ID: 1162348131

View in Genome Browser
Species Human (GRCh38)
Location 19:10133002-10133024
Sequence GCAGAGCTCTGTGCTGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162348131_1162348134 -5 Left 1162348131 19:10133002-10133024 CCAGTTGCAGCACAGAGCTCTGC No data
Right 1162348134 19:10133020-10133042 TCTGCCTCATGGTCACAGGATGG No data
1162348131_1162348133 -9 Left 1162348131 19:10133002-10133024 CCAGTTGCAGCACAGAGCTCTGC No data
Right 1162348133 19:10133016-10133038 GAGCTCTGCCTCATGGTCACAGG No data
1162348131_1162348136 11 Left 1162348131 19:10133002-10133024 CCAGTTGCAGCACAGAGCTCTGC No data
Right 1162348136 19:10133036-10133058 AGGATGGCTGCTCCACTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162348131 Original CRISPR GCAGAGCTCTGTGCTGCAAC TGG (reversed) Intergenic
No off target data available for this crispr