ID: 1162349133

View in Genome Browser
Species Human (GRCh38)
Location 19:10138246-10138268
Sequence CTAGGGAAGCAGATGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 10, 3: 32, 4: 366}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162349129_1162349133 -2 Left 1162349129 19:10138225-10138247 CCGCTCTGCACATGCTATCTACT 0: 1
1: 0
2: 2
3: 19
4: 176
Right 1162349133 19:10138246-10138268 CTAGGGAAGCAGATGATGCAGGG 0: 1
1: 0
2: 10
3: 32
4: 366
1162349127_1162349133 20 Left 1162349127 19:10138203-10138225 CCACAGCCAAGCATGCGGCTGGC 0: 1
1: 0
2: 2
3: 14
4: 194
Right 1162349133 19:10138246-10138268 CTAGGGAAGCAGATGATGCAGGG 0: 1
1: 0
2: 10
3: 32
4: 366
1162349128_1162349133 14 Left 1162349128 19:10138209-10138231 CCAAGCATGCGGCTGGCCGCTCT 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1162349133 19:10138246-10138268 CTAGGGAAGCAGATGATGCAGGG 0: 1
1: 0
2: 10
3: 32
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162349133 Original CRISPR CTAGGGAAGCAGATGATGCA GGG Intronic
900125585 1:1067690-1067712 CTTGGGCAGCCGAAGATGCACGG - Intergenic
900812727 1:4820206-4820228 CTTGGGAAGCAGCAAATGCAGGG + Intergenic
901588476 1:10318419-10318441 CTAGGGAACCAAAAGAAGCAGGG + Intronic
901824792 1:11854112-11854134 CCAGGGAGGCAGAGGTTGCAGGG + Intergenic
903618735 1:24682188-24682210 CTCCGGAAGCAGAGGTTGCAGGG - Intergenic
904583913 1:31568533-31568555 CTAGGGCAGCAGAGGAAGCAAGG - Intergenic
904779622 1:32935820-32935842 CTGGGGAGGCAGAGGTTGCAGGG - Intergenic
906541038 1:46586223-46586245 CAAGGGAAGCAGGTGAGCCAAGG - Intronic
907377554 1:54056399-54056421 CCAGGGAGGCAGAGGTTGCAGGG - Intronic
907531526 1:55103217-55103239 CTAGTGAACCAGGTGAAGCAAGG - Intronic
907652299 1:56306696-56306718 CTAGGGAAGAAGAGGAGGCAGGG - Intergenic
908329897 1:63061221-63061243 CTAGGGGAGCTGATGATATAAGG + Intergenic
908790216 1:67773608-67773630 CAAGGGAAGAGGATCATGCAGGG + Intronic
912168043 1:107063183-107063205 ATAGGGAAGAAGATGATACAAGG + Intergenic
912846066 1:113075769-113075791 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
913142512 1:115955510-115955532 GCAGGGAAGCAAATGATGCCAGG + Intergenic
914921019 1:151847579-151847601 CTAGGGACACAGATGAAGCAAGG - Intronic
916237235 1:162602672-162602694 CCCGGGAAGCAGAGGTTGCAGGG - Intergenic
917539561 1:175899671-175899693 CTATGGAGGAAGATGAAGCAAGG + Intergenic
917716881 1:177747349-177747371 CCAGGGGAGCTGATGGTGCAGGG - Intergenic
917846160 1:179022222-179022244 CCTGGGAAGCAGCTGAGGCAGGG + Intergenic
918292614 1:183123328-183123350 GTAGGGGAGCAGGTGAGGCAGGG - Intronic
919469169 1:197957586-197957608 CAGGGGAAGCTGATGATGCAGGG + Intergenic
919743280 1:200993198-200993220 ATAGGGAGGCAGATGCCGCAGGG - Intronic
919909119 1:202099581-202099603 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
921366319 1:214378077-214378099 CTAGAGAAGCAGAAGATGGCAGG - Exonic
921429741 1:215051666-215051688 CTTGGGAAGCAGCAGATGCAAGG + Intronic
922228009 1:223662371-223662393 CTGGGGAGGCAGAGGTTGCAGGG + Intronic
922562398 1:226578741-226578763 CCAGGGAAGCAGCCGCTGCAGGG - Intronic
922656710 1:227391086-227391108 CCCGGGAAGCAGAGGTTGCAGGG + Intergenic
922755648 1:228095408-228095430 CTAGGGGAGCAGCTGCAGCAGGG - Intronic
923306828 1:232696268-232696290 GTAGGAAAGCAGATGAAGTAGGG + Intergenic
923653361 1:235894471-235894493 CCAGGGAGGCAGAGGTTGCATGG - Intergenic
923716855 1:236432311-236432333 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1064481463 10:15744497-15744519 ATAGAGAAGAAGATGATCCAGGG - Intergenic
1065212556 10:23418154-23418176 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1065899513 10:30192602-30192624 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1065918473 10:30371076-30371098 TCAGGGTAGCAGATGATGCAGGG + Intronic
1066412026 10:35181087-35181109 ATAGGGAAGCAGATGCTGTAGGG + Intronic
1068077230 10:52271443-52271465 TCAGAGAAGCAGATCATGCAGGG + Exonic
1069547800 10:69341235-69341257 CTGGGGAAGCAGAGGTTGCAGGG - Intronic
1072071600 10:91923614-91923636 CTAGGGAAGGAGGTGAAGTAAGG - Intergenic
1072132539 10:92509515-92509537 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1074355797 10:112781982-112782004 CTAGGAAAGGAGATGCTGGAAGG - Intronic
1074790395 10:116880870-116880892 CGAGGGAAACAGCTGCTGCAGGG + Intronic
1074916355 10:117959806-117959828 CTATGGAAGCCTCTGATGCAGGG + Intergenic
1075489486 10:122854411-122854433 CTTGGGAAGCAGGAGATGGAGGG - Intronic
1075917306 10:126179789-126179811 CTGGGGTAGCAGTTCATGCATGG + Intronic
1076389194 10:130084794-130084816 CATGGGAAGCAGCTGATTCAGGG + Intergenic
1077262110 11:1628217-1628239 CGAGGGAAGGAGCTGATCCAAGG + Intergenic
1077278248 11:1728069-1728091 CTGGGGAAGCAGCTGATTCCAGG - Intergenic
1077602386 11:3582431-3582453 CCAGGGAAGCAGAGGAGGCCAGG + Intergenic
1079291495 11:19192120-19192142 CTGGGCAAGCAGTTGAAGCAAGG + Intronic
1079709669 11:23666053-23666075 CTTGGGAAGTAGATGGGGCAGGG + Intergenic
1080391193 11:31848316-31848338 CTTGGGAAGCAGAAGAGCCAAGG + Intronic
1081923356 11:46800440-46800462 CTAGGGAATCAAATGATGAAGGG + Intronic
1083696383 11:64445583-64445605 CTATGGAAGCAGAAGACGCCAGG + Intergenic
1083698495 11:64458224-64458246 TGAGGGAAGCAGATGAGGGAGGG - Intergenic
1084258280 11:67956978-67957000 CCAGGGAAGCAGAGGAGGCCAGG + Intergenic
1084474012 11:69378517-69378539 CCAGGGAAGGAGCTGATGAATGG - Intergenic
1084814466 11:71638232-71638254 CCAGGGAAGCAGAGGAGGCCAGG - Intergenic
1085349207 11:75787821-75787843 TGAGGGAGGCAGATGATGAAAGG + Intronic
1086162081 11:83733163-83733185 CTTGGGAGGCAGAGGTTGCAGGG + Intronic
1086360525 11:86054337-86054359 CTAGGGAAGCAGCTAATAAATGG + Intronic
1088392670 11:109332220-109332242 CTAAGAATGCAGATGATCCATGG + Intergenic
1088692867 11:112342767-112342789 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1089169207 11:116500562-116500584 CTCGGGAGGGAGGTGATGCATGG - Intergenic
1089269244 11:117290218-117290240 CTTGGGAAGCTCTTGATGCAAGG - Intronic
1090343893 11:126051721-126051743 CTCGGGAGGCAGAGGTTGCAGGG - Intronic
1091236676 11:134026806-134026828 CTAAGGAAGCTGAGAATGCAGGG + Intergenic
1091611188 12:2011073-2011095 CCCGGGAGGCAGATGTTGCAGGG + Intronic
1093912735 12:24765652-24765674 TTAAGGAAGCAGATGATTTAAGG - Intergenic
1094525717 12:31229403-31229425 CTCGGGAACCAGAGGAGGCAGGG + Intergenic
1095446341 12:42286839-42286861 CTAGGGCAGCAGAGGAGGCGAGG + Intronic
1095815431 12:46417052-46417074 CCTGGGAAGCAGAAGTTGCAAGG - Intergenic
1096581601 12:52589213-52589235 CAAGGAAAGCAGCTGATCCAAGG + Intronic
1098328364 12:69326024-69326046 CTGGGGAGGCAGAGGTTGCAGGG + Intergenic
1099980483 12:89595931-89595953 CTAGGGGAGCAGATACTTCAGGG - Intronic
1101456077 12:104832108-104832130 CTTCAGAAGCAGATGATCCATGG + Intronic
1102034281 12:109761954-109761976 CTGGGGAAGCAGTTGGTGCAGGG - Intronic
1102791231 12:115647470-115647492 CTAGTGATGCAGATGTTGCAGGG - Intergenic
1103259933 12:119577954-119577976 CAAGGGAAGGGGATTATGCAAGG - Intergenic
1103608231 12:122104300-122104322 ATAGGGAAGGAGAGGATGCCTGG - Intronic
1103720386 12:122971527-122971549 CCTGGGAAGCAGAGGTTGCATGG - Intronic
1104267066 12:127243747-127243769 CTAAAGAAGCAGGTGATGCATGG + Intergenic
1106453177 13:29903104-29903126 CTAGGGAAGCACAGAGTGCAAGG - Intergenic
1107322647 13:39205820-39205842 ATGGGGAAGGAGAGGATGCAGGG - Intergenic
1107700729 13:43045057-43045079 CAAGGGGAGCAGATCATGCTGGG - Intronic
1107930546 13:45303753-45303775 CCAGGGAGGCAGAGGTTGCAGGG - Intergenic
1107959600 13:45546321-45546343 CTAGGGAATCACATGAAGAAAGG + Intronic
1109241985 13:59900836-59900858 CAAGAGAAGCAGATTATGGAAGG - Intronic
1109299748 13:60578723-60578745 CTAGGTAAGTAGACGTTGCAAGG + Intergenic
1109628086 13:65004894-65004916 TGAGGGAAGCAGATTATGTAGGG + Intergenic
1109781948 13:67122696-67122718 CTCGGGAGGCAGAGGTTGCAGGG + Intronic
1109783905 13:67150107-67150129 CCTGGGAGGCAGATGTTGCACGG - Intronic
1110428060 13:75391736-75391758 GTAGGGCATCAGATGGTGCAGGG - Intronic
1110802996 13:79722062-79722084 GTTGGGATGCAGATGAGGCAAGG + Intergenic
1110906402 13:80896322-80896344 CCAGGGAGGCAGAGGTTGCAGGG - Intergenic
1112639222 13:101254295-101254317 CTTGGGAGGCAGAGGTTGCAGGG + Intronic
1113801201 13:113087250-113087272 CTGGGCAAGCTGCTGATGCAGGG + Exonic
1114198677 14:20503047-20503069 ATAAAGAAGCAGGTGATGCATGG + Intergenic
1114719407 14:24864463-24864485 CTAAGGAAGCAGGTGAGGGAAGG + Intronic
1115851496 14:37593130-37593152 GTTGGGAAACAGATGATTCAGGG - Intronic
1116029860 14:39558061-39558083 CCAGGGAAGCACATGAGGAAAGG - Intergenic
1116623742 14:47240118-47240140 CCAGGGAGGCAGAAGTTGCAGGG - Intronic
1117286749 14:54292855-54292877 TAAAGGAAGAAGATGATGCAAGG - Intergenic
1117956290 14:61125995-61126017 CTGGGGAAGCAGATGTCCCAAGG - Intergenic
1118398240 14:65355717-65355739 CTAGGGGAGCAGTTGGTGCCTGG - Intergenic
1118754260 14:68827225-68827247 CCTGGGAAGCAGAAGTTGCAGGG + Intergenic
1121088921 14:91167902-91167924 CTGGGAAAGCAGATGATGACAGG - Intronic
1121624176 14:95372455-95372477 CTTGGGAGGCAGAGGTTGCAGGG - Intergenic
1122226740 14:100285062-100285084 CTAGGGAGGGAGAGGAGGCAAGG + Intergenic
1123414960 15:20088702-20088724 CCCGGGAAGCAGAGGTTGCAGGG - Intergenic
1123472368 15:20564951-20564973 TCAGGGTAGCAGATGATGTAGGG - Intergenic
1123524302 15:21095816-21095838 CCCGGGAAGCAGAGGTTGCAGGG - Intergenic
1123645635 15:22435402-22435424 TCAGGGTAGCAGATGATGTAGGG + Intergenic
1123666888 15:22614967-22614989 TCAGGGTAGCAGATGATGTAGGG + Intergenic
1123732673 15:23159942-23159964 TCAGGGTAGCAGATGATGTAGGG - Intergenic
1123750806 15:23357322-23357344 TCAGGGTAGCAGATGATGTAGGG - Exonic
1124283177 15:28381238-28381260 TCAGGGTAGCAGATGATGTAGGG - Exonic
1124299522 15:28530375-28530397 TCAGGGTAGCAGATGATGTAGGG + Exonic
1124320728 15:28709540-28709562 TCAGGGTAGCAGATGATGTAGGG + Exonic
1124448842 15:29765814-29765836 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1124481765 15:30085809-30085831 TCAGGGTAGCAGATGATGTAGGG - Exonic
1124488221 15:30137907-30137929 TCAGGGTAGCAGATGATGTAGGG - Exonic
1124521826 15:30411392-30411414 TCAGGGTAGCAGATGATGTAGGG + Exonic
1124536838 15:30554827-30554849 TCAGGGTAGCAGATGATGTAGGG - Exonic
1124543312 15:30606881-30606903 TCAGGGTAGCAGATGATGTAGGG - Exonic
1124563269 15:30794333-30794355 TCAGGGTAGCAGATGATGTAGGG - Intergenic
1124755305 15:32400413-32400435 TCAGGGTAGCAGATGATGTAGGG + Exonic
1124761814 15:32452764-32452786 TCAGGGTAGCAGATGATGTAGGG + Exonic
1124776815 15:32596304-32596326 TCAGGGTAGCAGATGATGTAGGG - Exonic
1124960017 15:34386900-34386922 TCAGGGTAGCAGATGATGTAGGG + Intronic
1124976646 15:34533121-34533143 TCAGGGTAGCAGATGATGTAGGG + Intronic
1125766519 15:42140210-42140232 CTAGAGCAGCAGTTGATACATGG - Exonic
1126497608 15:49309694-49309716 CCCGGGAAGCAGAGGTTGCAGGG - Intronic
1127053944 15:55113158-55113180 TAAGGGAAGCAGCTAATGCAGGG - Intergenic
1128352630 15:66901240-66901262 CTGGGGAACCAGAAGAGGCAGGG + Intergenic
1128564550 15:68692008-68692030 CTGTGGAAGCAGATGATGCAGGG + Intronic
1128657257 15:69471510-69471532 ATTGGGAAGCAGGTGAGGCACGG + Intergenic
1129029337 15:72607297-72607319 TTAGGGTAGCAGATGATGCAGGG - Intergenic
1130014242 15:80174913-80174935 CTAGGGGAGCAGGTGCTGCTGGG + Intronic
1130221847 15:82026103-82026125 CTAGGGAAGAATCTGTTGCAGGG + Intergenic
1130281283 15:82522171-82522193 CCAGGGTAGTAGAGGATGCACGG - Intergenic
1130472658 15:84238354-84238376 CCAGGGTAGTAGAGGATGCACGG - Exonic
1130480149 15:84352925-84352947 CCAGGGTAGTAGAGGATGCACGG - Intergenic
1130484380 15:84390496-84390518 CCAGGGTAGCAGATGATGCACGG - Intergenic
1130491620 15:84435204-84435226 CCAGGGTAGTAGAGGATGCACGG + Intergenic
1130503235 15:84514244-84514266 CCAGGGTAGTAGAGGATGCACGG + Intergenic
1130536715 15:84790669-84790691 CCAAGAAAGCAGATCATGCAGGG - Intronic
1130594953 15:85242988-85243010 CCAGGGTAGTAGAGGATGCACGG - Intergenic
1131040922 15:89266102-89266124 CTTGGGAAGCAGAGGCTGGAGGG - Intronic
1131219419 15:90569393-90569415 CCAGGGAGGCAGAGGCTGCAGGG - Intronic
1131554585 15:93386105-93386127 CTCGGGAAGCAGAGGTTTCAAGG - Intergenic
1131683406 15:94747380-94747402 TTGGGGAAGCAGATGTTGAACGG - Intergenic
1132433607 15:101779375-101779397 TCAGGGTAGCAGATGATGTAGGG + Intergenic
1132639096 16:969597-969619 TGAGGGAAGCAGACGATGGAAGG + Intronic
1133224830 16:4336020-4336042 CCAGGGCAGCAGAAGATGCCTGG + Intronic
1133288345 16:4701786-4701808 CTATGGAAACAGCTGCTGCACGG + Intronic
1133369689 16:5238583-5238605 CCAGGGAAGCAGAGGAGGCCAGG - Intergenic
1133812760 16:9173970-9173992 CAAGGGAAGGAAATGATACATGG - Intergenic
1135416874 16:22275128-22275150 CTGGGGAAGCACATCATGCATGG + Intronic
1137258402 16:46798430-46798452 CTCGGGAGGCAGAGGTTGCAAGG + Intronic
1137661042 16:50206653-50206675 CAAGGGAGGCAGATGACCCACGG - Intronic
1138753968 16:59459596-59459618 CCTGGGAAGCAGATTATGGAAGG + Intergenic
1138880417 16:61007610-61007632 CCAGGGAGGCAGAGGTTGCAGGG - Intergenic
1140452123 16:75079402-75079424 CCAGGGAAGCAGAGGTTGCGGGG + Intronic
1141150311 16:81560070-81560092 CTGGGGAGGCAGAGGTTGCAGGG + Intronic
1142724893 17:1805734-1805756 CTCAGGAAGCAGAGGTTGCAGGG + Intronic
1143129125 17:4665033-4665055 CTAGGGAAGCAGAAGCAACAAGG + Intergenic
1143186448 17:5013265-5013287 ATAGGGAAGAAGAGAATGCAGGG + Intronic
1146116812 17:30147885-30147907 CCCGGGAAGCAGAGGTTGCAGGG - Intronic
1147192423 17:38745887-38745909 ATAGGGAAACAGAGGCTGCAGGG + Intronic
1148376229 17:47149001-47149023 CTCGGGAAGCAGAGGTTGCAGGG + Intronic
1149939019 17:60843290-60843312 CACGGGAAGCAGAGGTTGCAGGG - Intronic
1151199235 17:72455646-72455668 CTTGGGAGGCAGATGCTGCAAGG - Intergenic
1152175407 17:78783543-78783565 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1155683748 18:28521197-28521219 CTGGGGCAGTAGATGATGCTGGG + Intergenic
1155780992 18:29835848-29835870 CTAGCAGAGCAGAGGATGCAGGG - Intergenic
1156107043 18:33675812-33675834 CTAGGGAAGCTGAGCATGAAAGG - Intronic
1156294144 18:35774644-35774666 GGAAGGAAGCAGATGATACAGGG - Intergenic
1157111507 18:44824819-44824841 CTAGGGAAGCAGATGAAGAAAGG + Intronic
1157452607 18:47799777-47799799 CTAGGGGAGAAGAAGGTGCAGGG + Intergenic
1158272102 18:55727671-55727693 CCCGGGAAGCAGAGGTTGCAGGG - Intergenic
1158790748 18:60777590-60777612 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1158959623 18:62578840-62578862 CCAGGGAGGCAGAGGTTGCAGGG - Intronic
1159706991 18:71702855-71702877 CTGGGGAAGCAGAAGACACATGG + Intergenic
1159859066 18:73625671-73625693 CTGGGATAGCAGATGATGCTTGG - Intergenic
1160111653 18:76037781-76037803 CTATGGGAACAGATAATGCAGGG - Intergenic
1160839837 19:1141288-1141310 CTCGGGAAGCAGAGGTTGCAGGG - Intronic
1162026336 19:7896011-7896033 CCCGGGAGGCAGATGTTGCAGGG - Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162349133 19:10138246-10138268 CTAGGGAAGCAGATGATGCAGGG + Intronic
1162801496 19:13113232-13113254 CTGGGGAAGCGGAGGTTGCAGGG - Intronic
1162933856 19:13970906-13970928 CTTGGGAGGCAGAGGTTGCAGGG + Intronic
1163233061 19:16016704-16016726 CTGGGGATGCAGATGGGGCAGGG - Intergenic
1164194744 19:22946319-22946341 CTAGAGGAGCTGATGATACATGG - Intergenic
1165369666 19:35396858-35396880 CTAGAGAAGCTACTGATGCAGGG + Intergenic
1166372023 19:42307154-42307176 CTAGGGTAGGAGAGGAAGCATGG - Intronic
1166534640 19:43564932-43564954 CTCGAGAAGCCGAAGATGCAAGG - Intronic
1167412480 19:49353172-49353194 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
1167550327 19:50155834-50155856 CGTGGGAACCAGATGGTGCAGGG - Intronic
1167874631 19:52401480-52401502 CTGGGGAAGCAGATCAGGCAGGG - Intronic
1168475704 19:56673573-56673595 CTAGGGGAACAGATGGTGCTGGG + Intergenic
925615506 2:5741074-5741096 CTGCGGAAGCAGAGGATGGAAGG - Intergenic
927045180 2:19271175-19271197 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
927069684 2:19514604-19514626 CCAGGGAGGCAGAGGTTGCAGGG - Intergenic
929171731 2:38939046-38939068 CCTGGGAGGCAGATGTTGCAGGG - Intronic
929724716 2:44412998-44413020 CCCGGGAAGCAGAGGTTGCAGGG + Intronic
929810535 2:45185782-45185804 CTAGGCAATCAGATGAAACATGG + Intergenic
930048332 2:47193324-47193346 CTAGGGAAGCAGCTGACTCATGG + Intergenic
930379049 2:50604242-50604264 ATACAGAAGCAAATGATGCAAGG - Intronic
931745096 2:65285062-65285084 CCAGGGAGGCAGAAGTTGCAGGG - Intergenic
933727201 2:85433702-85433724 CAAGGGAAGCAGATGGAGCCAGG - Intronic
934121425 2:88843923-88843945 ATAGGGAGGCAGATGAGGGAAGG - Intergenic
934684558 2:96311094-96311116 CCAGGGAATCAGAGGTTGCAGGG + Intergenic
939773044 2:146348420-146348442 ATAGTGAATCAGATGATGAATGG + Intergenic
940121699 2:150275024-150275046 CAAGGGAAGGAGATTATACAAGG + Intergenic
940227420 2:151414208-151414230 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
940713238 2:157187538-157187560 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
941167873 2:162103013-162103035 CTGAGGAAGCTGATGCTGCATGG - Intergenic
942167398 2:173255184-173255206 GCAGGGAAGCAGTTGCTGCAGGG + Intronic
942558239 2:177194020-177194042 CAAGGGAAGTAAGTGATGCAAGG - Intergenic
943572778 2:189593635-189593657 TTAGAGAAGGACATGATGCATGG - Intergenic
947688185 2:232109363-232109385 CCAGGGAGGCAGAGGTTGCAGGG + Intronic
947784559 2:232804565-232804587 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
947907325 2:233775033-233775055 CTAGGGAAGGAGATGGAGCTGGG - Intergenic
948130807 2:235599381-235599403 CTGGGGAAGTGGATGCTGCAGGG + Intronic
948506825 2:238434072-238434094 CTAGGGAAGGTGGTGAAGCAGGG - Intronic
1168828561 20:831179-831201 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1169200433 20:3706616-3706638 GCAGGGAAGCTGAAGATGCAGGG + Exonic
1169418545 20:5439657-5439679 CTTGGGAGGCAGAGGTTGCAGGG - Intergenic
1173632665 20:44528339-44528361 CTGGGGAGGCAGAGGCTGCAGGG + Intergenic
1174445898 20:50590888-50590910 CATGGGAAGCAGAGGCTGCAGGG - Intronic
1175382806 20:58575372-58575394 CTAGGGAGGCAGAGGTTGCAGGG + Intergenic
1175522378 20:59610177-59610199 CTGGGGAAGCAGAGGTTGCATGG + Intronic
1176552677 21:8235712-8235734 CCAGGGAAGCGGAGGCTGCAGGG + Intergenic
1176571575 21:8418115-8418137 CCAGGGAAGCGGAGGCTGCAGGG + Intergenic
1176579487 21:8462678-8462700 CCAGGGAAGCGGAGGCTGCAGGG + Intergenic
1177938174 21:27376074-27376096 CTCTGGAAGTAGATGATGTAAGG + Intergenic
1179255813 21:39714326-39714348 CAAGGGAAACAGTAGATGCAAGG - Intergenic
1179772016 21:43627580-43627602 CTATGGAATCAGATTATCCAGGG + Intronic
1179953653 21:44725720-44725742 CCCGGGAAGCAGAGGCTGCAGGG + Intergenic
1183964650 22:41434494-41434516 CTAGGGGAACAGATGGTGCTGGG + Exonic
950315525 3:11998606-11998628 TTAGGCAAGCTGATGATGAATGG + Intergenic
952292881 3:32035484-32035506 CTTGGGAGGCAGAGGATGCAGGG + Intronic
952436947 3:33280975-33280997 ATTGGGAAGCAGAAGATGGAGGG + Intronic
952551614 3:34485068-34485090 CAAGGGAAGCAGATACTACAAGG + Intergenic
953911676 3:46896436-46896458 GGAGGGAAGCAGATGAGGAAAGG + Intronic
954212130 3:49103828-49103850 CTGGGGAGGCAGACGATGCCTGG + Intronic
954250416 3:49363018-49363040 CTAGGGCAGCAGCTGACCCAGGG + Intronic
954477637 3:50763355-50763377 CCCGGGAAGCAGAAGTTGCAGGG - Intronic
954967247 3:54622723-54622745 GTAGTGATGCAGAGGATGCAGGG + Intronic
955690005 3:61581683-61581705 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
955732449 3:62000863-62000885 CTGGGAAAGCAGATGATCCAGGG - Intronic
957739230 3:84241932-84241954 CTCGGGAGGCAGAGGTTGCAGGG + Intergenic
958188406 3:90153119-90153141 CTAGGGAAGCAGAAGCTGAAAGG + Intergenic
958410931 3:93814922-93814944 CTAGGGAAGCAGAGGCTGAAAGG + Intergenic
959808489 3:110588429-110588451 GCAGGGAAGCAGATGAGGAAAGG - Intergenic
959957109 3:112251886-112251908 CTAGGAAAGGAGATGATTCAGGG - Intronic
961280845 3:125765281-125765303 CCAGGGAAGCAGAGGAGGCCAGG - Intergenic
961617355 3:128193306-128193328 CAAGGGAGGCAGAGGAGGCAAGG + Intronic
961873543 3:130004303-130004325 CCAGGGAAGCAGAGGAGGCCCGG + Intergenic
962071498 3:132037866-132037888 TAAGGGGAGCAGATGATGAAGGG + Intronic
965180129 3:165391892-165391914 TTAGGGAAAAAGATGAGGCAAGG - Intergenic
966738284 3:183207786-183207808 CTAGGCAAGCTGTTGCTGCACGG - Exonic
967861593 3:194155997-194156019 GTAGGGAAGCAGAGGAAGGAAGG + Intergenic
967910161 3:194536073-194536095 CCAGGGAAGCAGAGATTGCAGGG + Intergenic
969016834 4:4108792-4108814 CCAGGGAAGCAGAGGAGGCCAGG + Intergenic
969034414 4:4241480-4241502 ATAGAGAAGCAGATGATGATGGG - Intronic
969393556 4:6906794-6906816 CTGGGGAGGCAGAGGTTGCAGGG - Intergenic
969737128 4:8999523-8999545 CCAGGGAAGCAGAGGAGGCCAGG - Intergenic
969796320 4:9531111-9531133 CCAGGGAAGCAGAGGAGGCCAGG - Intergenic
969985171 4:11201404-11201426 CTTGGGTAGCAGGTGATGGAAGG + Intergenic
970281884 4:14465675-14465697 CCAGGGAAGGAGATTATACAAGG - Intergenic
970445082 4:16116659-16116681 CTAGGGAAGGAGATGTTGGGGGG + Intergenic
970708945 4:18839238-18839260 CCGGGGAGGCAGAGGATGCAGGG + Intergenic
970841994 4:20484531-20484553 CTAGAGACCCAGATCATGCATGG - Intronic
972228624 4:37043999-37044021 CTAGTGAAGAAGAGGATTCAAGG + Intergenic
974471861 4:62329381-62329403 CTAGGGAACCAAAGGATCCAGGG + Intergenic
974508920 4:62811558-62811580 CCCGGGAAGCAGAGGTTGCAGGG - Intergenic
974725177 4:65789549-65789571 CAAGGGGAGAAGATTATGCAGGG - Intergenic
975445818 4:74463930-74463952 CTAGGGAAGCAGCTCTTTCAGGG + Intergenic
975758925 4:77598881-77598903 CTCGGGAGGCAGAGGTTGCAGGG - Intronic
977153413 4:93542849-93542871 CTAGGAAAGGAGAAGATGCTGGG - Intronic
979237317 4:118415906-118415928 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
979466765 4:121048490-121048512 CTAGGGCAGTTGAGGATGCAGGG - Intronic
983878651 4:172907008-172907030 CAAAGGAAGGAGATGATACAAGG + Intronic
984509710 4:180664377-180664399 CTAGGGAAACAGAAAATGCCTGG - Intergenic
984684036 4:182645891-182645913 CAAGGGGAGTAGATGATACAAGG + Intronic
985323486 4:188740596-188740618 CCAGGAAAGCTGATGGTGCAAGG + Intergenic
987189851 5:15465194-15465216 CAAGGGGAGCAGATTATCCAGGG + Intergenic
988006328 5:25416546-25416568 CTTGGGAGGCAGAGGTTGCAGGG - Intergenic
988592294 5:32559068-32559090 CTCGGGAGGCAGAGGTTGCAGGG + Intronic
988702735 5:33691575-33691597 CTAGGGAAGCAGGCGAGACATGG + Intronic
989000739 5:36757611-36757633 CAAGGGAAGGAGATTATACAAGG - Intergenic
991511052 5:67376515-67376537 GAAGGGAACCAGATGAGGCAGGG - Intergenic
991698633 5:69297139-69297161 CTTGGGAGGCAGAAGTTGCAGGG - Intronic
993310034 5:86318090-86318112 CCTGGGAGGCAGAGGATGCAGGG - Intergenic
994271801 5:97786406-97786428 CTAGGAAATCAGATAATGGATGG - Intergenic
994665783 5:102703761-102703783 ATAGGGAACCAGATCATGTAGGG + Intergenic
996447457 5:123572205-123572227 CTAGGGAAGGAGATGAAGGGAGG - Intronic
996901802 5:128551543-128551565 CTAGGAAAGCAGCTGATTCCAGG + Intronic
998070306 5:139192638-139192660 CCAGAGAAGCAGATGATAAATGG + Intronic
998174477 5:139893528-139893550 CTGGGGAAGGAGCTGCTGCAGGG - Intronic
998425524 5:142024968-142024990 TTAGGGAAGCGGGTCATGCAGGG + Intergenic
1001648043 5:173296868-173296890 CTAGGGTAGCAGGTGGAGCAGGG + Intergenic
1001943288 5:175755881-175755903 CCTGGGAAGCAGAGGCTGCAGGG + Intergenic
1002185056 5:177450546-177450568 CTATGGAAGGAGATGCTGGAGGG - Intronic
1002519830 5:179786162-179786184 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1002542050 5:179912952-179912974 CTAGGGAAGGCGATGATCCGCGG + Intronic
1002586773 5:180253477-180253499 CTATGGAGGCAGAAGAGGCAAGG + Intronic
1003595559 6:7471177-7471199 CTTGTGAAGCAAATGATGGATGG - Intergenic
1004215458 6:13699784-13699806 CTTGGGAGGCAGAAGTTGCAAGG + Intronic
1005030298 6:21502431-21502453 CTAGTGAAGAAGGTGAGGCAAGG - Intergenic
1006338728 6:33434069-33434091 CTAGGGAAGAAGAGGAGGTAGGG - Intronic
1007933713 6:45714948-45714970 CTAGGGCAGCAGAGGCTGTAAGG - Intergenic
1008271437 6:49494949-49494971 CTAGTGGAGCAGATGGAGCAGGG + Intergenic
1009930996 6:70177496-70177518 CGAAGGATGCAGATGATGGATGG - Intronic
1010107561 6:72187567-72187589 CTCAGGAAGCAGAGGTTGCAGGG - Intronic
1012405392 6:98890841-98890863 CTAGGGAGGCGGAGGTTGCAGGG + Intronic
1014146898 6:118008333-118008355 CAAGGGAAGAAGATTATGTAGGG + Intronic
1014446529 6:121534555-121534577 ATAGGGATGGAGATTATGCATGG - Intergenic
1015524571 6:134163407-134163429 CCAGGGAGGCAGAGGATGCAGGG + Intergenic
1015737129 6:136413084-136413106 CTTGGGAGGCAGAAGATGCAGGG + Intronic
1016604748 6:145907529-145907551 CTAGGGGACCAGATGTTGAAGGG - Intronic
1017097869 6:150820787-150820809 CCTGGGAAGCAGAGGTTGCAAGG + Intronic
1017264693 6:152429147-152429169 CATGGGAAGCAGGTAATGCAGGG - Intronic
1017312369 6:152988771-152988793 CCAGGAAAGCTGATGGTGCAAGG - Exonic
1018261918 6:161978852-161978874 CTAGGGAAGCAGAGTATTCTGGG + Intronic
1019175170 6:170155722-170155744 CTAGGTGAGCAGTGGATGCAGGG + Intergenic
1019179793 6:170178965-170178987 CAAGGAGAGCAGCTGATGCAGGG - Intergenic
1019974595 7:4570576-4570598 CTGGGGATGCAGAGGTTGCAAGG + Intergenic
1020058275 7:5133644-5133666 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1020063464 7:5169649-5169671 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1022451879 7:30523418-30523440 TCAGGGTAGCAGATGATGTAGGG + Intronic
1023490056 7:40730041-40730063 CCAGGGAAGAACATGAAGCAGGG + Intronic
1023904890 7:44514935-44514957 CTTGGGAGGCAGAGGTTGCAGGG + Intronic
1024020341 7:45362640-45362662 CTAGAGAAGCAGATGCTGCAAGG + Intergenic
1024058949 7:45683964-45683986 CGGGGGAAGCAGATGATGGGAGG + Intronic
1024269560 7:47632241-47632263 GTAGGGAAGAAAATGAAGCAGGG + Intergenic
1024276382 7:47680281-47680303 CGTGGGAGGCAGATGTTGCAGGG + Intergenic
1024448388 7:49509441-49509463 CTATGGAAACAGCTGTTGCAGGG - Intergenic
1026279759 7:68911776-68911798 CAAGGGAAGCTGATGAAGTAAGG - Intergenic
1026487000 7:70830247-70830269 CTTGTGAAGCAGATGGTGAAGGG - Intergenic
1027345339 7:77253956-77253978 CTAGAGAGGCTGATGAGGCAGGG + Intronic
1027825658 7:83112131-83112153 CCCGGGAAGCAGAGGTTGCAGGG - Intronic
1028741215 7:94278052-94278074 GTATGGAAGCAGAAGTTGCAGGG + Intergenic
1029075312 7:97929592-97929614 CCAGGGAAGCAGAGGAGGCCAGG + Intergenic
1029416781 7:100448112-100448134 CCCGGGAAGCAGAAGTTGCAGGG + Intergenic
1029464541 7:100716930-100716952 CAAGGTGAGCAGAGGATGCAGGG + Intergenic
1030564601 7:111137898-111137920 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
1032447550 7:131997613-131997635 CTAGGGAAGCAGATCATGGAAGG - Intergenic
1033657983 7:143386186-143386208 CCGGGGAAGCAGGTGATGGAGGG + Intronic
1036258574 8:7223226-7223248 CCAGGGAAGCAGAGGAGGCCCGG + Intergenic
1036308045 8:7616282-7616304 CCAGGGAAGCAGAGGAGGCCAGG - Intergenic
1036310629 8:7681822-7681844 CCAGGGAAGCAGAGGAGGCCCGG + Intergenic
1036358901 8:8064283-8064305 CCAGGGAAGCAGAGGAGGCCAGG - Intergenic
1036830523 8:12016344-12016366 CCAGGGAAGCAGAGGAGGCCAGG + Intergenic
1036892057 8:12602669-12602691 CCAGGGAAGCAGAGGAGGCCAGG + Intergenic
1036899603 8:12660644-12660666 CCAGGGAAGCAGAGGAGGCCAGG + Intergenic
1036900672 8:12666791-12666813 CCAGGGAAGCAGAGGAGGCCAGG + Intergenic
1037762497 8:21751160-21751182 CTTAGGAAGCAGCTGGTGCAGGG + Intronic
1039347503 8:36723570-36723592 CCTGGGAGGCAGAGGATGCAGGG + Intergenic
1039352548 8:36779122-36779144 AAAGGGAACCAGATTATGCAAGG - Intergenic
1040890254 8:52309738-52309760 AGAAGGAAGCAGATGATGTATGG - Intronic
1041275874 8:56157202-56157224 CTAAGGACGCGGATGATGCGGGG - Intergenic
1042721196 8:71828377-71828399 CCGGGGAAGCAGATGCTGCCCGG + Intronic
1043211814 8:77529045-77529067 CTATGGAAGGAGATGATTTAGGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043403091 8:79902922-79902944 CCCGGGAAGCAGAGGTTGCAGGG - Intergenic
1043982754 8:86659857-86659879 TCAGGTTAGCAGATGATGCAGGG + Intronic
1044590276 8:93907618-93907640 CTAGGTAAATGGATGATGCATGG - Intronic
1044621111 8:94191525-94191547 CCTGGGAGGCAGATGTTGCAGGG - Intronic
1045505016 8:102772140-102772162 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1045941705 8:107746225-107746247 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1047145250 8:122191423-122191445 CAAGAGAAGGAGATGATGGAAGG - Intergenic
1048891745 8:138954399-138954421 CTAGGGAGGCTGAGGTTGCAGGG + Intergenic
1050482796 9:6103445-6103467 GCAGGGAAGGAGATTATGCATGG + Intergenic
1051735838 9:20198397-20198419 CTAAAGAAGCAGATGATCTAAGG - Intergenic
1052296460 9:26901190-26901212 CAAGGGGAGTAGATTATGCAAGG - Intergenic
1052784058 9:32812339-32812361 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1056512440 9:87318689-87318711 CTGGGCATGCAAATGATGCATGG + Intergenic
1056741100 9:89256037-89256059 CCTGGGAGGCAGATGTTGCAGGG - Intergenic
1057175119 9:92991152-92991174 CTAGGGAGGCAGAGGTTGCAGGG - Intronic
1057424274 9:94935871-94935893 GGAGGGGAGCAGATGAAGCAGGG - Intronic
1057440143 9:95077191-95077213 CTAGGAAAGCAGATGCTGGCAGG - Intronic
1059307410 9:113365573-113365595 CTGGAGAAGCAGCTGATTCAGGG - Intronic
1059520519 9:114937023-114937045 CTAGGGAAGTAGGAGATTCAAGG + Intergenic
1059766464 9:117388314-117388336 CTAGGGAAGAAGATGATACCTGG - Intronic
1061364294 9:130163388-130163410 CCTGGGAAGCAGAGGCTGCAGGG - Intergenic
1203473848 Un_GL000220v1:134136-134158 CCAGGGAAGCGGAGGCTGCAGGG + Intergenic
1187715251 X:22096141-22096163 CAAGGGAATTAGATGATGGAAGG + Intronic
1188488523 X:30710332-30710354 CTAGGTTAGCAGATGAAGGAAGG - Intronic
1189446109 X:41083702-41083724 GTGGGGAAGCAAATGATTCATGG + Intergenic
1190790021 X:53690353-53690375 CCAGGGAGGCAGAGGTTGCAGGG - Intergenic
1192153139 X:68724282-68724304 CTAGGGAAGCAGAAGAAACCAGG - Intronic
1192996296 X:76516418-76516440 GTAGGGATGGAGATTATGCAAGG + Intergenic
1193571179 X:83146296-83146318 CTATTGAAGCTGATGATTCAAGG + Intergenic
1195903231 X:109819763-109819785 CTGGGCAAGCAGATGATGTTTGG + Intergenic
1196824727 X:119732109-119732131 CAAGGGAAGCAGGAGTTGCAAGG + Intergenic
1196922641 X:120600427-120600449 CCCGGGAAGCAGAGGGTGCAGGG + Intronic
1197111775 X:122783619-122783641 CTAGGGAAGGAAATGATCCAGGG + Intergenic
1199052800 X:143257274-143257296 CTAGGGAAGCAATTAATCCAGGG + Intergenic
1202031717 Y:20582284-20582306 CTCGGGAGGCAGAGGTTGCAGGG - Intronic
1202366689 Y:24170682-24170704 CCAGGGTAGCAGATGATGCAGGG - Intergenic
1202373715 Y:24214800-24214822 CCAGGGTAGCAGATGATGCATGG + Intergenic
1202497066 Y:25455320-25455342 CCAGGGTAGCAGATGATGCATGG - Intergenic
1202504093 Y:25499441-25499463 CCAGGGTAGCAGATGATGCAGGG + Intergenic