ID: 1162344998

View in Genome Browser
Species Human (GRCh38)
Location 19:10113736-10113758
Sequence GGCCGTGGCCAGCAATGGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162344990_1162344998 10 Left 1162344990 19:10113703-10113725 CCTGTGGCCCATACTGGTGGTTG 0: 1
1: 0
2: 2
3: 5
4: 90
Right 1162344998 19:10113736-10113758 GGCCGTGGCCAGCAATGGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 183
1162344992_1162344998 2 Left 1162344992 19:10113711-10113733 CCATACTGGTGGTTGAGTTCCTG 0: 1
1: 0
2: 0
3: 4
4: 108
Right 1162344998 19:10113736-10113758 GGCCGTGGCCAGCAATGGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 183
1162344991_1162344998 3 Left 1162344991 19:10113710-10113732 CCCATACTGGTGGTTGAGTTCCT 0: 1
1: 0
2: 2
3: 11
4: 151
Right 1162344998 19:10113736-10113758 GGCCGTGGCCAGCAATGGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 183
1162344987_1162344998 22 Left 1162344987 19:10113691-10113713 CCAGGGGGACTTCCTGTGGCCCA 0: 1
1: 0
2: 1
3: 13
4: 255
Right 1162344998 19:10113736-10113758 GGCCGTGGCCAGCAATGGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162344998 Original CRISPR GGCCGTGGCCAGCAATGGCC TGG Exonic
900421227 1:2556821-2556843 CGCCGGAGCCAGCAACGGCCAGG - Intronic
900470817 1:2854104-2854126 GGCCCTGGCCAGCCTGGGCCTGG - Intergenic
903017436 1:20370138-20370160 GCCCTTGGCCAGCATGGGCCTGG - Intergenic
903652398 1:24930017-24930039 GGCCCTGGCGAGTAGTGGCCGGG - Intronic
904009973 1:27383779-27383801 GGCAGGGGCCAGCTAGGGCCCGG - Intergenic
904267688 1:29326994-29327016 GGATGGGGACAGCAATGGCCAGG - Intergenic
904472111 1:30742384-30742406 GGCCCTGGCCAGGGATAGCCAGG - Intronic
906949602 1:50323552-50323574 TGCCGTAGCCAGCAAGGGGCTGG - Intergenic
914899532 1:151704364-151704386 GGTGGTGGCCAGCAATGGGGTGG + Intronic
915090057 1:153417860-153417882 GGCCCTGGCCAGGATGGGCCGGG + Intronic
915095427 1:153459216-153459238 GGCCCTGGCCAGGATGGGCCAGG - Intronic
917928741 1:179809559-179809581 GGCTGTGCACGGCAATGGCCTGG - Intronic
921495042 1:215829070-215829092 GGCCATGGCCAGACATGTCCGGG + Intronic
923033133 1:230265491-230265513 GGCTGTGGCCAGCAGGAGCCAGG - Intronic
1064996456 10:21300763-21300785 GGCTGTAACCAGCAAGGGCCTGG - Intergenic
1065882600 10:30049309-30049331 AGCCATGGCGAACAATGGCCAGG + Intronic
1065960212 10:30727871-30727893 GGAAGTGGTCAGAAATGGCCAGG + Intergenic
1067227793 10:44386665-44386687 GGCCCAGCCCAGCAAAGGCCTGG - Intergenic
1069495685 10:68901371-68901393 GGCGGTGGCCAGTAATGCCTGGG + Exonic
1069906332 10:71734696-71734718 GGCTGTGGCCAGTGCTGGCCGGG + Intronic
1076711662 10:132339092-132339114 TGCCGTGGCCAGCCACGCCCAGG - Intronic
1076830679 10:132992752-132992774 GGGGGTGGCCAGGGATGGCCGGG - Intergenic
1077402936 11:2367939-2367961 GACCCTGGCCAGAAAAGGCCGGG + Intergenic
1077844849 11:6013252-6013274 GCCTGTGCCCAGCAAGGGCCTGG - Intergenic
1078451442 11:11443718-11443740 GGCCTTGGCCAGGACTGGGCAGG - Intronic
1078667107 11:13334876-13334898 GGCTGTGGCCAGAAAAGCCCAGG - Intronic
1083596530 11:63920503-63920525 GGCTGTGGCCACTGATGGCCTGG - Intergenic
1084051956 11:66605798-66605820 GGCCCTTGCCAGCGATGGGCCGG - Exonic
1089392067 11:118108926-118108948 GGCCTGGGCCAGCAATGAGCAGG + Intronic
1089806211 11:121093154-121093176 TGCCTTGGCCAGAAATGGTCAGG + Intergenic
1090666674 11:128919028-128919050 GGCTGAGGCCAGCACTCGCCTGG + Exonic
1090801078 11:130172710-130172732 GGAAGAGGACAGCAATGGCCGGG - Intronic
1091276660 11:134357437-134357459 GGCCATGCCCAGCCACGGCCTGG + Intronic
1096256221 12:50063814-50063836 GGCAGTGCCCAGCAAGAGCCAGG + Intronic
1096421264 12:51459986-51460008 GGCCGAGGCCTCCAATGTCCTGG + Exonic
1103013535 12:117476426-117476448 GGCTGTGGCTCTCAATGGCCAGG + Intronic
1104918176 12:132277235-132277257 TGCTGGGGCCTGCAATGGCCAGG + Intronic
1106585503 13:31053328-31053350 GGCCTTGGCCAGGAATGGGAGGG + Intergenic
1117043316 14:51787522-51787544 GGCCATGGCCAGCAGCAGCCTGG - Intergenic
1119473436 14:74913056-74913078 GGCTGTGGCCAGCCATGGTCGGG + Intronic
1120787423 14:88550279-88550301 GTCCGTGGAGAGCACTGGCCAGG - Exonic
1121536608 14:94695379-94695401 GGCCTTGGGCAGCAATGCCTGGG - Intergenic
1122079120 14:99254631-99254653 GGCCGGGGCCAGCGAGGCCCTGG + Intronic
1122365751 14:101194010-101194032 GGCTGTGGCCAGCAAAGGAGGGG + Intergenic
1122917432 14:104865524-104865546 GGCCGCGGCCAGCGCTGGGCCGG - Intronic
1122982646 14:105198573-105198595 GGCGGTGGCAAGCCATGGCAGGG + Intergenic
1125902967 15:43366302-43366324 TGCCCTGCCCAGTAATGGCCTGG - Exonic
1127895836 15:63298070-63298092 TGCAGTGGCCAGCATGGGCCAGG - Intronic
1128495053 15:68193066-68193088 GGATGTAACCAGCAATGGCCAGG - Exonic
1129237979 15:74235122-74235144 GGGCCTGACCAGGAATGGCCTGG - Intergenic
1129361548 15:75027740-75027762 TGCCGTGGGCAGCGAGGGCCAGG - Intronic
1129709364 15:77812669-77812691 GACCCTCGCCAACAATGGCCAGG + Intronic
1132646328 16:1000903-1000925 TGCCGTGGCCAGCAGTGGTTGGG - Intergenic
1132860643 16:2070033-2070055 GGCCGAGGCCAGCAGGAGCCAGG - Intronic
1132891300 16:2206127-2206149 GGTCGTAGCCTGCAGTGGCCAGG - Exonic
1136027094 16:27475503-27475525 GGCCCTGGGCAGCACTGGCAGGG + Intronic
1136493234 16:30624637-30624659 GCCTGTGGCCAGACATGGCCTGG - Intergenic
1136775343 16:32868771-32868793 GGCCCTGGACAGCCATGGCTTGG + Intergenic
1140704471 16:77613765-77613787 CTCCGAGGCCAGCAATGGCTAGG + Intergenic
1141441358 16:84031657-84031679 GGCCGTGGCTAGCGATGACCGGG - Intronic
1142292078 16:89197809-89197831 GGCCGAGGCCGGCCATGGACTGG - Intronic
1203077760 16_KI270728v1_random:1130880-1130902 GGCCCTGGACAGCCATGGCTTGG + Intergenic
1145241343 17:21242483-21242505 GGCCAAGGCCAGCAAGGGGCGGG + Exonic
1147140624 17:38458735-38458757 AGCTGTGGCCAGCAGGGGCCAGG - Intronic
1147586515 17:41656387-41656409 GGCTGTGGTCAGGAATGGCCGGG + Intergenic
1147668529 17:42163712-42163734 GGCCCTGGCCAGCCAGGGCAGGG + Exonic
1147743254 17:42680458-42680480 GGGTCTGGCCGGCAATGGCCTGG - Exonic
1148342811 17:46883689-46883711 GGCCGTGCCCAGCACTCCCCGGG - Intronic
1148673754 17:49432910-49432932 GGCCCTGGCAGGGAATGGCCTGG + Intronic
1149571944 17:57678329-57678351 GGCTCTGGCCAGCAATGGCTGGG - Intronic
1150652658 17:67020012-67020034 CCCCGGGGCCAGCAATAGCCGGG + Intronic
1151460347 17:74250436-74250458 GGCCGAGGGGAGCGATGGCCTGG + Intronic
1151952686 17:77363917-77363939 GGACCTGGCCAGCTCTGGCCAGG - Intronic
1152263039 17:79277580-79277602 GGCAGAGGCCCGCAGTGGCCAGG - Intronic
1152296666 17:79471259-79471281 GTACGTGACCAGCACTGGCCAGG + Intronic
1152644120 17:81460990-81461012 GGCAGCGGCCAGCAAGGGGCCGG + Exonic
1156352761 18:36315332-36315354 GGCTGAGGCCAGGAAAGGCCTGG - Intronic
1157516076 18:48312345-48312367 TGGGGTGGCCAGCAAAGGCCAGG - Intronic
1160820856 19:1057113-1057135 GGCAGTGGCAAGCAGTGGCTGGG - Intronic
1160835608 19:1123191-1123213 GGGCGTGGCCAGGAATGCCTGGG + Intronic
1161224401 19:3136390-3136412 TGCCCTGGCCAGCAGGGGCCCGG + Exonic
1162034008 19:7929557-7929579 GCCCGGGGCCAGCACTGCCCTGG + Intronic
1162344998 19:10113736-10113758 GGCCGTGGCCAGCAATGGCCTGG + Exonic
1162780229 19:13002812-13002834 GGTGGTGGCCAGCAGTGGGCAGG + Intronic
1162918343 19:13886012-13886034 GGGCCCGGCCAGCAAGGGCCCGG + Exonic
1163638924 19:18450729-18450751 GGCCGATGTCAGCAATGACCTGG - Exonic
1163863141 19:19752955-19752977 GGCCCTGGTCAGCAGGGGCCTGG - Intergenic
1166324537 19:42041273-42041295 GGCTGTGGCCAGAGATGGCCAGG - Intronic
1167491054 19:49792789-49792811 CGCCATGGCCAGCACTGACCTGG - Intronic
925871803 2:8278202-8278224 GGCTGTGGCCAGCAGGAGCCAGG - Intergenic
927720391 2:25378410-25378432 GGCAGAGGCCTTCAATGGCCTGG + Intronic
930037187 2:47093889-47093911 GGCCGGGCCCTGCAATGGCCGGG + Intronic
932775983 2:74528770-74528792 GGAAGAGGCCACCAATGGCCGGG - Exonic
934896638 2:98125383-98125405 AGCCGTGGACAGCAAGGGCAGGG + Intronic
935406897 2:102718827-102718849 GGCCGTGGCCGGCCTTGCCCTGG - Exonic
937467364 2:122146163-122146185 GGCGGTGGCCAGCTGGGGCCAGG - Intergenic
944579813 2:201122525-201122547 GGCTGTGGTAAACAATGGCCAGG - Intronic
946039821 2:216773936-216773958 AGCCATGGCCAGATATGGCCTGG + Intergenic
946154932 2:217801076-217801098 AGCTGTGGACACCAATGGCCAGG - Exonic
947521182 2:230847308-230847330 GGGGGTGGCCAGCATTGGCTAGG - Intergenic
947826224 2:233107691-233107713 AGCCCTGGACAGCAAGGGCCTGG + Intronic
1168760539 20:347228-347250 GGCCGTGTCCCGCCAGGGCCGGG + Intronic
1170530010 20:17281718-17281740 GGCCATGGCCTGCAATTGCTTGG - Intronic
1170648761 20:18220009-18220031 CGGCGTGGCCATCACTGGCCAGG + Intergenic
1171465018 20:25321342-25321364 GGCGATGGCCAGGCATGGCCAGG + Intronic
1174575377 20:51533343-51533365 GGGCGTGGGCAGCAGTGGTCTGG - Intronic
1175230825 20:57472088-57472110 GGCAGGGGACAGCAAGGGCCTGG - Intergenic
1175419623 20:58823096-58823118 TGCCGTGGCTAGATATGGCCAGG - Intergenic
1175962828 20:62645787-62645809 GTCCGTGGGCAGGAAGGGCCTGG - Intronic
1182548837 22:31090461-31090483 AGCTGTGGGCAGCACTGGCCAGG + Intronic
1183441838 22:37827447-37827469 GGCCCTGGGGAGCAGTGGCCAGG - Intergenic
1183712292 22:39512257-39512279 GCCAGTGGCCAGGAAGGGCCAGG + Exonic
1184363078 22:44030440-44030462 GGCTGTGGCCAGCCCTGGTCGGG + Intronic
1184694621 22:46132618-46132640 GGCGCTGGCCAGCACAGGCCAGG - Intergenic
1185206244 22:49540880-49540902 TGCCTGGGCCAGGAATGGCCTGG + Intronic
1185250963 22:49801494-49801516 AGCCGTGGCCATCCCTGGCCAGG + Intronic
1185274424 22:49944203-49944225 GCTTGTGGCCAGCCATGGCCTGG - Intergenic
949819100 3:8095877-8095899 GGCCCTGACCAGCAATGGGCTGG + Intergenic
950175211 3:10868664-10868686 GGCAGTGGCCAGGAACAGCCAGG + Intronic
950612097 3:14133366-14133388 GGCCTTGTTCAGCAATGGTCTGG + Intronic
952269375 3:31817120-31817142 GGCCATGGGCAGCCATGGGCGGG + Intronic
952867501 3:37863594-37863616 GGCTGTGGCCAGCTCCGGCCTGG - Intronic
953412975 3:42700739-42700761 GGCCCCGGCCAGCATAGGCCAGG + Exonic
953943469 3:47124156-47124178 GGTAGTAGCCAGCAGTGGCCTGG + Exonic
954150981 3:48656879-48656901 GGCCGAGGCCAGGAAGGGCGCGG + Exonic
954681973 3:52350745-52350767 GGCCGGGACCAGCCAGGGCCAGG + Intronic
960676128 3:120196530-120196552 GGCCATGGGGAGGAATGGCCTGG - Intronic
961474005 3:127135854-127135876 GGCCGGGGGCTGCGATGGCCTGG - Intergenic
961639676 3:128357444-128357466 GGCCATGGCCAACAGGGGCCAGG + Intronic
961782896 3:129331521-129331543 GGCAGTGACCAGCCATGGCTAGG + Intergenic
963786152 3:149536505-149536527 GGCTGTGAGCAGCACTGGCCTGG - Intronic
966199495 3:177347086-177347108 GGACATGCCCAGAAATGGCCAGG + Intergenic
966588670 3:181654924-181654946 GACTGTGGCCACCAATAGCCGGG + Intergenic
967812629 3:193773495-193773517 GGCCGTGGCCAGCCCCTGCCTGG + Intergenic
968510450 4:993227-993249 AGCCGAGGCCAGAAATGCCCTGG - Intronic
968553284 4:1235102-1235124 GGAGGTGGCCAGCATTTGCCTGG + Intronic
968707498 4:2086975-2086997 GGCCAGGGCCAGGAGTGGCCTGG - Intronic
969255661 4:6000041-6000063 GGCCGTGGGCAGCCATGGTGGGG + Intergenic
969340034 4:6534897-6534919 CGCTGTGGCCAGCACTGGGCCGG - Intronic
969574099 4:8026376-8026398 GGCCATGTCCATCAATGGCCAGG + Intronic
973655444 4:53043041-53043063 TGCCGTGGTCAGAAATGGCGAGG - Intronic
984802451 4:183727511-183727533 GGACGCAGCCATCAATGGCCAGG + Intergenic
985569780 5:638678-638700 CGCTGTCCCCAGCAATGGCCCGG - Intronic
985579755 5:690399-690421 GGCGCTGACCAGCACTGGCCTGG + Intronic
985594601 5:782458-782480 GGCGCTGACCAGCACTGGCCTGG + Intergenic
985634701 5:1030269-1030291 GGCCAAGGCCACCAATGCCCAGG - Intronic
985811670 5:2094740-2094762 GGCCGGGGCCAGGGCTGGCCTGG - Intergenic
990410242 5:55534706-55534728 GGCCGTCGCCAGCCCCGGCCCGG - Exonic
994891318 5:105639831-105639853 GTCCATGGGCAGCAATGGGCAGG - Intergenic
996747371 5:126857045-126857067 GGTCGTGGGCAGCTCTGGCCGGG - Intergenic
997385555 5:133469281-133469303 GACCGTGGGCTGCATTGGCCAGG + Intronic
998458014 5:142288761-142288783 GGACGACGCCAGCAATAGCCTGG + Intergenic
1001315027 5:170635914-170635936 GGCAGTGGCAGGCAGTGGCCAGG + Intronic
1001990228 5:176110558-176110580 CTCCGTGACCAGCCATGGCCAGG - Intronic
1002028312 5:176410643-176410665 GGCCATTCCCAGCCATGGCCAGG - Intronic
1002226644 5:177727582-177727604 CTCCGTGACCAGCCATGGCCAGG + Intronic
1002267199 5:178043631-178043653 CTCCGTGACCAGCCATGGCCAGG - Intronic
1002670290 5:180861163-180861185 GGGCGTGGCAGGCAAGGGCCGGG + Intronic
1002921348 6:1575456-1575478 GGCAGTGGCCAGCGATCCCCTGG + Intergenic
1007636400 6:43302358-43302380 GGCCGTGCCCAGCAGTGTCCCGG - Exonic
1008905917 6:56677743-56677765 GGCAGTAGCCAGCAATGACCAGG - Intronic
1011470345 6:87701871-87701893 GGCAGTGGCCAGGGACGGCCCGG + Exonic
1011795575 6:90948059-90948081 GTCCGTGGGCAGCCATGGGCTGG - Intergenic
1013086363 6:106861300-106861322 TCCCGTGGGCAGCCATGGCCAGG + Intergenic
1019530431 7:1500353-1500375 CACCGTGGGCAGCACTGGCCGGG + Exonic
1019705273 7:2494479-2494501 AGCCGTGGCCAGCAGAGACCCGG - Intergenic
1019731574 7:2632142-2632164 GGCCGGGCCCCGCCATGGCCGGG + Exonic
1019758535 7:2791319-2791341 AGCAGTGGACAGCAATGGCCAGG + Intronic
1024359830 7:48456004-48456026 GGCCGTGCCCGGCAAGGGCCGGG - Intronic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1032410793 7:131692259-131692281 GGCCGTGGCCGGGAAGCGCCGGG - Intergenic
1033305014 7:140218818-140218840 GGCCGTGGCCAGCTAGCCCCAGG - Intergenic
1034064404 7:148122542-148122564 GGCAGGGGCCAGCAATAGCAAGG + Intronic
1035337397 7:158138617-158138639 GGCAGTGGCCACCTAGGGCCAGG + Intronic
1035341799 7:158166992-158167014 GGCTGGTGCCAGCAAAGGCCTGG + Exonic
1037719280 8:21429216-21429238 AGCTGTGGCCAGCAGTGGCTAGG - Intergenic
1041063579 8:54059965-54059987 GGGTGTGGGCAGCAATGGCAAGG - Intronic
1043435828 8:80235812-80235834 GCCCCTGGCCTGCGATGGCCAGG + Intergenic
1048402646 8:134086409-134086431 GGACCTGGCCAGCAAAGCCCAGG + Intergenic
1048854459 8:138674410-138674432 AGCCCAGGCCAGTAATGGCCTGG - Intronic
1049284964 8:141769686-141769708 GGCCCTGAACAGGAATGGCCAGG + Intergenic
1049293607 8:141817672-141817694 GGCAGTGGGCAGGAATGGACAGG + Intergenic
1049347428 8:142146326-142146348 GGCCTTGCCCGGCATTGGCCCGG - Intergenic
1053308424 9:37000226-37000248 AGGGGTGGGCAGCAATGGCCGGG - Intronic
1057091598 9:92263025-92263047 GGCCGTGGCCAGCACCAGCAGGG + Exonic
1058271755 9:102981355-102981377 GGCCGTGACCAGCAAAGCCACGG + Intergenic
1061061026 9:128250632-128250654 GGGCGTGGCCAGCACTGGGCTGG + Intronic
1061308726 9:129748611-129748633 GGCCATGGCCAGGTGTGGCCAGG + Intronic
1061500410 9:130998412-130998434 TGCCCTGTGCAGCAATGGCCCGG + Intergenic
1062350328 9:136135561-136135583 GACAGTAGCCAGCAAGGGCCAGG - Intergenic
1062688111 9:137826776-137826798 GGCTGTGGCCTTCACTGGCCAGG + Intronic
1203791010 EBV:151532-151554 GGCCGTGGCCAGGTACGGGCTGG - Intergenic
1186223651 X:7375286-7375308 GTCCGTGGGCGGCCATGGCCAGG + Intergenic
1192081543 X:68052702-68052724 GGCCTTTGCCAGCAAAGGCAGGG - Intronic
1200117222 X:153774653-153774675 GGCCGGGGCCAGCATCAGCCAGG - Intronic
1200212256 X:154351959-154351981 GGCCCTCGACAGCAATGGCCAGG + Exonic
1201120563 Y:10869574-10869596 AGCAGTGGACAGCAATGGCGTGG - Intergenic
1201972917 Y:19816167-19816189 GGGCGTGGCCTGAAATGGCTGGG + Intergenic