854 16:88270273-88270295 ACGTCCTTGGGAAGGATGGGTGG - Intergenic
1142620919 17:1165332-1165354 ACCTCCTGCGGGTGGATGGCCGG + Intronic
1143512593 17:7404767-7404789 CCCGCCCTCCGGAGAATGGGGGG - Intergenic
1145775691 17:27526823-27526845 TCCTCCTCCGGGGGGAGGGGTGG + Intronic
1146129480 17:30259008-30259030 CCCTCTTTAGGGAGGATGTTAGG - Intronic
1146514799 17:33480729-33480751 CAGTCCTTCGGGAGGATGGCTGG - Intronic
1146831158 17:36070583-36070605 CCCTCGGGAGGGAGGATGGGAGG + Intronic
1150007677 17:61479723-61479745 CCCTCCTTGGGGAGGAGGGTGGG - Intronic
1151412908 17:73942953-73942975 CCCTCCATGAGGAGCATGGGGGG - Intergenic
1152695411 17:81741508-81741530 CCCTTTTGCAGGAGGATGGGGGG + Intergenic
1152895376 17:82907882-82907904 CCCTGCCTGGGGAGGGTGGGAGG - Intronic
1157783612 18:50462233-50462255 CACTCCTGCAGGAAGATGGGAGG + Intergenic
1159992569 18:74926944-74926966 CCCTCTTGCAGGAGGATGGCAGG - Intronic
1160007051 18:75075431-75075453 CCCTTCGTGGGGAGGATGGAGGG + Intergenic
1160042779 18:75360739-75360761 GGCTCCTTCTGGAGGATTGGAGG + Intergenic
1160693758 19:472598-472620 CCCTCCATGGTGAGGATTGGGGG + Intronic
1161224273 19:3136020-3136042 TCCTCCTTCTGGAGAAGGGGCGG - Intergenic
1161735952 19:5992131-5992153 CCCACCTGCGGGAGGGAGGGTGG - Intergenic
1161984159 19:7644738-7644760 TCCTCCTTCGGAATGGTGGGTGG + Exonic
1162344708 19:10112466-10112488 CCCTCCTTCGGGAGGATGGGGGG - Intronic
1162894077 19:13754413-13754435 CACTGCTGCGGAAGGATGGGTGG + Intronic
1163546474 19:17943857-17943879 CCCTCTGGCGGGAGGACGGGTGG - Exonic
1163630706 19:18416809-18416831 CCGTCCTTCGCGTGGGTGGGGGG + Intergenic
1167691136 19:50984088-50984110 CCCTCCCTCCGAAGGACGGGCGG + Intronic
1168292740 19:55364849-55364871 CCCTGCTCCGGGCGGCTGGGTGG + Exonic
1168516900 19:57016592-57016614 CCCTCCCCCGGGGTGATGGGGGG - Intergenic
932360608 2:71102518-71102540 CCCACCTTAGGTGGGATGGGGGG - Intergenic
932382575 2:71298847-71298869 CCCTCCTTAGGGAGGGAGGAGGG - Intronic
932699567 2:73984190-73984212 CCCTCCTCTGGGAGGCAGGGCGG + Intergenic
936876245 2:117193075-117193097 CCCTCCTTCAGGATAATGGCTGG - Intergenic
937449861 2:121993059-121993081 CCCTACAGCTGGAGGATGGGAGG - Intergenic
937982947 2:127625572-127625594 CTCTCCTTTGGGAGGTGGGGGGG + Intronic
942098463 2:172555893-172555915 TCCTTCCTCGGGAGGCTGGGCGG + Intronic
946236466 2:218327368-218327390 GCCTCATTCGGGGGGCTGGGAGG - Intronic
948207363 2:236169119-236169141 CCATCCTCGGGGAGGAAGGGGGG + Intergenic
948610769 2:239165273-239165295 CCCTGCTGCAGGTGGATGGGTGG - Intronic
1169578263 20:6990431-6990453 CCCTCCTTCCGGAGGCTCTGGGG - Intergenic
1172950842 20:38722787-38722809 GCCTCCTCCGGGAGACTGGGAGG + Intergenic
1173727637 20:45308394-45308416 CCCCCCCTCAGGAGGAAGGGGGG - Intronic
1174184597 20:48697777-48697799 TTCCCCTTCTGGAGGATGGGAGG + Intronic
1174287503 20:49483392-49483414 CCCTCCTGCGGTAGGGTTGGGGG - Intergenic
1176195479 20:63834870-63834892 CCATCCTTCCTGAGGATGAGAGG - Intergenic
1180084945 21:45504336-45504358 CCCTGGCTCGGGGGGATGGGAGG + Intronic
1182431608 22:30302176-30302198 CCTGCCTTAGGGAGGATGGTAGG + Intronic
1182490296 22:30667464-30667486 CTCTCCTTCAGGCGGGTGGGCGG + Exonic
1183622319 22:38981823-38981845 CCCACCTTCTGGAAGCTGGGAGG + Intronic
1183627485 22:39013722-39013744 CCCACCTTCTGGAAGCTGGGAGG + Intergenic
954445063 3:50542054-50542076 CCCTCTGTGGGGAGGAGGGGAGG + Intergenic
954553175 3:51499302-51499324 CCCTCTTTCATGGGGATGGGAGG + Intronic
961311350 3:126003999-126004021 CCCTCCTTTGGGAGGGAGGCTGG + Intergenic
961669384 3:128517912-128517934 CCCTCCTAAGGGTGGATGTGTGG - Intergenic
966711136 3:182974001-182974023 CACTCCTTTGGGAGGCTGAGAGG + Intronic
968635088 4:1674135-1674157 GCCTCCTTCTGGAGGCTGAGGGG + Intronic
968869202 4:3232957-3232979 CCCTCCTCAGTGAGGATGGTGGG + Intronic
969704180 4:8783070-8783092 CCCTCCCTCCCGGGGATGGGAGG + Intergenic
970191311 4:13522327-13522349 CTCTCCCTCGGGAGGAAGGTAGG - Intergenic
970747529 4:19317376-19317398 ACCTACTTCAGGAAGATGGGTGG + Intergenic
987399884 5:17464025-17464047 CCCTCCTCCCGGAGGTTCGGTGG + Intergenic
991585005 5:68193114-68193136 CCCTCCTTCATGTGGATGGCAGG - Intronic
994012311 5:94919833-94919855 TCCTACTTTGAGAGGATGGGTGG - Intronic
996143319 5:119941972-119941994 CCATCCTTCAGGATGAGGGGTGG + Intergenic
997616454 5:135249421-135249443 GACTCCTTCGGGAGGATGTGCGG + Intronic
998163750 5:139828624-139828646 TCATCCTTCGGGAGGAGGGGAGG - Intronic
998396869 5:141824278-141824300 CCCTCCTTCAGGTGGAAGAGTGG - Intergenic
999149900 5:149420020-149420042 CCCTCCCTGGGGAGGAAGTGGGG + Intergenic
1001075111 5:168620692-168620714 CCCTCTTTCTGGAGGTGGGGAGG + Intergenic
1001267866 5:170288149-170288171 GCCTACTTGGGGAGGGTGGGTGG - Intronic
1007323013 6:41040732-41040754 CCCTCTTTAGGGCGGCTGGGAGG + Intronic
1013685276 6:112574309-112574331 CCCTCCTGCTTGATGATGGGAGG - Intergenic
1013853079 6:114539470-114539492 CCCCCCTTAAGGAAGATGGGAGG + Intergenic
1018421117 6:163641845-163641867 CCCACCTGCGGGAGGGTGAGAGG + Intergenic
1019124822 6:169831099-169831121 CCCACCCTCGGGAGGAGGAGGGG + Intergenic
1019563488 7:1668977-1668999 GCCTCCTTCGGCTGGCTGGGTGG - Intergenic
1021218673 7:17949167-17949189 CCCTCATTCTGAAGGGTGGGGGG - Intergenic
1022532692 7:31076793-31076815 CTCCCCTTAGGGCGGATGGGGGG + Intronic
1029098291 7:98106766-98106788 CACTCCTTCAGGATGATGGGCGG + Intergenic
1029308256 7:99638207-99638229 CTCTCCTTCCAGGGGATGGGTGG + Intergenic
1035826856 8:2654053-2654075 CCCTCCCTCTGAAGGGTGGGGGG + Intergenic
1036407544 8:8468511-8468533 TCCTCCTTTGTGGGGATGGGAGG + Intergenic
1036786695 8:11692697-11692719 TGCTCCGTCGGGAGGCTGGGAGG + Intronic
1041375818 8:57208765-57208787 TCCTCCTTCGGGAGCTGGGGTGG + Intergenic
1041376581 8:57213144-57213166 TCCTCCTTCGGGAGCTGGGGTGG + Intergenic
1044845881 8:96380768-96380790 ACCTCCTTCTGGTGCATGGGTGG + Intergenic
1044885926 8:96777388-96777410 CCCTCATACGGAAGGATGGGAGG + Intronic
1046715371 8:117561208-117561230 TCTTCCTTGGGGAGGATGAGTGG - Intergenic
1049537437 8:143188894-143188916 CACTGCTGCGGGAGAATGGGTGG + Intergenic
1049548433 8:143245671-143245693 CCCTACTGTGGGAGGGTGGGCGG - Intergenic
1049605894 8:143529062-143529084 CCCTCATTCGGGAGTCTGTGAGG - Intronic
1057544729 9:96009488-96009510 CTCTCTTTCTGGAGGAAGGGAGG - Intronic
1061403149 9:130379251-130379273 CCCACCTTCTGGAACATGGGGGG - Intronic
1062325644 9:136011219-136011241 CCCTTCTTGGGGAGGGTGGGAGG - Exonic
1187499507 X:19828008-19828030 CCCTCCTGGCGGGGGATGGGGGG - Intronic
1190055769 X:47180194-47180216 GCCTCCTGTGGGAGGAGGGGAGG - Exonic
1197355121 X:125430162-125430184 CCCTCCTTTTGAAGCATGGGTGG - Intergenic
1201147460 Y:11072889-11072911 CCCTCCTCCGGGAGCATGGGTGG - Intergenic