ID: 1162349020

View in Genome Browser
Species Human (GRCh38)
Location 19:10137699-10137721
Sequence AAGGCTGAGGACTCGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 724
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 666}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162349008_1162349020 12 Left 1162349008 19:10137664-10137686 CCCATGACCATGCAAGAGAGACC 0: 1
1: 0
2: 0
3: 12
4: 97
Right 1162349020 19:10137699-10137721 AAGGCTGAGGACTCGGGAGGAGG 0: 1
1: 0
2: 2
3: 55
4: 666
1162349013_1162349020 5 Left 1162349013 19:10137671-10137693 CCATGCAAGAGAGACCAGGGGTC 0: 1
1: 0
2: 3
3: 7
4: 162
Right 1162349020 19:10137699-10137721 AAGGCTGAGGACTCGGGAGGAGG 0: 1
1: 0
2: 2
3: 55
4: 666
1162349009_1162349020 11 Left 1162349009 19:10137665-10137687 CCATGACCATGCAAGAGAGACCA 0: 1
1: 1
2: 0
3: 16
4: 151
Right 1162349020 19:10137699-10137721 AAGGCTGAGGACTCGGGAGGAGG 0: 1
1: 0
2: 2
3: 55
4: 666
1162349015_1162349020 -9 Left 1162349015 19:10137685-10137707 CCAGGGGTCACACAAAGGCTGAG 0: 1
1: 0
2: 1
3: 14
4: 227
Right 1162349020 19:10137699-10137721 AAGGCTGAGGACTCGGGAGGAGG 0: 1
1: 0
2: 2
3: 55
4: 666

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162349020 Original CRISPR AAGGCTGAGGACTCGGGAGG AGG Intronic
900158919 1:1214214-1214236 AGGGCAGAGGAGGCGGGAGGAGG + Intergenic
900488707 1:2935727-2935749 GGGGATGAGGACTGGGGAGGAGG - Intergenic
900532647 1:3162267-3162289 AAGTCCCGGGACTCGGGAGGAGG - Intronic
900567908 1:3343718-3343740 GAGGCGGAGAACCCGGGAGGCGG - Intronic
901439602 1:9269739-9269761 AAGACTGAGGAAATGGGAGGGGG - Exonic
901652555 1:10751657-10751679 GAGGCTGAGAGCTCGGGAAGCGG + Intronic
902614400 1:17616006-17616028 CAGGCCGAGGCCTGGGGAGGCGG + Intronic
903085762 1:20857074-20857096 AATGTTGTGAACTCGGGAGGTGG + Intronic
903168815 1:21539739-21539761 AATGGTGTGAACTCGGGAGGTGG - Intronic
903456248 1:23489060-23489082 AATGCTGTGAACCCGGGAGGCGG - Intergenic
904135346 1:28307962-28307984 AATGCTGTGAACCCGGGAGGCGG - Intergenic
904445438 1:30570074-30570096 AAAGCTGAGGGCGGGGGAGGGGG + Intergenic
904672840 1:32179330-32179352 AACTCCGAGGACTCGGGAAGAGG - Intergenic
904832172 1:33312257-33312279 AGGGCTCAGCACTGGGGAGGTGG - Intronic
904984418 1:34533243-34533265 AATGGTGTGAACTCGGGAGGCGG - Intergenic
905390727 1:37634149-37634171 CAGGCTGCGGACTGGGGTGGGGG + Intronic
905517132 1:38570035-38570057 AAGGCTGCGGAGGCGCGAGGGGG - Intergenic
905642593 1:39601459-39601481 AATGCTGTGAACCCGGGAGGCGG + Intergenic
906281719 1:44559214-44559236 AAGGCTGAGGACTGGGGCTGGGG - Intronic
906360797 1:45156547-45156569 AAGACAGGGGACTCTGGAGGAGG + Intronic
906483019 1:46212844-46212866 AATGGTGTGAACTCGGGAGGTGG - Intronic
906608953 1:47189204-47189226 AAGTCTGGGGACTCTGCAGGTGG - Intronic
907283205 1:53363978-53364000 AAGGGTGGGGACTGGGGAGGAGG - Intergenic
909723584 1:78807063-78807085 AAGGGTGAGGAGGCAGGAGGGGG + Intergenic
910911808 1:92242816-92242838 AAGGCTGAGGAGATGGGAAGGGG + Intronic
910965181 1:92801108-92801130 AAGGCCGCGAACCCGGGAGGCGG + Intergenic
912379697 1:109240730-109240752 AAGGATGGGGACTCGGGGAGAGG - Intergenic
912522918 1:110258850-110258872 GAGGCTGAGGGCTGGGGAGCTGG - Intronic
912525572 1:110280376-110280398 AAGGTTGAAGACTCTGGGGGAGG + Intronic
912624681 1:111197330-111197352 AAGGCTGAGGGCTGGGGAGGGGG + Intronic
912703387 1:111894984-111895006 AAGGGAGAGGACTCAGGGGGAGG + Intronic
912704685 1:111903294-111903316 AAGGCTGAGCAGGTGGGAGGCGG + Intronic
912989691 1:114473168-114473190 AATGGTGTGAACTCGGGAGGCGG + Intronic
913524292 1:119676410-119676432 AATGGTGTGAACTCGGGAGGTGG - Intronic
914060994 1:144207889-144207911 ATGGAGGAGGACTCTGGAGGAGG + Intergenic
914118156 1:144758480-144758502 ATGGAGGAGGACTCTGGAGGAGG - Intergenic
914749698 1:150526261-150526283 AATGGTGTGAACTCGGGAGGCGG + Intergenic
915135362 1:153728032-153728054 AAGGCGGAGGGCGGGGGAGGGGG - Intergenic
915187853 1:154122566-154122588 AATGGTGTGAACTCGGGAGGTGG + Intronic
915244296 1:154545181-154545203 AAGGCTGAGTTCTCTGGAAGGGG + Intronic
915340256 1:155173423-155173445 AAGCCTGAGGACCAGGGCGGTGG - Exonic
916612968 1:166411022-166411044 AATGGTGTGAACTCGGGAGGTGG - Intergenic
917116431 1:171608502-171608524 AATGGTGTGAACTCGGGAGGCGG - Intergenic
917221332 1:172731872-172731894 AATGGCGTGGACTCGGGAGGCGG + Intergenic
918048834 1:180956940-180956962 AAGGCTGAGGAGTGGGGAGAGGG - Intergenic
918302146 1:183214295-183214317 AGGGCTGAGGACTGGGGAAGGGG + Intronic
919972278 1:202588995-202589017 AAAGTTGAGGTCTAGGGAGGTGG + Exonic
920159838 1:203988106-203988128 CAGGGTGAGGACGTGGGAGGAGG + Intergenic
920456437 1:206105081-206105103 AATGGTGTGGACCCGGGAGGCGG + Intergenic
921388552 1:214596120-214596142 AATGGTGTGAACTCGGGAGGCGG + Intergenic
923103249 1:230834336-230834358 AAGGCTGAGAAATCCTGAGGTGG - Intergenic
924473904 1:244367084-244367106 AAGGGTGCGGTCTAGGGAGGAGG + Intronic
1062822734 10:547226-547248 AAGGCTGTGGCCTCGCGATGGGG - Intronic
1062962283 10:1581468-1581490 CAGGCTGGGAACTCAGGAGGTGG - Intronic
1063368282 10:5504658-5504680 CAGGGTGAGGACTCGGAAGGTGG + Intergenic
1064313288 10:14231427-14231449 AAGGGTGTGAACCCGGGAGGTGG - Intronic
1064682781 10:17828161-17828183 AAGGGCGTGAACTCGGGAGGCGG - Intronic
1064788837 10:18932147-18932169 AAGGCAGAAGACTCAGGAGGAGG - Intergenic
1065093947 10:22262797-22262819 ATGTCTGAGGTCTGGGGAGGTGG + Intergenic
1066127315 10:32354365-32354387 AATGGTGTGGACCCGGGAGGCGG + Intronic
1066395787 10:35020261-35020283 AATGCTGAGAAGTGGGGAGGTGG + Intronic
1066631817 10:37465680-37465702 AATGCTGAGTACTGGAGAGGAGG - Intergenic
1067942642 10:50669354-50669376 ATGGCTTAGAACCCGGGAGGCGG + Intergenic
1068200729 10:53781288-53781310 ACGGCGGTGAACTCGGGAGGCGG - Intergenic
1068381170 10:56255361-56255383 AAGACTGAGTTCTCGGGACGAGG - Intergenic
1068794273 10:61061045-61061067 AAGGGTGAGGAGGTGGGAGGGGG - Intergenic
1069610265 10:69768136-69768158 GAGGCTGAGGACGTGAGAGGCGG - Intergenic
1070863881 10:79694309-79694331 ATGGCTTAGAACCCGGGAGGCGG + Intergenic
1071042004 10:81321977-81321999 AATGGTGAGAACCCGGGAGGCGG - Intergenic
1071206455 10:83285032-83285054 AATGGTGTGAACTCGGGAGGCGG + Intergenic
1071289272 10:84176884-84176906 CTGGCTGAGGACTGTGGAGGTGG + Intronic
1071299760 10:84247755-84247777 GAGCCTGTGGACTGGGGAGGGGG - Intronic
1071377279 10:85020660-85020682 GAGGCTGAGGACTTGAGATGAGG + Intergenic
1071588193 10:86845908-86845930 AATGGCGTGGACTCGGGAGGTGG + Intronic
1072431199 10:95372226-95372248 AAGCCTGAGGATTTGGGAGCTGG + Intronic
1072506307 10:96071000-96071022 AAAGGTGTGAACTCGGGAGGCGG + Intergenic
1072865889 10:99061139-99061161 AAGGCTGTGGACTAGGGTGGTGG + Intronic
1073304977 10:102495845-102495867 ATGGCTTTGGACCCGGGAGGCGG - Intronic
1073485959 10:103819414-103819436 AAGGCTGAGGGCTAGGGGAGGGG + Intronic
1074640936 10:115379911-115379933 AAGGGTGTGAACCCGGGAGGTGG - Intronic
1075446685 10:122518229-122518251 GAGGCTGAGGAGTCTGGAGCAGG + Intergenic
1075743876 10:124712918-124712940 TGGGGTGAGGACTTGGGAGGTGG - Intronic
1075817235 10:125273969-125273991 AAGGCAGAGGACGCAGGAGCTGG + Intergenic
1076897982 10:133323632-133323654 AATGGTGTGAACTCGGGAGGCGG + Intronic
1077003406 11:337298-337320 AATGGTGGGAACTCGGGAGGCGG - Intergenic
1077099775 11:817246-817268 AATGGTGTGAACTCGGGAGGCGG - Intergenic
1077257021 11:1590180-1590202 AAGGCTGGGGACTCCAGCGGAGG - Intergenic
1077283469 11:1755819-1755841 AAGGCGGAGGAGGCTGGAGGAGG - Intronic
1077880990 11:6349938-6349960 AATGGTGAGAACCCGGGAGGCGG + Intergenic
1078534252 11:12160498-12160520 AAGGTTCAGGATTCGTGAGGAGG - Intronic
1078599153 11:12715378-12715400 AAGCCTGGGGACTGGGGAGGAGG + Intronic
1078733926 11:14002509-14002531 AGGGCTGAAGACTGGGGAGATGG + Intronic
1078903972 11:15667193-15667215 AAGGCTGAGGACGATGGAGTTGG - Intergenic
1079702503 11:23566581-23566603 AATGGCGTGGACTCGGGAGGTGG - Intergenic
1080071326 11:28091900-28091922 AATGGTGAGAACCCGGGAGGCGG - Intronic
1080629918 11:34065044-34065066 AAAGGTGAGAACCCGGGAGGTGG - Intronic
1081635998 11:44722567-44722589 AATGGTGTGAACTCGGGAGGTGG + Intergenic
1081639442 11:44742792-44742814 AAGGATGAGGAGTCGGGTGCTGG - Intronic
1082256159 11:50035547-50035569 AATGGTGTGAACTCGGGAGGCGG + Intergenic
1082849542 11:57753165-57753187 AGGCCCGAGGACTCGGGAGGAGG - Intronic
1082853201 11:57783570-57783592 AATGCTGTGAACCCGGGAGGCGG + Intronic
1083100401 11:60299557-60299579 AATGGTGAGAACCCGGGAGGCGG - Intronic
1083624872 11:64067298-64067320 GAGGCTGAGCAGTGGGGAGGAGG - Intronic
1083817061 11:65139450-65139472 AATGGCGAGAACTCGGGAGGCGG - Intergenic
1083947245 11:65931085-65931107 AATGGTGTGGACCCGGGAGGCGG - Intergenic
1083983333 11:66192391-66192413 AAGGCTGAGGAGGCGTTAGGTGG + Intronic
1084194460 11:67516553-67516575 CAGGCTGAGGCCTGGGGAGGTGG + Intergenic
1084276973 11:68057404-68057426 AATGGTGTGAACTCGGGAGGTGG - Intronic
1084395088 11:68904188-68904210 GAGACTGACAACTCGGGAGGTGG - Intronic
1084438698 11:69158343-69158365 AAGCCAGAGGACTCAGGTGGAGG + Intergenic
1084471760 11:69365746-69365768 GAGGGTGAGGAGTGGGGAGGAGG + Intronic
1084612361 11:70211837-70211859 AATGCTGTGAACCCGGGAGGCGG - Intergenic
1084684176 11:70684202-70684224 AAGGGTGATGACTGGGTAGGGGG - Intronic
1084894744 11:72258011-72258033 AATGGTGTGAACTCGGGAGGAGG - Intergenic
1084905678 11:72344604-72344626 AGGGCTGAGGACTCGGGCTTCGG - Intronic
1084920920 11:72469056-72469078 AGGGCTGAGGACTGGGGAAGTGG + Intergenic
1084953330 11:72678579-72678601 AAGGCTGTGGACTGGGGCCGAGG - Intergenic
1085396606 11:76209889-76209911 CAGGCTGGGGGCTAGGGAGGAGG - Intronic
1086209507 11:84301570-84301592 AAGGGTGTGAACCCGGGAGGTGG + Intronic
1086984181 11:93230472-93230494 AATGGTGTGAACTCGGGAGGCGG + Intergenic
1088771226 11:113037816-113037838 AAGCCTAAGGACTACGGAGGAGG - Intronic
1089372428 11:117970916-117970938 AAGGGTGAGGACTGGGGTAGAGG + Intergenic
1090331073 11:125932586-125932608 AAGCCTGAGGATTCCGGAAGGGG - Intergenic
1091723652 12:2830955-2830977 AAGGCTCAGGGCTGGGGGGGTGG - Intronic
1091757088 12:3060851-3060873 AAGGCTGAGCACTTGAGATGAGG - Intergenic
1092133826 12:6132066-6132088 AAGGGTGTGAACCCGGGAGGCGG + Intergenic
1092167778 12:6353674-6353696 AATGGTGTGGACCCGGGAGGCGG - Intronic
1092719693 12:11429369-11429391 TAGGATGTGGACTCGGGAGTGGG - Intronic
1092875718 12:12845876-12845898 AAGGCTGAGGCCAGGGGCGGTGG - Intergenic
1093214351 12:16346211-16346233 AACGGTGTGAACTCGGGAGGCGG + Intergenic
1093643766 12:21557810-21557832 AATGGTGTGGACCCGGGAGGCGG + Intronic
1095669382 12:44840548-44840570 AATGGTGAGAACCCGGGAGGCGG + Intronic
1095961041 12:47834545-47834567 AAGGCTGAAGAGTGGGGTGGAGG + Intergenic
1095989884 12:48027392-48027414 AAGGCTGAGGCCTGGGGCGAGGG - Intergenic
1096183356 12:49563413-49563435 AAGGCTGAGGGCTGGGAAGGTGG - Intronic
1096214622 12:49792403-49792425 AAGGGAAAGGACTCGGGAGCAGG - Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096968248 12:55646067-55646089 AATGGTGAGAACCCGGGAGGCGG - Intergenic
1098182004 12:67857451-67857473 AATGGTGAGAACTCGGGAGGCGG - Intergenic
1098865008 12:75752301-75752323 AAGGCCAAGGACCTGGGAGGCGG - Intergenic
1100021901 12:90079066-90079088 AAGGCTGAGGACTAGGATTGAGG + Intergenic
1100076941 12:90796903-90796925 AATGGTGTGAACTCGGGAGGCGG - Intergenic
1100491156 12:95079468-95079490 AAGGCTGAGAGCTCAAGAGGAGG + Exonic
1100654721 12:96629388-96629410 AATGGTGTGAACTCGGGAGGTGG - Intronic
1100867009 12:98867773-98867795 AATGGTGTGGACCCGGGAGGAGG + Intronic
1100991163 12:100253001-100253023 AATGGTGTGGACTCGGGAGGCGG - Intronic
1101059321 12:100954557-100954579 AATGCAGAGGACTCAGAAGGAGG + Intronic
1101168278 12:102061814-102061836 CAGGGTGGGGACTCGGAAGGTGG + Intronic
1101484078 12:105133393-105133415 AAGGATAAGGACTGGGGTGGAGG - Intronic
1101860703 12:108480196-108480218 AAGCCAGAGGACTGGGGAGTGGG - Intergenic
1102010521 12:109615774-109615796 CTGGCTGAGGATTCTGGAGGGGG + Intergenic
1102031507 12:109742535-109742557 AAGGCTGGCGATTGGGGAGGGGG + Intronic
1102220364 12:111190302-111190324 ACTGCTCAGGACTCGGGAGTAGG + Intronic
1102290845 12:111698384-111698406 AAGGCTCACTACTCAGGAGGCGG - Intronic
1102306301 12:111807174-111807196 AATGGTGTGAACTCGGGAGGCGG + Intronic
1102319081 12:111915212-111915234 AATGGTGTGAACTCGGGAGGCGG + Intergenic
1102715698 12:114970027-114970049 AATGGTGTGAACTCGGGAGGCGG + Intergenic
1102780852 12:115563323-115563345 AAGGATGAGGTGGCGGGAGGTGG - Intergenic
1102870912 12:116413232-116413254 AAAATTGAGGACTCGGGAGTTGG + Intergenic
1103290157 12:119838893-119838915 AAGGCTGGGGGCACAGGAGGAGG + Intronic
1103599826 12:122047435-122047457 AATGGTGTGAACTCGGGAGGCGG + Intronic
1104425862 12:128677653-128677675 AGGGCTGAGGACCAGGGTGGGGG - Intronic
1104880524 12:132067691-132067713 GAGGCTGAGGTCTTGGCAGGGGG + Intronic
1104910527 12:132238168-132238190 AAGGCTAAGGACGCGGGCAGGGG + Intronic
1105291785 13:19058115-19058137 AAGGCTGGGGACGCTGGAGCAGG + Intergenic
1106912042 13:34473201-34473223 AATGGTGTGAACTCGGGAGGTGG - Intergenic
1108056025 13:46486198-46486220 AAGCCTGAGGACTTGGATGGAGG - Intergenic
1108193355 13:47965959-47965981 AATGGTGAGAACCCGGGAGGTGG + Intronic
1109871356 13:68338265-68338287 AATGGTGTGAACTCGGGAGGTGG - Intergenic
1111252934 13:85628583-85628605 AATGGTGTGGACCCGGGAGGCGG - Intergenic
1111306131 13:86414926-86414948 AGGGGAGAGGACTGGGGAGGAGG - Intergenic
1112477339 13:99744057-99744079 AATGCTGTGAACCCGGGAGGCGG - Intronic
1112796076 13:103058006-103058028 CAGACTGAGGGCTGGGGAGGGGG + Intronic
1114029574 14:18566186-18566208 AATGCTGTGAACCCGGGAGGTGG - Intergenic
1114323099 14:21563505-21563527 AATGGTGTGGACCCGGGAGGCGG - Intergenic
1114735577 14:25040280-25040302 GAGGCAGAGGACAAGGGAGGTGG + Intronic
1115995693 14:39193714-39193736 AATGATGTGAACTCGGGAGGCGG - Intergenic
1117616777 14:57542191-57542213 AATGGTGAGAACCCGGGAGGCGG - Intergenic
1118749802 14:68797233-68797255 AAGGCAGAGGCCTCAGGAGAGGG + Intergenic
1118834369 14:69465885-69465907 AATGCTGTGAACCCGGGAGGCGG + Intergenic
1118875667 14:69782719-69782741 AATGGTGTGAACTCGGGAGGTGG + Intronic
1119180037 14:72599493-72599515 AATGGTGTGAACTCGGGAGGCGG - Intergenic
1119239965 14:73051238-73051260 AATGCTGTGAACCCGGGAGGCGG - Intergenic
1119809408 14:77503962-77503984 AATGGTGCGAACTCGGGAGGCGG - Intergenic
1120870190 14:89329767-89329789 AATGCTGTGAACCCGGGAGGCGG + Intronic
1121039121 14:90730517-90730539 AAGGCTGGGGACACGGAAGCGGG + Intronic
1121413389 14:93762873-93762895 AGGGCTGAGGCCTGGGGTGGAGG - Intronic
1121417337 14:93788519-93788541 AGGGCGGGGGACTGGGGAGGCGG - Intergenic
1121680973 14:95792490-95792512 GAGGCTGAGGGCCTGGGAGGGGG + Intergenic
1121778057 14:96603756-96603778 AAGGCAGAGGACTTGGGTTGGGG + Intergenic
1122731602 14:103803554-103803576 AATGCTGTGAACCCGGGAGGTGG + Intronic
1122873082 14:104650453-104650475 AAGGCTGACGACGGGGGAGGAGG - Intergenic
1123998532 15:25735147-25735169 AGGGCTGAGCCCACGGGAGGTGG + Intronic
1124037968 15:26073836-26073858 AAGGCTGACGACTGTGTAGGTGG + Intergenic
1125508551 15:40281156-40281178 GAGCCTGAGGGCTGGGGAGGGGG + Intronic
1125639105 15:41214830-41214852 AATGGTGTGAACTCGGGAGGCGG - Intronic
1125777670 15:42232558-42232580 AATGGTGTGAACTCGGGAGGCGG - Intronic
1125809482 15:42525279-42525301 AAGGGTGTGAACCCGGGAGGCGG + Intronic
1125828189 15:42693268-42693290 AAGAGTGAGGATTGGGGAGGAGG - Exonic
1125911142 15:43440426-43440448 AATGGTGTGGACCCGGGAGGCGG + Intronic
1126231243 15:46328191-46328213 AATGCTGTGAACCCGGGAGGCGG - Intergenic
1126444033 15:48721727-48721749 CAGGCTGAGGGCTCAGGAAGTGG + Intronic
1126575846 15:50195402-50195424 AATGCTGTGAACCCGGGAGGCGG + Intronic
1126974369 15:54158413-54158435 AATGGTGAGAACCCGGGAGGTGG - Intronic
1127086461 15:55428579-55428601 AATGGCGAGAACTCGGGAGGCGG - Intronic
1127487526 15:59433053-59433075 AATGGTGTGAACTCGGGAGGTGG + Intronic
1127975050 15:63990934-63990956 CAGGCAGAGGAGTAGGGAGGGGG - Intronic
1128058835 15:64720676-64720698 AATGGTGTGAACTCGGGAGGCGG - Intergenic
1128165884 15:65464274-65464296 AAGGGTGTGAACCCGGGAGGTGG + Intronic
1129107744 15:73320905-73320927 AAATCTCAGGACTCAGGAGGTGG - Exonic
1129165618 15:73775487-73775509 GAGGCTGAGGAGTAGGGAGAGGG + Intergenic
1129355383 15:74987432-74987454 GTAGCTGAGGACTTGGGAGGGGG + Intronic
1129676813 15:77636201-77636223 GAGGCTGAGGAGGCAGGAGGTGG + Intronic
1129819067 15:78584133-78584155 AAGGGTGAGGGCTCTGGAGATGG + Intronic
1130060254 15:80564426-80564448 GAGGCTGAGGACTCAGAGGGTGG - Intronic
1130116961 15:81013775-81013797 CAGGCTGAGGACTGCGGAAGCGG - Intronic
1130903272 15:88223097-88223119 AGAGCTGCGGGCTCGGGAGGCGG + Intronic
1130995130 15:88899292-88899314 AGGGCTGGGGACTGGGGAAGGGG - Exonic
1132385550 15:101397736-101397758 AAGGCTGAGGAAGGGGGAGGAGG - Intronic
1132760570 16:1506830-1506852 AAGGCGGTGGGCACGGGAGGAGG + Intronic
1132772597 16:1572557-1572579 AATGGTGTGGACCCGGGAGGTGG + Intronic
1132852250 16:2030067-2030089 GAGGCTGGGGGCTGGGGAGGCGG - Intronic
1132936668 16:2484714-2484736 AGGGCTGAGGCCTAGGGCGGTGG + Intronic
1132998738 16:2838565-2838587 AAGGCAGAGGAGTTGGAAGGAGG + Intronic
1134105593 16:11484092-11484114 AATGGTGTGAACTCGGGAGGCGG - Intronic
1135116245 16:19726000-19726022 AATGGTGTGAACTCGGGAGGTGG - Intronic
1135642525 16:24133457-24133479 AAGGCTGAAGCCTGTGGAGGAGG - Intronic
1135810936 16:25586272-25586294 AATGGTGTGAACTCGGGAGGCGG - Intergenic
1136451919 16:30358385-30358407 GAGGCTGAGGAGGCTGGAGGAGG + Exonic
1136506249 16:30705483-30705505 ATGGCTGTGAACCCGGGAGGCGG - Intronic
1137486768 16:48897792-48897814 GATGCTGAGGAGTGGGGAGGAGG + Intergenic
1138194725 16:55043722-55043744 AGGACTGAGGGCTCCGGAGGAGG + Intergenic
1138249568 16:55491674-55491696 AAGGCTGAGAACCCTGGAAGCGG - Intronic
1138451792 16:57097716-57097738 AAGACTGGGGGCTGGGGAGGTGG - Intronic
1138476468 16:57273171-57273193 AATGGTGTGAACTCGGGAGGCGG + Intronic
1138862418 16:60774525-60774547 AAGGGTGTGAACCCGGGAGGTGG + Intergenic
1139577281 16:67849743-67849765 AATGCTGTGAACCCGGGAGGCGG - Intronic
1139918395 16:70442274-70442296 AATGGTGTGAACTCGGGAGGTGG + Intergenic
1140470543 16:75211758-75211780 AAGGCAGAGGACTTGGGAGCTGG + Intergenic
1141002603 16:80322422-80322444 AATGGTGTGAACTCGGGAGGCGG + Intergenic
1141578932 16:84983903-84983925 GAGGCAGAGCACCCGGGAGGTGG + Intronic
1141658618 16:85429670-85429692 AGGTCTGAGGACAGGGGAGGAGG - Intergenic
1141815301 16:86405390-86405412 AAGGTTGACGACTCGGGAAGGGG - Intergenic
1141899820 16:86983842-86983864 AAGGCTGGGGAGTTTGGAGGTGG + Intergenic
1142063570 16:88046977-88046999 AATGGTGTGGACCCGGGAGGTGG + Intronic
1142745669 17:1956412-1956434 AAGGCTGAGGACTCAAGTGGGGG + Intronic
1143367937 17:6420577-6420599 AAGGCAGAGGGCACGGGAGCCGG + Intronic
1143495486 17:7309962-7309984 GAGGCTGAAGACTGGGGAGCAGG - Intronic
1144355885 17:14445709-14445731 AATGCTGTGAACACGGGAGGCGG + Intergenic
1144507053 17:15841126-15841148 AATGGTGTGGACCCGGGAGGTGG - Intergenic
1144552802 17:16256422-16256444 GAGGCAGAGGAATCGGGAGGTGG - Intronic
1144678111 17:17174746-17174768 AATGGTGTGAACTCGGGAGGCGG + Intronic
1144756401 17:17682561-17682583 AAGGCAGGGAACCCGGGAGGAGG + Intronic
1144918055 17:18740845-18740867 AATGGTGAGAACCCGGGAGGTGG - Intergenic
1145148517 17:20500340-20500362 AATGGTGTGAACTCGGGAGGTGG + Intergenic
1145171178 17:20658723-20658745 AATGGTGTGGACCCGGGAGGCGG - Intergenic
1145973006 17:28967956-28967978 AATGCTGAGGATGCAGGAGGGGG + Intronic
1146027143 17:29331380-29331402 AAGGATGAGGAAGCAGGAGGGGG - Intergenic
1146796594 17:35785532-35785554 AATGGTGTGAACTCGGGAGGCGG - Intronic
1147000420 17:37358770-37358792 AGGTCTGGGGTCTCGGGAGGTGG - Intronic
1147346695 17:39802133-39802155 AATGCTGTGAACCCGGGAGGCGG + Intronic
1148071959 17:44913874-44913896 AAGGCTGAGGAATGGGGAGAAGG - Intronic
1148375309 17:47139351-47139373 AAGGGCGTGAACTCGGGAGGCGG - Intronic
1148597065 17:48865317-48865339 AATGGTGTGAACTCGGGAGGCGG - Intronic
1148858809 17:50593475-50593497 AGGGCTGAGTGCTGGGGAGGGGG - Intronic
1149386879 17:56151120-56151142 AAGACTGAGGACCAGAGAGGTGG - Intronic
1149610712 17:57955942-57955964 AATGCTGAGGACACAGGAGATGG + Intergenic
1149761455 17:59234262-59234284 AATGGTGTGAACTCGGGAGGCGG + Intronic
1150395703 17:64820293-64820315 AATGGTGTGGACCCGGGAGGCGG - Intergenic
1150513040 17:65776319-65776341 AATGGTGTGAACTCGGGAGGCGG - Intronic
1150599941 17:66642214-66642236 AATGGTGTGAACTCGGGAGGTGG - Intronic
1151389365 17:73775521-73775543 AAGGCTGAGGGCTGGAGAGAAGG + Intergenic
1151451205 17:74199487-74199509 AAGGATGGGGAGTCGGGTGGCGG - Intergenic
1151464132 17:74273662-74273684 AATGGTGTGAACTCGGGAGGCGG + Intergenic
1151580188 17:74973020-74973042 AAGGGTGAGGACCGGGGCGGGGG - Intronic
1152562984 17:81087799-81087821 AAGGCTGGGGACACGGGAAGAGG - Intronic
1152687487 17:81701763-81701785 TAGGCTGAGGACAAGGGAGGTGG - Exonic
1152769300 17:82157566-82157588 AAGGCGGAGGAATGGGGAGAGGG + Intronic
1152823304 17:82448270-82448292 AGGTCTGAGGACCAGGGAGGAGG + Intronic
1152823320 17:82448351-82448373 AGGTCTGAGGACCAGGGAGGAGG + Intronic
1152823336 17:82448432-82448454 AGGTCTGAGGACCAGGGAGGAGG + Intronic
1152823352 17:82448513-82448535 AGGTCTGAGGACCAGGGAGGAGG + Intronic
1152823368 17:82448594-82448616 AGGTCTGAGGACCAGGGAGGAGG + Intronic
1152823384 17:82448675-82448697 AGGTCTGAGGACCAGGGAGGAGG + Intronic
1152823400 17:82448756-82448778 AGGTCTGAGGACCAGGGAGGAGG + Intronic
1152823416 17:82448837-82448859 AGGTCTGAGGACCAGGGAGGAGG + Intronic
1153012486 18:551681-551703 AGGGTTGAGGAGTCGTGAGGGGG - Intergenic
1153770502 18:8412044-8412066 AAGGCTGAGGAAAAGGGAGGTGG + Intergenic
1154947393 18:21175791-21175813 AAGGGCGAGAACCCGGGAGGCGG + Intergenic
1155146057 18:23084677-23084699 AAGGGTGTGAACCCGGGAGGCGG - Intergenic
1155969401 18:32067164-32067186 AATGGTGTGAACTCGGGAGGCGG + Intronic
1156333498 18:36148178-36148200 AATGGTGTGAACTCGGGAGGCGG - Intronic
1156429568 18:37057512-37057534 AATGGTGTGAACTCGGGAGGCGG - Intronic
1156557020 18:38078953-38078975 AAGGCTGAAGACTTCTGAGGAGG + Intergenic
1156601418 18:38611558-38611580 AAAGCAGAAGACTGGGGAGGCGG + Intergenic
1157247593 18:46068382-46068404 AATGCTGTGAACTTGGGAGGTGG - Intronic
1157498649 18:48173780-48173802 AGGGCTGTGGACTTTGGAGGAGG - Intronic
1158774795 18:60564246-60564268 AATGCTGTGAACTTGGGAGGTGG + Intergenic
1159072775 18:63644854-63644876 AAAGCTGAGCACTCAGGAGAAGG - Intronic
1160447132 18:78936661-78936683 AAGGCTGAGGGCCAGGGAGGTGG + Intergenic
1160447151 18:78936707-78936729 AAGGCTGAGGGCCAGGGAGGTGG + Intergenic
1160447167 18:78936753-78936775 AAGGCTGAGGGCCAGGGATGTGG + Intergenic
1160585056 18:79909553-79909575 AAGGCTGGGGACTCTGGTGAGGG - Intronic
1160585195 18:79910045-79910067 AAGGCTGGGGACTCTGGCGAGGG - Intronic
1160755210 19:753470-753492 AATGCTGTGAACCCGGGAGGTGG - Intronic
1161124558 19:2548392-2548414 AATGCCGTGAACTCGGGAGGCGG + Intronic
1161156583 19:2734976-2734998 GAGGCTGGGGGCTCGGGAGTAGG + Intronic
1161643446 19:5437750-5437772 GAGGCAGTGGACTGGGGAGGGGG - Intergenic
1161690782 19:5732517-5732539 AATGGTGTGAACTCGGGAGGTGG - Intronic
1162144575 19:8605769-8605791 AAGGCTGTGAACAGGGGAGGCGG - Exonic
1162321009 19:9970587-9970609 TAAGCTGAGGACCCAGGAGGTGG + Intronic
1162349020 19:10137699-10137721 AAGGCTGAGGACTCGGGAGGAGG + Intronic
1163127119 19:15250302-15250324 AATGGTGAGGACCCTGGAGGTGG - Intronic
1163267683 19:16231199-16231221 AATGGTGTGAACTCGGGAGGCGG + Intronic
1163358183 19:16828631-16828653 AATGGTGTGAACTCGGGAGGCGG + Intergenic
1163624557 19:18381758-18381780 AAAGGCGAGAACTCGGGAGGCGG - Intronic
1165058417 19:33193733-33193755 GAGGCTGGGGACTTGGGAGGAGG - Intronic
1165461221 19:35945297-35945319 CAGTCTGAGGACCCCGGAGGAGG + Exonic
1165554662 19:36619815-36619837 AATGGTGTGAACTCGGGAGGCGG - Intronic
1165899948 19:39164659-39164681 AAGGCTGTGAACTCTGGAGTGGG + Intronic
1166002175 19:39884136-39884158 AATGGTGTGAACTCGGGAGGCGG + Intronic
1166004959 19:39900387-39900409 AATGGTGTGAACTCGGGAGGCGG + Intronic
1166007329 19:39916522-39916544 GAGGGTGAGGACCCGGGAGGAGG - Intronic
1166228932 19:41414300-41414322 CAGGGTTAGGACTCTGGAGGGGG + Intronic
1166320890 19:42018235-42018257 AATGGTGTGGACCCGGGAGGTGG + Intronic
1166364827 19:42273053-42273075 AAGGCTGGAGACTTGGGTGGTGG - Intronic
1166761482 19:45227202-45227224 AATGGTGAGAACCCGGGAGGCGG - Intronic
1166763885 19:45241134-45241156 GAGGCTGGGGACCAGGGAGGAGG - Intronic
1166831570 19:45642500-45642522 AAGGAAGAGGACTCTGAAGGGGG + Exonic
1166957403 19:46474066-46474088 AATGCTGTGAACCCGGGAGGTGG - Intergenic
1167033611 19:46979651-46979673 AGGGCTGAGGAGGAGGGAGGAGG - Intronic
1167361132 19:49031137-49031159 GAGGCTGAGGCCTCGGGGGCAGG + Intronic
1167482213 19:49740027-49740049 GAGGCTGAGGGCATGGGAGGAGG - Intronic
1167622407 19:50567333-50567355 AGGGCTGAAGACTGGGGAGGGGG + Intronic
1167768325 19:51499038-51499060 AAGGCTGAGGCTGAGGGAGGGGG + Intronic
1168011579 19:53537720-53537742 AACGCTGGGGCCTCGGGAGAGGG - Intronic
1168072000 19:53958577-53958599 GGGGCTGGGGACGCGGGAGGGGG + Intergenic
1168182945 19:54675519-54675541 AATGGTGTGAACTCGGGAGGCGG - Intronic
1168288357 19:55345494-55345516 GAGGATGAGGATGCGGGAGGTGG + Intronic
1168467042 19:56611335-56611357 AAGGATGAGGACTCGGGCTCTGG + Intronic
1202700402 1_KI270712v1_random:159777-159799 ATGGAGGAGGACTCTGGAGGAGG + Intergenic
926306594 2:11641570-11641592 AATGGTGAGAACCCGGGAGGCGG - Exonic
926635538 2:15175051-15175073 AATGGTGTGGACCCGGGAGGTGG - Intronic
926954855 2:18283286-18283308 AATGGTGTGAACTCGGGAGGCGG + Intronic
927207727 2:20620653-20620675 GAGACTGAGGACCAGGGAGGAGG - Intronic
927641387 2:24847844-24847866 AGAGCTGAGGAGTCTGGAGGAGG + Intronic
927681835 2:25144870-25144892 AAGGCAGAGGGGTAGGGAGGTGG + Intronic
928402006 2:30985814-30985836 AAGGCTGAGGGGAGGGGAGGGGG - Intronic
928484504 2:31716556-31716578 AAGGGCGTGAACTCGGGAGGCGG + Intergenic
929122019 2:38491189-38491211 ACTGCTCAGGACTGGGGAGGAGG - Intergenic
929451723 2:42042487-42042509 GGGGCTGAGGACTAGAGAGGGGG - Intergenic
929595489 2:43173092-43173114 AATGGTGTGAACTCGGGAGGTGG - Intergenic
929826559 2:45313451-45313473 AAGGGTTAGGATTTGGGAGGAGG + Intergenic
929946170 2:46374217-46374239 AGGGCTGATGAATGGGGAGGAGG + Intronic
930130801 2:47848035-47848057 AATGCTGTGAACCCGGGAGGTGG + Intronic
931310586 2:61076078-61076100 AATGGTGTGAACTCGGGAGGCGG - Intronic
931438592 2:62270490-62270512 AATGGTGCGAACTCGGGAGGCGG + Intergenic
931536693 2:63285345-63285367 AATGGTGTGAACTCGGGAGGTGG + Intronic
931598996 2:63983527-63983549 AATGCTGTGAACTCAGGAGGTGG - Intronic
932604059 2:73152266-73152288 AAGGTTGAGGACACAGGAGGTGG + Intronic
932695604 2:73953803-73953825 AATGCTGTGAACCCGGGAGGCGG - Intronic
933039218 2:77440325-77440347 AATGGTGTGAACTCGGGAGGTGG + Intronic
933348520 2:81122923-81122945 AATGGCGAGAACTCGGGAGGCGG - Intergenic
933460595 2:82578525-82578547 AATGGTGTGAACTCGGGAGGCGG + Intergenic
933678724 2:85079957-85079979 AATGCTGTGAACCCGGGAGGTGG - Intergenic
933813510 2:86048166-86048188 CAGCCTGAGGAGTGGGGAGGAGG - Intronic
933974331 2:87496324-87496346 AAGGCAGAGGCCTCAGCAGGAGG - Intergenic
934009602 2:87805771-87805793 AATGGTGTGAACTCGGGAGGTGG + Intronic
934810051 2:97270014-97270036 CAGCCTGAGGACACTGGAGGAGG - Intergenic
934827641 2:97437925-97437947 CAGCCTGAGGACACTGGAGGAGG + Intergenic
935794775 2:106630589-106630611 AAGGCTGAAGACCCTGGAGCTGG + Intergenic
935860390 2:107323000-107323022 AATGGTGAGAACCCGGGAGGCGG - Intergenic
936319493 2:111454495-111454517 AAGGCAGAGGCCTCAGCAGGAGG + Intergenic
936531306 2:113278530-113278552 AAGGATGAGGCCTGGGGAGGGGG - Exonic
936883955 2:117286590-117286612 AATGGTGTGAACTCGGGAGGTGG + Intergenic
937391544 2:121492300-121492322 AATGGTGAGAACCCGGGAGGCGG + Intronic
937418345 2:121735265-121735287 AAAGGTGAGGACTCTGGAGTTGG - Intronic
937996645 2:127699164-127699186 AACGCTGAGGTCTCAGGAGGAGG + Intergenic
938140941 2:128794168-128794190 AGTGATGAGGACTGGGGAGGTGG - Intergenic
938287018 2:130127576-130127598 AAGTCTGGGGACTGGGAAGGGGG - Intronic
938428575 2:131211294-131211316 AAGTCTGGGGACTGGGAAGGGGG + Intronic
938717403 2:134033481-134033503 AAGGCTGTGCTCTCAGGAGGTGG - Intergenic
938726501 2:134113408-134113430 AAGACTGAGGAGGGGGGAGGGGG - Intergenic
939375944 2:141367567-141367589 AATGGTGAGAACTGGGGAGGCGG - Intronic
939519816 2:143215586-143215608 AAGGCTAACGACTTGGGATGGGG + Intronic
941938198 2:171003185-171003207 AAGGGTGTGGACCCGGGAGGCGG + Intronic
942195746 2:173517747-173517769 AATGGTGTGGACCCGGGAGGTGG + Intergenic
942348802 2:175031252-175031274 AACTCTGAGGACTCAGGAGCTGG - Intergenic
942451504 2:176110920-176110942 AAGGCTGAGAATTCTGGCGGGGG + Intronic
942627406 2:177916844-177916866 ATGGCGGTGGACCCGGGAGGCGG - Intronic
943089258 2:183354614-183354636 ATGGCGGAGAACCCGGGAGGCGG - Intergenic
944315992 2:198286409-198286431 AAGGCTGGGGTCTCGGTATGGGG - Intronic
944318019 2:198304419-198304441 AAGGCTGATGGCTGAGGAGGTGG - Intronic
945833395 2:214811130-214811152 AAGGATGAGGAATGGAGAGGAGG - Intergenic
945851779 2:215016494-215016516 AATGGTGAGAACCCGGGAGGCGG + Intronic
946235738 2:218323450-218323472 AAGCGTGCGGGCTCGGGAGGCGG + Intronic
946409251 2:219508244-219508266 AAGGGTCAGGACTAGGGGGGAGG - Intergenic
946618331 2:221533444-221533466 ATGGCTGATGACTCGGAGGGAGG + Intronic
946679085 2:222194575-222194597 CAGGCTGAGGACTCGAGCAGAGG - Intergenic
946915170 2:224512180-224512202 AATGGTGTGGACCCGGGAGGTGG - Intronic
948285842 2:236784433-236784455 AATGGTGTGAACTCGGGAGGTGG + Intergenic
948473499 2:238202341-238202363 AATGCTGAGGACTCTTGAGGAGG - Intronic
948777867 2:240299239-240299261 CAGGCTGAGGAGCCCGGAGGAGG - Intergenic
948800157 2:240429838-240429860 ACGGCTGAGGACCAGGGAGGAGG - Intergenic
948800166 2:240429881-240429903 ACAGCCGAGGACTTGGGAGGAGG - Intergenic
1168891003 20:1295341-1295363 AAGCCTAAGGACTCGGGGGCAGG + Intronic
1168945813 20:1756511-1756533 AATGGTGTGAACTCGGGAGGCGG - Intergenic
1168976841 20:1973095-1973117 AGGGCTGAGGATTCCTGAGGAGG - Intergenic
1169137599 20:3206742-3206764 AATGGTGGGGACCCGGGAGGCGG + Intergenic
1169530627 20:6481313-6481335 AAGGCTGAGGCCTCAGAAGGTGG + Intergenic
1170215434 20:13885948-13885970 AATGGTGTGAACTCGGGAGGCGG + Intronic
1170629207 20:18053964-18053986 AAGGCTGGGGAGAAGGGAGGCGG - Intronic
1171256658 20:23693687-23693709 AGGGCTGGGGACTAGGGATGAGG - Intergenic
1172488683 20:35316723-35316745 AATGCTGTGAACCCGGGAGGCGG - Intronic
1172524731 20:35592489-35592511 AAGGCTGAGGGTTAGGTAGGAGG + Intergenic
1172644084 20:36459087-36459109 CAGGCTGGGGATTAGGGAGGGGG + Intronic
1172753062 20:37264470-37264492 ATGGCTCAGGACCCAGGAGGCGG + Intergenic
1172941722 20:38658991-38659013 GAGGTGGAGGACTTGGGAGGTGG - Intergenic
1173075149 20:39811186-39811208 AAGGCTGGGGACCAAGGAGGAGG + Intergenic
1173095885 20:40027796-40027818 AACTTTGGGGACTCGGGAGGGGG - Intergenic
1173850216 20:46213107-46213129 AAGGCTGAGGACTCAGACGTGGG - Exonic
1174139114 20:48400452-48400474 AAGGCTGCAGAGACGGGAGGAGG + Intergenic
1174394270 20:50236910-50236932 AATGGTGTGAACTCGGGAGGCGG + Intergenic
1174403280 20:50287775-50287797 AAGGCTGAGGCCACAGGTGGTGG - Intergenic
1174759589 20:53193949-53193971 AAGTCTGAGCACTGAGGAGGAGG - Intronic
1174885607 20:54330378-54330400 AATGCTGCGAACCCGGGAGGCGG + Intergenic
1175482630 20:59322207-59322229 AAGGCTGAGCACTCGGTGGGTGG - Intronic
1175956008 20:62609806-62609828 GAGGCTGGGGACTTGGGGGGTGG + Intergenic
1175966376 20:62661962-62661984 GACGCTGAGGACTTGGGTGGTGG - Intronic
1175990382 20:62785606-62785628 CAGACTGTGGGCTCGGGAGGCGG - Intergenic
1176059213 20:63164970-63164992 AGGGCTGAGAACTCAGGTGGAGG + Intergenic
1176077517 20:63254997-63255019 CGGGCCGAGGACTCAGGAGGAGG + Intronic
1176224001 20:63984332-63984354 AATGCTGTGAACCCGGGAGGCGG + Intronic
1176677974 21:9798780-9798802 AGTGCTGAGGACTGGGGAGGAGG + Intergenic
1177061493 21:16380022-16380044 AATGCTGTGAACCCGGGAGGTGG - Intergenic
1177611700 21:23457155-23457177 AATGGTGAGAACCCGGGAGGCGG + Intergenic
1178434739 21:32548071-32548093 AAGGATGAGGGAGCGGGAGGGGG - Intergenic
1178701317 21:34835669-34835691 AAGGCTGAGGAAGCAGCAGGAGG - Intronic
1178915954 21:36705658-36705680 AAGGAGGGGGAGTCGGGAGGAGG + Intronic
1178941647 21:36911660-36911682 AATGGTGTGGACTCGGGAGGCGG + Intronic
1179222128 21:39417850-39417872 AATGGTGTGAACTCGGGAGGCGG - Intronic
1179520400 21:41939902-41939924 TTGTCTGAGGAGTCGGGAGGCGG + Intronic
1180020947 21:45126628-45126650 AAGGCTGAGGTCTAGGGTGGTGG + Intronic
1180091227 21:45534707-45534729 AAGGCTGAGGAAGAGGGAGTAGG - Intronic
1180453690 22:15493236-15493258 AATGCTGTGAACCCGGGAGGTGG - Intergenic
1180734156 22:18003071-18003093 AATGGTGTGAACTCGGGAGGCGG + Intronic
1181321625 22:22011617-22011639 AATGGTGTGAACTCGGGAGGCGG - Intergenic
1181425724 22:22837279-22837301 AATGGTGTGAACTCGGGAGGTGG - Intronic
1181540694 22:23571619-23571641 AAGACTGAGGGATGGGGAGGGGG - Intergenic
1181956209 22:26589684-26589706 GAGGTTGGGGACTCCGGAGGCGG + Intronic
1182275641 22:29186870-29186892 GAGGCTGAGGAGTGGGGTGGGGG + Intergenic
1182318468 22:29463360-29463382 AAGGCAAAAGACTTGGGAGGCGG + Intergenic
1182929395 22:34158286-34158308 AAGGGTGTGAACCCGGGAGGCGG + Intergenic
1182977865 22:34640371-34640393 CAGGCTGAGGACTCGGGGGCAGG + Intergenic
1183449703 22:37886105-37886127 AATGGTGTGAACTCGGGAGGTGG + Intronic
1183558793 22:38553409-38553431 AATGGTGTGAACTCGGGAGGCGG + Intronic
1184111772 22:42399679-42399701 AAGGCTGGGGAGTCACGAGGCGG + Intronic
1184151313 22:42640744-42640766 AAGGCTGAGGAGGAGGCAGGGGG - Intronic
1184790102 22:46694965-46694987 AGGGATGAGGACTCTGGGGGAGG - Intronic
1185013805 22:48331974-48331996 GAGGCTGGGGACAAGGGAGGAGG - Intergenic
1185024275 22:48398726-48398748 AAGGCTGAGCAGTGGGCAGGAGG - Intergenic
1185325550 22:50224160-50224182 AAGGCTGAAGTCCCTGGAGGAGG - Exonic
1185379709 22:50502810-50502832 AATGCTGAGGACGGGGCAGGAGG + Intergenic
1185406068 22:50651690-50651712 AATGGTGTGAACTCGGGAGGTGG + Intergenic
949861203 3:8506412-8506434 AAGGCTGGGGACCAGGAAGGAGG + Intronic
950054510 3:10013794-10013816 AATGGTGTGAACTCGGGAGGCGG - Intergenic
950061938 3:10078860-10078882 GAGGCTGAGGCATGGGGAGGAGG + Intronic
950112193 3:10426430-10426452 CAGGCTGAAGACTGGGGAGCTGG + Intronic
951276126 3:20688374-20688396 AATGGTGTGAACTCGGGAGGTGG + Intergenic
952146887 3:30542832-30542854 AATGGTGTGAACTCGGGAGGTGG + Intergenic
952567690 3:34679241-34679263 AATGCTGAGGAATGTGGAGGTGG - Intergenic
952823904 3:37509044-37509066 AGGGCTGAGGATTAGGGAAGGGG - Intronic
952909200 3:38167296-38167318 GAGGCTGGGGACTGGGGATGAGG + Intronic
953226794 3:41028654-41028676 AATGGTGTGAACTCGGGAGGTGG + Intergenic
953548836 3:43884842-43884864 AGGGCTGAGGCAGCGGGAGGAGG + Intergenic
954205174 3:49053396-49053418 AATGGTGTGAACTCGGGAGGCGG + Intronic
954212770 3:49107630-49107652 AAAGCTGAGGACAGGAGAGGAGG + Intergenic
954268678 3:49490264-49490286 AATGATGTGGACCCGGGAGGTGG + Intronic
955906338 3:63811469-63811491 AATGGTGTGAACTCGGGAGGCGG + Intergenic
957692663 3:83592800-83592822 AATGGTGTGAACTCGGGAGGCGG - Intergenic
959257752 3:104036538-104036560 AATGGTGTGGACCCGGGAGGTGG - Intergenic
959412211 3:106038343-106038365 AATGGTGTGAACTCGGGAGGCGG - Intergenic
961331856 3:126147246-126147268 ATGGCTGGGGACTAGGAAGGTGG + Intronic
961640883 3:128364198-128364220 GAGGCTTAGGGCTCGGGCGGGGG + Intronic
962169241 3:133083185-133083207 CAGGCTGAGGAGTGGGGCGGCGG - Intronic
963248541 3:143084399-143084421 AAGGGTGAGAACCTGGGAGGCGG - Intergenic
964419715 3:156488696-156488718 AATGCTTAGGACTCTGGAGTTGG - Intronic
965934365 3:174088664-174088686 AATGGTGTGAACTCGGGAGGCGG + Intronic
966059222 3:175734468-175734490 AATGGTGTGAACTCGGGAGGCGG + Intronic
966686262 3:182698921-182698943 GAGGCTGAGGACCCAGGAGGTGG + Intergenic
966863071 3:184241401-184241423 CTTGGTGAGGACTCGGGAGGTGG + Exonic
967656709 3:192058972-192058994 AAGGCTGAGGAAGAGGGTGGGGG + Intergenic
967839133 3:193990575-193990597 AAGGGTGTGAACCCGGGAGGTGG - Intergenic
967975941 3:195034876-195034898 AGCGCTGAGGACTGGGGAGTGGG + Intergenic
968315106 3:197717355-197717377 AATGCTGTGAACCCGGGAGGCGG + Intronic
968799257 4:2731568-2731590 AGGGGAAAGGACTCGGGAGGAGG - Intronic
969142623 4:5092443-5092465 AATGGTGTGAACTCGGGAGGCGG + Intronic
969331760 4:6477637-6477659 AAGGGTGTGAACCCGGGAGGCGG + Intronic
970037548 4:11754930-11754952 AATGGTGTGGACCCGGGAGGTGG + Intergenic
970613497 4:17746643-17746665 AATGGTGTGGACTCGGGAGGTGG + Intronic
970641027 4:18066259-18066281 AATGGTGTGAACTCGGGAGGCGG - Intergenic
972773865 4:42223688-42223710 AATGGTGTGAACTCGGGAGGCGG - Intergenic
973779266 4:54272897-54272919 AAGGCTGAGGACTCGGGGGAGGG - Intronic
974186066 4:58448619-58448641 AATGGTGTGAACTCGGGAGGCGG - Intergenic
975000436 4:69219042-69219064 AAGGCTGAGGACGCTGAATGGGG - Intergenic
975344744 4:73281411-73281433 AAGGCAGAGGATTCTGGAGCAGG + Intergenic
975644142 4:76529401-76529423 AACGGTGTGAACTCGGGAGGTGG - Intronic
975781946 4:77849151-77849173 GAGGCTGGGGGCTGGGGAGGGGG - Intergenic
975840296 4:78466439-78466461 AGGGGTGAGGACACTGGAGGAGG + Intronic
976207892 4:82639639-82639661 CAGGCTGAGGACCTGGGAGCTGG + Intronic
976307511 4:83575497-83575519 AATGGTGTGAACTCGGGAGGTGG - Intronic
976398440 4:84582724-84582746 GAGGCTGAGGAGCTGGGAGGCGG - Intergenic
976791989 4:88888847-88888869 AATGCTGTGAACCCGGGAGGCGG + Intronic
977157949 4:93596489-93596511 AATGCGGTGAACTCGGGAGGCGG + Intronic
977170205 4:93752455-93752477 AAGGGTGTGAACCCGGGAGGCGG - Intronic
978512343 4:109534498-109534520 AATGGTGTGAACTCGGGAGGCGG + Intronic
978601918 4:110437562-110437584 AAGGCAGAAGACTCAGGTGGAGG + Intronic
980214007 4:129827746-129827768 AAGGCTGAGGTCTCCTGAAGAGG - Intergenic
980402730 4:132313720-132313742 AAGGCTGAAGACCTGGGAGGGGG + Intergenic
981151732 4:141386624-141386646 AATGGTGTGAACTCGGGAGGCGG - Intergenic
981718444 4:147775276-147775298 AAGGCTGGGGACTGGCCAGGAGG - Intronic
981948529 4:150377882-150377904 GAGGCTGAGGACCTGGGAAGGGG + Intronic
982163546 4:152593680-152593702 AATGGCGAGAACTCGGGAGGCGG + Intergenic
983002208 4:162430279-162430301 AAGGGCGTGAACTCGGGAGGCGG + Intergenic
983902240 4:173147863-173147885 AAGGCTGAGGTCTAGGGGGATGG - Intergenic
984514334 4:180719685-180719707 AAGGCTGTGGAGTCAGCAGGAGG + Intergenic
984530288 4:180908265-180908287 AACGGTGTGAACTCGGGAGGTGG - Intergenic
985397539 4:189559955-189559977 CTTGCTGAGGACTGGGGAGGAGG - Intergenic
985397550 4:189560011-189560033 AGTGCTGAGGACTGGGGAGGAGG - Intergenic
985641040 5:1063655-1063677 AGGGCTGTGGCCTCGTGAGGTGG - Intronic
985641057 5:1063704-1063726 AGGGCTGTGGCCTCGTGAGGTGG - Intronic
985763364 5:1763321-1763343 AAGGACGAGGAAACGGGAGGAGG - Intergenic
986166049 5:5272446-5272468 AATGGTGTGAACTCGGGAGGCGG - Intronic
986315903 5:6586177-6586199 AAGGCTGAGTGCCAGGGAGGAGG - Intergenic
986391358 5:7290381-7290403 AATGGTGTGAACTCGGGAGGTGG + Intergenic
986956668 5:13158720-13158742 AATGCTGTGAACTCGGGAGGTGG + Intergenic
988004762 5:25395158-25395180 AATGGTGTGAACTCGGGAGGCGG - Intergenic
988069988 5:26275488-26275510 AATGCTGTGAACCCGGGAGGCGG + Intergenic
992985972 5:82230051-82230073 AAGGGTTAGGGCTCGGGATGGGG - Intronic
994420901 5:99525771-99525793 AAGGCTGAGGACCTGCGAGTAGG - Intergenic
994486141 5:100388543-100388565 AAGGCTGAGGACCTGCGAGTAGG + Intergenic
995155584 5:108908632-108908654 AATGCTGTGAACCCGGGAGGCGG + Intronic
995347568 5:111138037-111138059 AAAGCAGAAGAATCGGGAGGCGG + Intergenic
996699316 5:126434602-126434624 AATGGTGTGGACCCGGGAGGCGG - Intronic
997314515 5:132921038-132921060 AATGGTGTGAACTCGGGAGGCGG + Intronic
998011100 5:138696304-138696326 AATGGTGTGAACTCGGGAGGCGG + Intronic
1000810505 5:165855633-165855655 AAGAATGAGGACTTTGGAGGTGG - Intergenic
1001367208 5:171154361-171154383 AATGGTGTGGACTCGGGAGGCGG - Intronic
1001775249 5:174324050-174324072 AAGGGTGAGGACCCGTCAGGTGG + Intergenic
1001984726 5:176063008-176063030 AATGCTGTGAACCCGGGAGGGGG + Intronic
1002232787 5:177781183-177781205 AATGCTGTGAACCCGGGAGGGGG - Intronic
1002263201 5:178008625-178008647 AATGCTGTGAACCCGGGAGGGGG + Intronic
1002594312 5:180312175-180312197 GAGGCTGAGGACCAGGGAGGCGG + Intronic
1002764917 6:231162-231184 AATGCTGTGAACCCGGGAGGCGG - Intergenic
1003056313 6:2824148-2824170 AATGGTGTGAACTCGGGAGGTGG - Intergenic
1003264345 6:4552351-4552373 TAGGCTGAGGAGTTTGGAGGAGG - Intergenic
1004010175 6:11677481-11677503 AAGGCTGAAGACTAGAGAGAGGG + Intergenic
1004973714 6:20940998-20941020 AATGCTGTGAACCCGGGAGGTGG + Intronic
1005592338 6:27341815-27341837 AATGGTGAGAACCCGGGAGGCGG - Intergenic
1005968503 6:30743467-30743489 AATGGGGAGGACTCGGGTGGGGG - Exonic
1006305161 6:33214191-33214213 AGGACTGGGGACCCGGGAGGGGG - Intergenic
1006308943 6:33243593-33243615 AAGGCAGAGGACATGGGATGTGG + Intergenic
1006585997 6:35113174-35113196 GAGGCTGAGAACCTGGGAGGTGG + Intergenic
1006593916 6:35179013-35179035 AAGGCAGAGGAGCCTGGAGGAGG + Intergenic
1006682034 6:35804327-35804349 AATGGTGTGAACTCGGGAGGCGG - Intergenic
1006804549 6:36779669-36779691 AGGGCTGGGGACTCAGCAGGTGG - Intronic
1007675921 6:43594935-43594957 AAGGCTGGGGGCTGGGGAGGTGG + Intronic
1007694951 6:43726071-43726093 AATGCTGGGGAGTTGGGAGGAGG - Intergenic
1007697044 6:43740566-43740588 AAGGCAGTGGAGTGGGGAGGAGG + Intergenic
1007777055 6:44229803-44229825 CAGGCTGGGGGCTGGGGAGGGGG - Intronic
1009558982 6:65214070-65214092 AATGGTGTGGACCCGGGAGGTGG + Intronic
1009962458 6:70540409-70540431 AATGGTGTGAACTCGGGAGGCGG - Intronic
1009973387 6:70648093-70648115 AAGGGCGTGGACTGGGGAGGCGG + Intergenic
1010141496 6:72620172-72620194 AAGGCGGAGGGGGCGGGAGGGGG - Intergenic
1011152589 6:84290545-84290567 AATGGTGTGGACCCGGGAGGCGG - Intergenic
1011429988 6:87275256-87275278 AATGGTGTGAACTCGGGAGGTGG - Intergenic
1011499770 6:87975367-87975389 AAGGCTGAGGAAAAGGGAAGAGG - Intergenic
1011593122 6:88990327-88990349 AAGGCTGAGAACCAGGGAGAAGG - Intergenic
1011745444 6:90403515-90403537 GAGGCTGAGGACATGGGATGTGG - Intergenic
1011883132 6:92057426-92057448 AAGGCAGAGGTGTTGGGAGGTGG - Intergenic
1012045218 6:94264349-94264371 AATGGTGAGAACCCGGGAGGCGG - Intergenic
1012698910 6:102426544-102426566 AATGGTGTGAACTCGGGAGGCGG + Intergenic
1013066690 6:106690824-106690846 AATGGTGTGAACTCGGGAGGTGG - Intergenic
1014507168 6:122273523-122273545 AATGCTGTGAACCCGGGAGGCGG + Intergenic
1016049363 6:139514185-139514207 AATGGCGAGAACTCGGGAGGCGG + Intergenic
1016888056 6:148977663-148977685 AATGGTGTGAACTCGGGAGGTGG + Intronic
1017053439 6:150416031-150416053 GAGACTGAGGACATGGGAGGTGG + Intergenic
1017053445 6:150416073-150416095 GAGACTGAGGACATGGGAGGTGG + Intergenic
1018210456 6:161476098-161476120 AATGGTGTGGACCCGGGAGGCGG + Intronic
1019519951 7:1456076-1456098 GAGGCTGAGGGCACGGGATGGGG + Intronic
1019561378 7:1660337-1660359 AATGGTGGGAACTCGGGAGGCGG + Intergenic
1019725986 7:2602988-2603010 AAGGCTGAGGACTAGGGCAGTGG - Intronic
1020097507 7:5377071-5377093 GAGGTTCAGGACTTGGGAGGTGG - Intronic
1020274694 7:6616987-6617009 GAGGCTCAGGACTGGGGAGTTGG - Intronic
1020527006 7:9274994-9275016 AAGGGTGTGAACCCGGGAGGCGG - Intergenic
1021856452 7:24861971-24861993 AATGCTGTGAACTCGGGAGGTGG - Intronic
1022020789 7:26398172-26398194 AAGGCCCAGGGTTCGGGAGGCGG + Intergenic
1022089047 7:27096033-27096055 AGGGCGGAGGACGCTGGAGGAGG + Intergenic
1023268246 7:38431567-38431589 AAGGGTGTGAACCCGGGAGGCGG + Intronic
1024186093 7:46949482-46949504 GAGGCAGAGGACTCACGAGGTGG - Intergenic
1025230956 7:57203172-57203194 GAGGCGGAGGAGGCGGGAGGAGG - Intergenic
1025621828 7:63180057-63180079 AAGGCAGAAGACTCAGGTGGAGG + Intergenic
1025866802 7:65389916-65389938 AATGGTGTGAACTCGGGAGGCGG - Intronic
1026136090 7:67662328-67662350 AAGTCTGAGGATGAGGGAGGTGG - Intergenic
1026232991 7:68501602-68501624 AGGCCTGAGAACTCGGGATGGGG + Intergenic
1026846242 7:73700551-73700573 AAGGCTGAGGACTGGACAGTCGG + Intronic
1026872112 7:73859205-73859227 AAGGCAGAGGACTCTGGGGTAGG - Intergenic
1027263150 7:76479234-76479256 AAGGAGAAGGTCTCGGGAGGTGG + Intronic
1027314534 7:76977339-76977361 AAGGAGAAGGTCTCGGGAGGTGG + Intergenic
1027617297 7:80438968-80438990 AATGGTGTGAACTCGGGAGGCGG + Intronic
1028028711 7:85880650-85880672 AAGCATGAGGTCTCTGGAGGAGG + Intergenic
1028475094 7:91244626-91244648 AATGCTGAGGAGAAGGGAGGAGG - Intergenic
1029266944 7:99349751-99349773 AATGGTGTGAACTCGGGAGGCGG + Intronic
1029536949 7:101162819-101162841 CGGGCTCAGGACCCGGGAGGGGG + Exonic
1029921841 7:104273549-104273571 AATGATGTGAACTCGGGAGGCGG - Intergenic
1030092863 7:105873065-105873087 AAGGGTGTGAACCCGGGAGGCGG + Intronic
1031033906 7:116766400-116766422 AATGCTGAGAGCTCAGGAGGAGG + Intronic
1031823868 7:126537688-126537710 AATGCTGTGAACCCGGGAGGCGG + Intronic
1031903506 7:127435834-127435856 AATGGTGTGGACCCGGGAGGCGG + Intergenic
1032220995 7:129994077-129994099 AATGGTGTGAACTCGGGAGGTGG + Intergenic
1032276873 7:130465123-130465145 AACGGTGTGAACTCGGGAGGCGG + Intergenic
1032785950 7:135199508-135199530 AAGGCTAAGATCTGGGGAGGTGG + Intronic
1033433336 7:141308823-141308845 AAGGCTGGGGATTCAGGAGCCGG - Intronic
1034460199 7:151193818-151193840 AAGGCACGGGACACGGGAGGTGG + Intronic
1034844272 7:154430028-154430050 AAGGCTGAGAACTGGGAGGGTGG - Intronic
1034895601 7:154874637-154874659 AGGGCTGAGGAGTGGGGTGGGGG - Intronic
1035019099 7:155789740-155789762 AATGCTGTGAACCCGGGAGGCGG - Intergenic
1035314953 7:157991819-157991841 AAGGCTGGGGACCCAGGACGAGG + Intronic
1035416890 7:158696730-158696752 AAGGGTGTGGACTTAGGAGGAGG - Intronic
1035939083 8:3875680-3875702 CTGGCTGAGGTCTAGGGAGGGGG + Intronic
1036165023 8:6424507-6424529 AAGGCTGAGGAGGCGGGAAGTGG - Intronic
1036543788 8:9746671-9746693 AGGGCTGAGGACTGGGGCTGGGG - Intronic
1036577785 8:10044760-10044782 AAGGCTGATGGCTGGGGAGCAGG + Intergenic
1037341888 8:17854498-17854520 AAGGGTGTGAACCCGGGAGGCGG - Intergenic
1037923131 8:22821896-22821918 AATGGTGTGAACTCGGGAGGTGG + Intronic
1037961584 8:23102276-23102298 GAGGCTGAGGAGTAGGTAGGAGG - Intronic
1037969940 8:23164645-23164667 GAGGCTGAGGAGTAGGTAGGAGG + Intergenic
1038503838 8:28067526-28067548 GAGGGTGATGACTCTGGAGGTGG + Exonic
1040039655 8:42903429-42903451 AATGGTGGGAACTCGGGAGGTGG - Intronic
1041218967 8:55630277-55630299 AATGGTGTGAACTCGGGAGGTGG - Intergenic
1041398774 8:57419339-57419361 GATGCTGGGGACTCGGAAGGAGG + Intergenic
1041449729 8:57994396-57994418 AAGGGTGGGGACCCGGAAGGTGG + Intergenic
1041515427 8:58694420-58694442 ATGGCCCAGGACTCTGGAGGGGG - Intergenic
1041572455 8:59352812-59352834 AATGGTGTGAACTCGGGAGGAGG - Intergenic
1042243306 8:66686726-66686748 AATGGTGTGAACTCGGGAGGTGG - Intronic
1042245430 8:66705368-66705390 AATGGTGTGAACTCGGGAGGTGG - Intronic
1043926123 8:86039343-86039365 AAGGCAGAGGACCCGGGACTGGG - Intronic
1044116019 8:88335160-88335182 AATGGTGTGAACTCGGGAGGCGG - Intergenic
1044289289 8:90448511-90448533 AAGGGAGAGGAATCTGGAGGAGG - Intergenic
1044902679 8:96965454-96965476 AATGGTGTGAACTCGGGAGGTGG - Intronic
1045537529 8:103045852-103045874 AATGGTGTGAACTCGGGAGGCGG + Intronic
1045693471 8:104782870-104782892 AAGGCTGAGTCCTGGGGATGAGG + Intronic
1045766480 8:105677410-105677432 AAGAGTGTGGACTCTGGAGGTGG - Intronic
1046522363 8:115341966-115341988 AATGGTGTGAACTCGGGAGGCGG - Intergenic
1047663277 8:127061905-127061927 AATGGTGTGAACTCGGGAGGCGG + Intergenic
1048096912 8:131306286-131306308 AATGCTGTGAACCCGGGAGGTGG + Intergenic
1048240008 8:132731954-132731976 AAGCCAGAGGAATTGGGAGGTGG + Intronic
1049107814 8:140624585-140624607 AAGGCTGGGGGCTCAGGAGGAGG + Intronic
1049572535 8:143375994-143376016 AAGGTTGGGGACCTGGGAGGGGG + Intronic
1049986345 9:955153-955175 TGGCCTGAGGACTGGGGAGGAGG + Intronic
1050089094 9:1998480-1998502 AAAACTGTGGCCTCGGGAGGAGG + Intergenic
1051288673 9:15523326-15523348 AAGGGTTAGGAATTGGGAGGAGG - Intergenic
1052024547 9:23560004-23560026 CAGGCTGAGGACTCATGAGCTGG + Intergenic
1052431156 9:28368681-28368703 AATGGTGTGAACTCGGGAGGGGG - Intronic
1052507227 9:29371376-29371398 AATGGTGAGAACCCGGGAGGCGG - Intergenic
1053160970 9:35813277-35813299 AAGGCTGAGGGCCTGGGAGATGG - Exonic
1053563225 9:39218516-39218538 AATGCTGTGAACCCGGGAGGTGG - Intronic
1053597266 9:39575381-39575403 AATGGTGTGAACTCGGGAGGCGG - Intergenic
1053829011 9:42056435-42056457 AATGCTGTGAACCCGGGAGGTGG - Intronic
1053855293 9:42332344-42332366 AATGGTGTGAACTCGGGAGGCGG - Intergenic
1054133922 9:61400551-61400573 AATGCTGTGAACCCGGGAGGTGG + Intergenic
1054601549 9:67131012-67131034 AATGCTGTGAACCCGGGAGGTGG + Intergenic
1054749075 9:68886090-68886112 AAGGGTGTGAACCCGGGAGGCGG + Intronic
1055227138 9:74012928-74012950 AACGGTGTGAACTCGGGAGGCGG - Intergenic
1055699091 9:78921761-78921783 AAGGCTGAGGAGGAGGAAGGAGG + Intergenic
1055979135 9:81984291-81984313 AATGGTGTGAACTCGGGAGGCGG + Intergenic
1055994289 9:82140887-82140909 AATGCTGTGAACCCGGGAGGCGG - Intergenic
1056466975 9:86866922-86866944 AAGGGTGAAAACTGGGGAGGAGG - Intergenic
1056552545 9:87663805-87663827 GAGGCTGAACACTGGGGAGGAGG - Intronic
1057143840 9:92745429-92745451 AAGGGTGGGGACAGGGGAGGGGG + Intronic
1057578292 9:96261758-96261780 AAGTCTGAGGAGTAGGGAGATGG - Intronic
1057627725 9:96692577-96692599 AATGGTGTGAACTCGGGAGGCGG + Intergenic
1057884745 9:98821802-98821824 AAAGCAGAGGAGTGGGGAGGGGG - Intronic
1058224901 9:102348092-102348114 AATGGTGTGAACTCGGGAGGCGG - Intergenic
1059267282 9:113047020-113047042 AATGGTGTGAACTCGGGAGGAGG + Intronic
1059667594 9:116463426-116463448 AAGGCTGAGAAGTTGAGAGGAGG - Intronic
1060234157 9:121850541-121850563 AAGGGGGAGGAGTGGGGAGGTGG + Intronic
1060549533 9:124478393-124478415 GAGGCTGAGGCCACGGGAGCTGG - Exonic
1060740594 9:126095449-126095471 AAGGCTGAGAAATCCGGTGGAGG + Intergenic
1060892599 9:127198282-127198304 AAGGCTGAGCACTGGGAAAGGGG - Intronic
1061442949 9:130618969-130618991 AAGGCTGGGAGCTCTGGAGGAGG - Intronic
1061746424 9:132743509-132743531 AAGGCTGGGGAATCTGGCGGTGG - Intronic
1062083312 9:134635912-134635934 AAGGCTGAGGGTTGGGGAAGAGG + Intergenic
1062214211 9:135380366-135380388 AAGGCTGAGAACCGGGGAAGTGG + Intergenic
1062477913 9:136738486-136738508 ATGGCTGAGGACTCGGGTTCAGG + Intronic
1062634736 9:137484861-137484883 CAGCCTCAGGACTGGGGAGGCGG - Intronic
1062634748 9:137484894-137484916 CAGCCTCAGGACTGGGGAGGCGG - Intronic
1062730270 9:138104617-138104639 TAGGCTGAGGACTCTGGATTTGG + Intronic
1203663122 Un_KI270754v1:1272-1294 AGTGCTGAGGACTGGGGAGGAGG + Intergenic
1203663133 Un_KI270754v1:1328-1350 CTTGCTGAGGACTGGGGAGGAGG + Intergenic
1185442787 X:235993-236015 AATGCTGTGAACCCGGGAGGCGG + Intergenic
1185453306 X:294393-294415 AATGGTGTGAACTCGGGAGGCGG + Intronic
1185479138 X:433288-433310 AATGGTGTGAACTCGGGAGGCGG - Intergenic
1185610905 X:1393011-1393033 AAGGGAGAGGAGGCGGGAGGAGG - Intergenic
1186283899 X:8023622-8023644 AAGCCTGAGAACTGGGTAGGAGG - Intergenic
1186590956 X:10929414-10929436 ATGACTGAGGACTCTGGAGTTGG - Intergenic
1189974572 X:46448289-46448311 TAGGCTGAGGCCTCAGAAGGAGG + Exonic
1190295137 X:49022089-49022111 AATGGTGTGAACTCGGGAGGCGG - Intergenic
1190340928 X:49294820-49294842 AATGGTGTGAACTCGGGAGGTGG + Intronic
1194012721 X:88582691-88582713 AATGGTGTGGACCCGGGAGGCGG + Intergenic
1194334263 X:92626120-92626142 AATGGTGTGAACTCGGGAGGCGG + Intergenic
1194813257 X:98412666-98412688 AATGCTGAGGGCTGGGGTGGGGG - Intergenic
1195391874 X:104370824-104370846 AATGGTGTGAACTCGGGAGGCGG - Intergenic
1195738733 X:108040350-108040372 AAGGCTGAGGACCACAGAGGAGG + Intergenic
1196278745 X:113798347-113798369 AAGGGTGTGAACCCGGGAGGTGG - Intergenic
1196318837 X:114264594-114264616 AATGGTGTGAACTCGGGAGGTGG + Intergenic
1196717938 X:118827824-118827846 AAGGCTGGGGAATGGGGTGGAGG + Intergenic
1196757107 X:119167576-119167598 AAGCCTCAGGGCTGGGGAGGAGG + Intergenic
1197892342 X:131279563-131279585 TAGGCTGCGGAGTGGGGAGGGGG - Intronic
1198653707 X:138891196-138891218 AATGCCGTGAACTCGGGAGGCGG + Intronic
1200141441 X:153904794-153904816 AGGGCTGGGGACTGGGCAGGGGG - Intronic
1201402876 Y:13621740-13621762 AATGGTGTGGACTCAGGAGGTGG + Intergenic
1201521039 Y:14873886-14873908 GAGGCTGAGGAATAAGGAGGAGG + Intergenic
1201677296 Y:16600999-16601021 AATGGTGTGGACCCGGGAGGCGG + Intergenic