ID: 1162350414

View in Genome Browser
Species Human (GRCh38)
Location 19:10145458-10145480
Sequence GGAAGGCATCTGGAAAACGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162350414 Original CRISPR GGAAGGCATCTGGAAAACGT TGG Intronic
901316618 1:8314433-8314455 GGGAGGCAGCAGGAAAACCTCGG - Intergenic
902588838 1:17459019-17459041 GGAAGGCTTCTGGGAAGCCTTGG - Intergenic
904562574 1:31408656-31408678 GGAAAGCATCTGGAGACCTTTGG + Intergenic
905042420 1:34971021-34971043 GGAAGGTATCTGGATCACGGGGG + Intergenic
905229755 1:36507724-36507746 GGAAGGCTTCTGGTACAGGTGGG + Intergenic
906824000 1:48959092-48959114 GGGAGGCATCTGGATAGCGTAGG + Intronic
909247127 1:73300417-73300439 GCAAGGCTTCTGGTAAAAGTAGG + Intergenic
909944548 1:81649109-81649131 GGAAGAAGTCTGGAAAATGTGGG - Intronic
909952741 1:81738720-81738742 AGACTGCATCTGGAAAACGGGGG - Intronic
913402345 1:118449720-118449742 GGAAGGCATCTGGTAGAAGGTGG + Intergenic
915866776 1:159509550-159509572 GGAGGGCATGTGGGAAAAGTGGG - Intergenic
920738792 1:208560394-208560416 GGAAGGGATCTGGCAAAACTGGG + Intergenic
922947146 1:229526371-229526393 GGCAGGCAGCTGGAAAATGCAGG - Intronic
1063867038 10:10376365-10376387 TGAAGGCATCAGGAAAATTTTGG + Intergenic
1065774893 10:29110474-29110496 GGAAGTTTTCTGGAAAACCTAGG - Intergenic
1066252729 10:33650057-33650079 GTAAGGGACCTGGAAAACTTTGG - Intergenic
1068220203 10:54034698-54034720 GGAAGGCAGCTGGAAAAGGAAGG - Intronic
1070440693 10:76440194-76440216 GGAAGGCCTCTGGAAAGGTTTGG + Intronic
1073467933 10:103705046-103705068 GGAAGGCAGCTGGAGAAGGCTGG - Intronic
1075586555 10:123662677-123662699 GGTTCTCATCTGGAAAACGTGGG + Intergenic
1076138780 10:128063570-128063592 GAAATGCTTTTGGAAAACGTTGG + Intronic
1078679657 11:13463515-13463537 GGAAGTCAAGGGGAAAACGTGGG - Intergenic
1081295878 11:41388617-41388639 GGAAGGCATTTGGTAAACTAGGG + Intronic
1081384551 11:42456308-42456330 TGAAGTCATCTGGAAAAAGGCGG - Intergenic
1083709409 11:64538960-64538982 GGAAAGCAACTCGAAAAGGTGGG - Intergenic
1084608744 11:70187546-70187568 GGCAGGCCTCTGGGAAATGTTGG - Intronic
1084914969 11:72421781-72421803 GGAAGGCAATTGGGAAAGGTTGG - Intronic
1085064891 11:73485753-73485775 GCAGGGCATCTGGACAAAGTAGG - Intronic
1087349840 11:97018110-97018132 GGAATGTAACTGGAAAATGTGGG + Intergenic
1088020204 11:105110173-105110195 CGAAGACATCTGGAAAACATAGG + Intergenic
1088595847 11:111439594-111439616 GGACGGCATCTGGAAGAGGAAGG - Intronic
1093954665 12:25202307-25202329 GGCAGGCATCTGGGGAAGGTGGG + Intronic
1093996456 12:25648092-25648114 GGAGGGAATTTGGAAAACATAGG + Intronic
1097168555 12:57099127-57099149 GGAAGGGAGGTGGAAAAGGTGGG + Intronic
1100216632 12:92456706-92456728 GGAAGGCGTCTGGAAAGAGTTGG + Intergenic
1102441591 12:112967809-112967831 GCAAGGCATCTGGCACATGTAGG + Intronic
1104127361 12:125861182-125861204 GCGAGGCTTCTGGAAAACCTTGG + Intergenic
1105325032 13:19363093-19363115 GGAAGGCATGTTGAAAACCAAGG - Intergenic
1106860733 13:33904752-33904774 GGAAGTCACCTGGGAGACGTGGG - Intronic
1108010333 13:46000775-46000797 GGAAGGCATACTGAAAACTTAGG - Intronic
1108359243 13:49653970-49653992 GGAAGGCTTCTGGAAGACAAGGG + Intergenic
1109976198 13:69835606-69835628 GGAAGGCATCTGCAAAATGTAGG + Intronic
1110225019 13:73110675-73110697 AGAAGGCATTTGGAAAATGCTGG + Intergenic
1110716360 13:78709590-78709612 GGAAAGTATCTGGAAAATGTAGG - Intergenic
1113594005 13:111518637-111518659 GGCAGGCAGCTGTAACACGTGGG + Intergenic
1117953553 14:61105562-61105584 GGAAGGCATCTTTCAAACGGTGG + Intergenic
1118035300 14:61859747-61859769 TGAAGGCATCTGGGAAGTGTGGG + Intergenic
1119986806 14:79147631-79147653 TGAAGGCTTCTGGACAAAGTTGG - Intronic
1121657392 14:95607216-95607238 GCAAGGCGTCTGGGAGACGTAGG + Intergenic
1127039985 15:54964025-54964047 GGAAGGCATCTGGTAAATGTAGG + Intergenic
1129471560 15:75758413-75758435 GGAAGGATTCTGGAAGACATAGG + Intergenic
1129513008 15:76138708-76138730 GGAAGGCATGCGGAATATGTGGG + Intronic
1136584194 16:31173329-31173351 GGAAGGAATCTGGGGAACTTGGG - Intergenic
1137838642 16:51619303-51619325 GGAAGGCAAGTGGAAAAGGCAGG - Intergenic
1138858456 16:60724539-60724561 AGAAGGCATCTGGAAGATCTAGG + Intergenic
1139692589 16:68650680-68650702 GCAAGGCAACTGGAAACCTTCGG + Intronic
1147004595 17:37392242-37392264 GGAAGGCTTTTGGAATGCGTAGG - Exonic
1147718361 17:42522757-42522779 GGAAGGCGCCTGGGAAACTTGGG - Intergenic
1147975637 17:44246810-44246832 GGAAGGCATTAGGGAAATGTGGG - Intergenic
1148233956 17:45955155-45955177 GGAAGGCAGCTGGACAAGGGTGG - Intronic
1151096082 17:71499866-71499888 GGGAGGCATTGGGAAGACGTTGG + Intergenic
1151986835 17:77549004-77549026 GCAAGGCTTCTGGAAAGAGTTGG + Intergenic
1154356888 18:13628178-13628200 GAAAAGCATGTGGAAAACGATGG + Intronic
1158261441 18:55610303-55610325 GTAAGGCATAGGGAAAAGGTCGG - Intronic
1161814240 19:6489557-6489579 CAAAGGCATCTGGGAAATGTAGG - Intergenic
1162350414 19:10145458-10145480 GGAAGGCATCTGGAAAACGTTGG + Intronic
1165398919 19:35585238-35585260 GGAAGGCGTCTTGCAGACGTAGG - Intergenic
929932685 2:46271144-46271166 GAAAGGCCACTGGAAAAAGTTGG + Intergenic
930144201 2:47984564-47984586 GGGAGGCTTTTGGAAAACATGGG - Intergenic
933949808 2:87319165-87319187 GGACTGCACCTGGAAAACCTGGG + Intergenic
935612322 2:105038173-105038195 GCAAGGCCTCTGGAAAACCGCGG + Exonic
936330385 2:111542432-111542454 GGACTGCACCTGGAAAACCTGGG - Intergenic
939365552 2:141225881-141225903 GGAAGGGAGGTGGAAAAAGTGGG - Intronic
940495674 2:154424944-154424966 TGAAGCCATCTAGAAAACTTTGG + Intronic
943749974 2:191501044-191501066 GGGAGGCTTCTGGAAACTGTGGG + Intergenic
946278840 2:218651528-218651550 GGAAGGCATCTTGAAACAGTTGG - Intronic
1168860845 20:1044982-1045004 GGGAGGCATCTGGTAAATCTGGG + Intergenic
1169922245 20:10747770-10747792 GGAAGGCATTAGGAACACTTGGG + Intergenic
1174013528 20:47469836-47469858 GGAAGGCATCAGGGAATAGTGGG + Intergenic
1175415967 20:58801112-58801134 GGGAGGCATCCAGAAAACATTGG + Intergenic
1176416560 21:6478854-6478876 GGAAGAGATCAGGAAAAGGTTGG - Intergenic
1178991182 21:37358101-37358123 GGAAGGCATCTGTGAGACATAGG - Intergenic
1179096768 21:38323170-38323192 GGAAGGCTGCTGGGAAATGTGGG - Intergenic
1179481009 21:41678710-41678732 CTAAGGCACCTGGAAAACGGAGG - Intergenic
1179692060 21:43087189-43087211 GGAAGAGATCAGGAAAAGGTTGG - Intergenic
1181520304 22:23444664-23444686 GGAAGGCATGTTGAAAACTGAGG - Intergenic
1184298437 22:43540876-43540898 GGGAGGCATTTGGAAAACCAGGG + Intronic
949948099 3:9206390-9206412 GGAAGCCATATTGAAAACATGGG - Intronic
953343440 3:42155225-42155247 GGAAGGCAACTTGGAAACGTGGG + Intronic
955972585 3:64450677-64450699 GGAAGGGATCATGAAAACTTGGG - Intergenic
956405075 3:68919854-68919876 GGAATGTGTCTGGAAAACGTGGG - Intronic
957435311 3:80167770-80167792 CAAATGCATCTGGAAAATGTGGG - Intergenic
962636350 3:137335701-137335723 GGAGGGGTTCTGGAATACGTAGG + Intergenic
965250940 3:166343092-166343114 GGAAGGCTTCTTGCAAACTTGGG - Intergenic
967357291 3:188586461-188586483 GAAAGGAGTCTGGAAAACTTTGG + Intronic
970390391 4:15604159-15604181 GCAAGGCATGTCGAAAACTTAGG - Intergenic
971132402 4:23827240-23827262 GGAAGGCTTCTGAAAATCCTGGG + Intronic
971424863 4:26505555-26505577 GGAAGGCATCTGGAAATAATTGG - Intergenic
974209171 4:58747182-58747204 GGGAGGCATTTGGAAAATGGGGG + Intergenic
979323839 4:119355791-119355813 GTAAGGCATTTGAAAAACCTTGG + Intergenic
983241677 4:165240465-165240487 GTAAGGCATTTGAAAAACCTTGG + Intronic
987431049 5:17833490-17833512 GGAATGCATCTGGAAGACAAAGG - Intergenic
996535907 5:124577574-124577596 GGAAGGCTTCTGGGAGACATTGG - Intergenic
999226544 5:150029883-150029905 GGAAGGTATCTGGTTAGCGTCGG + Intronic
1008704743 6:54144300-54144322 GGAATGCTTCTGGAAGAAGTTGG + Intronic
1011253812 6:85401260-85401282 GGAAGGTAGCTGTAAAACTTGGG - Intergenic
1014217773 6:118768981-118769003 GGAAGGCAACTGGAAACTGCTGG + Intergenic
1014868112 6:126556834-126556856 GTAGGGAATTTGGAAAACGTAGG - Intergenic
1019570608 7:1710229-1710251 GGAAGGCATCTGGGAATTTTCGG + Intronic
1019590938 7:1831564-1831586 GGAAGGCATGTTGAAAACTGAGG + Intronic
1020372803 7:7452659-7452681 GGAGGGTATCTGGAAAAGATAGG + Intronic
1020664564 7:11023953-11023975 GGAAGGCATGTCGAAAGCCTAGG + Intronic
1023337007 7:39180835-39180857 GGAAGGCAAAGGGAAAAGGTTGG - Intronic
1023892115 7:44400373-44400395 GGAAGGCAGCTGGGAAGCGAAGG + Intronic
1026972756 7:74478027-74478049 GGCAGGCATCTGAAAAGCGTGGG - Intronic
1031715732 7:125106900-125106922 AACAGGCATCTGGAAAAAGTTGG - Intergenic
1032235499 7:130118623-130118645 GGAAGGCATGTGGAAAGCAAAGG - Intronic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1032945528 7:136847797-136847819 GAAAGGAAGCTGGAAAACCTTGG + Intergenic
1035603263 8:911473-911495 GGAAGGATGCTGGAGAACGTTGG + Intergenic
1037012002 8:13855403-13855425 GGAAGGCATATTGAAAACAAAGG - Intergenic
1040674056 8:49727422-49727444 GAAAGGCATATGAAAAATGTCGG - Intergenic
1042621617 8:70712189-70712211 GGAAAGCAGATGGAAAACCTAGG + Intronic
1043729762 8:83661826-83661848 GGAAAGAATGTGGAAACCGTAGG - Intergenic
1044691087 8:94879160-94879182 GGAATGCATGTGGCAAAAGTTGG - Intronic
1045438014 8:102184039-102184061 GGATGGAATTTGGAAAAAGTAGG + Intergenic
1045438043 8:102184369-102184391 GGATGGAATTTGGAAAAAGTGGG + Intergenic
1055453043 9:76447973-76447995 GGAAGCCATCTGGACAAAGACGG - Intronic
1056766365 9:89446957-89446979 GGAAGGCATCTGGAGAATTGAGG - Intronic
1061682360 9:132249299-132249321 GGAAGCCATCTGGAGCACTTTGG - Intergenic
1187481291 X:19658247-19658269 GGAAAGCTTCTGGAAAAAGATGG - Intronic
1189007805 X:37013250-37013272 GGAAGACAGCTGGAAAATGTGGG - Intergenic
1190789384 X:53684780-53684802 GGAAGGAGTCTGGATAATGTAGG - Intronic
1192355443 X:70398577-70398599 GGAAGGCTTCTGGAAGAGGTGGG - Intronic
1193498411 X:82241004-82241026 GCAATGCAGATGGAAAACGTGGG + Intergenic
1197274792 X:124465657-124465679 GGAAGGAATCTGAAAAAGGATGG - Intronic
1199533251 X:148873057-148873079 GGCAGGCATGTGGTTAACGTGGG - Intronic