ID: 1162358600

View in Genome Browser
Species Human (GRCh38)
Location 19:10203220-10203242
Sequence TTCTGCCCAAATCAACCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 197}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162358598_1162358600 -4 Left 1162358598 19:10203201-10203223 CCTTTGTTTTTGCTGCCACTTCT 0: 1
1: 0
2: 3
3: 36
4: 491
Right 1162358600 19:10203220-10203242 TTCTGCCCAAATCAACCTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 197
1162358595_1162358600 4 Left 1162358595 19:10203193-10203215 CCCCAAAGCCTTTGTTTTTGCTG 0: 1
1: 1
2: 10
3: 84
4: 766
Right 1162358600 19:10203220-10203242 TTCTGCCCAAATCAACCTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 197
1162358591_1162358600 30 Left 1162358591 19:10203167-10203189 CCCCTGGCCTCTCAAGTTCTTAA 0: 1
1: 0
2: 1
3: 17
4: 210
Right 1162358600 19:10203220-10203242 TTCTGCCCAAATCAACCTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 197
1162358597_1162358600 2 Left 1162358597 19:10203195-10203217 CCAAAGCCTTTGTTTTTGCTGCC 0: 1
1: 0
2: 0
3: 41
4: 344
Right 1162358600 19:10203220-10203242 TTCTGCCCAAATCAACCTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 197
1162358596_1162358600 3 Left 1162358596 19:10203194-10203216 CCCAAAGCCTTTGTTTTTGCTGC 0: 1
1: 0
2: 2
3: 37
4: 359
Right 1162358600 19:10203220-10203242 TTCTGCCCAAATCAACCTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 197
1162358594_1162358600 23 Left 1162358594 19:10203174-10203196 CCTCTCAAGTTCTTAAGTGCCCC 0: 1
1: 0
2: 0
3: 2
4: 90
Right 1162358600 19:10203220-10203242 TTCTGCCCAAATCAACCTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 197
1162358592_1162358600 29 Left 1162358592 19:10203168-10203190 CCCTGGCCTCTCAAGTTCTTAAG 0: 1
1: 0
2: 1
3: 31
4: 624
Right 1162358600 19:10203220-10203242 TTCTGCCCAAATCAACCTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 197
1162358593_1162358600 28 Left 1162358593 19:10203169-10203191 CCTGGCCTCTCAAGTTCTTAAGT 0: 1
1: 0
2: 4
3: 24
4: 211
Right 1162358600 19:10203220-10203242 TTCTGCCCAAATCAACCTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162358600 Original CRISPR TTCTGCCCAAATCAACCTTC TGG Intronic
909871021 1:80739252-80739274 TACTACCCAAAGCAATCTTCAGG + Intergenic
912604484 1:110974659-110974681 TTCTTCCCAAATCAAGCATGAGG - Intergenic
913416371 1:118613245-118613267 TACTACCCAAAGCAACCTACAGG - Intergenic
914707436 1:150181950-150181972 ATCTCTCCAGATCAACCTTCAGG + Intergenic
916960682 1:169885426-169885448 TACAGCCCAAATCCACCTGCAGG + Intronic
917459119 1:175213456-175213478 TTTTGCCCAGATCAACATCCTGG + Intergenic
918746527 1:188208493-188208515 TACTGCCCAAAACAATCTACAGG + Intergenic
918960110 1:191264130-191264152 TTTCTCCCAAATCAACATTCTGG - Intergenic
919358330 1:196556075-196556097 TTTTGCCCAGATCAATGTTCTGG - Intronic
919590798 1:199499404-199499426 TACTGCCCAAAGCAATCTACAGG + Intergenic
920921856 1:210303913-210303935 TTCTGCCCTTCTGAACCTTCTGG - Intergenic
921989251 1:221346547-221346569 TTCTGCCCACATGCTCCTTCTGG - Intergenic
1064133534 10:12730888-12730910 TTCAGCTCCAATCAAGCTTCTGG - Intronic
1065672501 10:28135611-28135633 TTCTGCCCTATGCAAACTTCAGG - Intronic
1068825498 10:61434187-61434209 GTCTGCCCAATTCAACCTCTGGG + Intronic
1071101348 10:82041505-82041527 TACTGCCCAAAGCCACCTTTGGG + Intronic
1072572722 10:96672776-96672798 TTCTTCCAAGTTCAACCTTCAGG + Intronic
1073953869 10:108844555-108844577 TACTGCTCAAAGCAAACTTCAGG - Intergenic
1073962413 10:108947887-108947909 TACTTCCCAAATTGACCTTCAGG - Intergenic
1074230824 10:111533177-111533199 TTCTGTCCACATCAACATTTAGG - Intergenic
1074635336 10:115309346-115309368 TACTGCCCAAAACAATCTGCAGG - Intronic
1075118216 10:119644790-119644812 TGCTGCCCAGATCCACTTTCAGG - Intergenic
1076074097 10:127518848-127518870 TACCACCCAAATCAACCTACCGG - Intergenic
1076803218 10:132842374-132842396 TCCTGTCCAAATCAGCATTCTGG + Intronic
1077073485 11:688930-688952 TGCTTCCAAAATCAGCCTTCAGG + Intronic
1079120903 11:17684187-17684209 TTCTCCCCATATCAAACTCCTGG - Intergenic
1082212218 11:49518919-49518941 TTCAGCCCCAGTCAACCTTCTGG + Intergenic
1082684358 11:56219950-56219972 CTCTACCCAATTCAAGCTTCCGG - Intergenic
1085493212 11:76941724-76941746 TACTGCCCAAATCAATCTACAGG - Intronic
1086737494 11:90324086-90324108 TTTTGCCCAGATCAATGTTCTGG + Intergenic
1087426423 11:97992895-97992917 GTCAGCCCAATTGAACCTTCAGG - Intergenic
1090165673 11:124544294-124544316 TACTGCCGAAATTCACCTTCTGG - Intergenic
1095400277 12:41806681-41806703 TACTGCCCAAAGCAATCTACAGG - Intergenic
1097458141 12:59826147-59826169 TTCTCCCTGCATCAACCTTCAGG - Intergenic
1097931017 12:65186546-65186568 TTCTGCCCAAAACAAAACTCAGG - Intronic
1098060816 12:66560242-66560264 TTTTGCCCAAATCAATGTCCTGG - Intronic
1100670309 12:96804684-96804706 TACTGCCCAAAGCAATCTACAGG + Intronic
1104622058 12:130322010-130322032 TTTTTCCCAAATCAACATACAGG + Intergenic
1104734157 12:131126555-131126577 TTATTCACAAATCAACATTCTGG + Intronic
1104786937 12:131456018-131456040 TTCTGGCCAAAAGAGCCTTCAGG + Intergenic
1107805871 13:44153441-44153463 TTCAGCTTAAATCAACATTCAGG + Intronic
1112021523 13:95375419-95375441 TACTGCCCAAAGCAATCTACAGG + Intergenic
1114331125 14:21638039-21638061 TTCTCCAAAAATCTACCTTCTGG - Intergenic
1115251582 14:31354126-31354148 TTATGTCCAAAGCAACCTACAGG + Intronic
1116641801 14:47472995-47473017 ATTTCCCCAAATCAACCTCCTGG - Intronic
1119554210 14:75540978-75541000 TTCTCCCCACCTCAGCCTTCTGG - Intronic
1121384592 14:93508409-93508431 TTCTGCCAAAATAATCCTGCTGG + Intronic
1122065808 14:99173961-99173983 TACTGCCTTAATCAACCCTCGGG + Exonic
1122534620 14:102453631-102453653 ATCTGCACAACTCCACCTTCAGG - Intronic
1125206145 15:37155468-37155490 TGCTGCCCAAATCCCTCTTCAGG + Intergenic
1125393215 15:39218240-39218262 TTTTGCCCAGACCAACATTCTGG - Intergenic
1126957775 15:53953421-53953443 TTCTGTCCAATTCAACCCTAAGG + Intergenic
1127127283 15:55824139-55824161 TTCAGGCCAATGCAACCTTCTGG + Intergenic
1127418940 15:58785918-58785940 ATCTGCCCACCTCAACCTCCCGG + Intronic
1129135548 15:73546986-73547008 TTTTGCCCAGATCAACATCCTGG - Intronic
1131397450 15:92097868-92097890 TACAGCCCAAATCCACCTGCAGG - Intronic
1134427749 16:14167926-14167948 ATCTGCCCACCTCAGCCTTCCGG + Intronic
1135381986 16:22003255-22003277 TGCTGCCCAGATCCCCCTTCAGG + Intergenic
1137362087 16:47827595-47827617 TTTTGGCCAGATCAACCTCCAGG - Intergenic
1137424351 16:48365216-48365238 TTCTGTTTAAATCAAACTTCAGG - Intronic
1145268686 17:21392798-21392820 TGCTGCCCACACCCACCTTCAGG - Intronic
1147175759 17:38655244-38655266 TTCTGCACAGATAAACCTCCAGG + Intergenic
1149258990 17:54858649-54858671 ATCTGCCCACATCCACCTTCAGG - Intergenic
1151756370 17:76077410-76077432 TTCAGGCCACATCAACCGTCAGG - Exonic
1155349062 18:24888311-24888333 TTCTGCCAAAATAACACTTCTGG + Intergenic
1156427757 18:37033747-37033769 TTCTGGCCACCTCAACCTCCCGG + Intronic
1157953494 18:52067305-52067327 TTCTTCCCAAATCGACATGCAGG + Intergenic
1158360418 18:56666133-56666155 ATGTGCCCAAATCTTCCTTCAGG - Intronic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1162222984 19:9194554-9194576 TTGTTCCCAAATCAAAGTTCAGG - Intergenic
1162358600 19:10203220-10203242 TTCTGCCCAAATCAACCTTCTGG + Intronic
1163035672 19:14567560-14567582 CTCCGGACAAATCAACCTTCAGG + Intronic
1165830081 19:38726179-38726201 ATCTGCCCACCTCAACCTCCTGG - Intronic
933149526 2:78897110-78897132 TTCTGCCCAAGACATTCTTCAGG - Intergenic
933512550 2:83259466-83259488 TACTGCCCAAAGCAACTTACAGG + Intergenic
934135020 2:88987285-88987307 TTCTGCCCAAGTCCACCCTGTGG + Intergenic
934235287 2:90226465-90226487 TTCTGCCCAAGTCCACCCTGTGG - Intergenic
936578261 2:113673163-113673185 GTCTGCACAAATAAACCTTATGG + Intergenic
937685771 2:124695217-124695239 TTCTGCTCAGGTCCACCTTCAGG - Intronic
939346647 2:140974803-140974825 TACTGCACAAGTCAACCTTCTGG + Intronic
939662962 2:144913228-144913250 TACTGCCCAAAGCAATCTACAGG - Intergenic
941117164 2:161485472-161485494 TACTGCCCAAAGCAATCTACAGG + Intronic
947987692 2:234463079-234463101 TTCTGCCCACAGCAGCCTCCAGG + Intergenic
1169076411 20:2762528-2762550 TGTTGCCCAAATAAACCATCTGG - Intergenic
1169353576 20:4889696-4889718 TCCTGCCCATCTCAACCTTGAGG + Intronic
1170348982 20:15418938-15418960 TTCTGCCAAAATAACCCTGCAGG + Intronic
1170418087 20:16165627-16165649 TTCTGGCCAAACGAACCTACAGG + Intergenic
1172022735 20:31925739-31925761 TCTTTCCCAAATCATCCTTCAGG - Intronic
1173839649 20:46149106-46149128 TCCTCCCCAAATCGCCCTTCAGG - Intergenic
1174929541 20:54797871-54797893 TTCTCCCTAAATCAACCTAGAGG - Intergenic
1177213741 21:18102923-18102945 TTGTGCCAAAATAAAGCTTCAGG - Intronic
1179245961 21:39634488-39634510 CTCTGCCCAATTCTTCCTTCTGG + Intronic
1181138128 22:20783815-20783837 TTCTGCCCAAATCAGGCCTCAGG + Intronic
1181186070 22:21104835-21104857 ATCTGCCCACATTGACCTTCTGG + Intergenic
1182584136 22:31333957-31333979 TTCTGCCCTACTCCACCATCTGG + Intronic
951058712 3:18179031-18179053 TTTTCCCTAATTCAACCTTCAGG + Intronic
951070605 3:18324500-18324522 ATCTGACCAAAAAAACCTTCTGG - Intronic
951591265 3:24267682-24267704 TTCTGGCTAAACCAACCTACCGG - Intronic
953476427 3:43209538-43209560 TTGTGCCAACATCATCCTTCAGG - Intergenic
954781603 3:53066104-53066126 TTCTCATCAAATCAACCTTAGGG - Intronic
955234158 3:57124883-57124905 TTCTCCCCAACCCAAGCTTCAGG + Intronic
956326785 3:68061808-68061830 TTCTCCACAAAACACCCTTCAGG + Intronic
961747734 3:129076124-129076146 TTTTTCCCAAATCAACTTTGGGG - Intergenic
962736983 3:138334230-138334252 TTCTTCCCAAGTCAATCTTTAGG - Intergenic
963545087 3:146647050-146647072 TTCTGCACAACTGAAGCTTCTGG + Intergenic
963830084 3:149997939-149997961 TGCTGCCCAAAGCAATCTACAGG + Intronic
964134149 3:153325620-153325642 TACTGCCCAAAGCAACTTGCAGG - Intergenic
964565248 3:158043545-158043567 TACTGCCCAAACCAATCTACAGG + Intergenic
964639826 3:158896932-158896954 TACTTGCCAAATCAAGCTTCTGG - Intergenic
964953098 3:162321716-162321738 TACTACCCAAAGCAATCTTCAGG - Intergenic
965571503 3:170178085-170178107 TTATGGCCTAATCACCCTTCAGG - Intronic
965647799 3:170902291-170902313 TTCTTCCCAAACCCACTTTCAGG - Intronic
966384021 3:179375806-179375828 TGCTTACCAAATCAACTTTCTGG - Intronic
966533283 3:181004265-181004287 CTCTGCCCAGTTCAAACTTCTGG + Intergenic
966836424 3:184052888-184052910 CTCTGCCCAGATGCACCTTCCGG - Intergenic
967044879 3:185727308-185727330 ATCTGCCCAGACTAACCTTCCGG - Intronic
969608325 4:8213207-8213229 TTCTGCACATACCAGCCTTCTGG + Intronic
969650660 4:8465996-8466018 TTCTGCCCAAATGACATTTCAGG - Intronic
969728169 4:8938199-8938221 TGCTGCCCAAATCCCCCTTTAGG - Intergenic
971894846 4:32579275-32579297 TACTGCCCAAATCCCCCTTCAGG - Intergenic
972068037 4:34977017-34977039 TGCTGCCCAAAACAACTTTTGGG + Intergenic
973590296 4:52434035-52434057 TGCAGCCCAAATCATCCCTCTGG - Intergenic
973602102 4:52552306-52552328 TTTAGCCCACCTCAACCTTCAGG + Intergenic
973659253 4:53085961-53085983 TTTTGCCCAAATCAATTTCCTGG - Intronic
974024702 4:56723206-56723228 CTCAGCTCAAATCAAGCTTCTGG - Intergenic
978994678 4:115135888-115135910 TACTGCCCAAAGCAATCTACAGG + Intergenic
979630622 4:122898813-122898835 TTCTGGAGAAATAAACCTTCTGG - Intronic
980528757 4:134023021-134023043 TTCTGGCTAAATCAACTTCCAGG - Intergenic
990125658 5:52514708-52514730 TACTGCCCAAAGCAATCTACAGG + Intergenic
991238753 5:64431453-64431475 TTTTGCCCAGATCAATGTTCTGG - Intergenic
994236221 5:97366101-97366123 TTCTTCCCAATTCCACTTTCAGG - Intergenic
994253055 5:97559653-97559675 TTCTGGACAAATCAACATTTGGG - Intergenic
995235701 5:109827432-109827454 TATTGCCCAAATTAAGCTTCAGG + Intronic
995324812 5:110878121-110878143 TTTTGCCCAGACCAACTTTCTGG + Intergenic
995329106 5:110926809-110926831 CTCTGCCCAAATTGATCTTCAGG + Intergenic
997519655 5:134514621-134514643 TCTTGCCCATTTCAACCTTCAGG + Intergenic
1001738361 5:174026848-174026870 TTTTGCCCAATTCAACCATGGGG + Intergenic
1003503753 6:6723749-6723771 TTCTGCCTCCATCACCCTTCCGG + Intergenic
1003738889 6:8911796-8911818 TTCTGCCCAGATCCATGTTCTGG - Intergenic
1005156608 6:22814183-22814205 TTTTGCCCAGATCAACGTCCTGG + Intergenic
1005177848 6:23068432-23068454 TTTTGCCCAGATCAACATCCTGG - Intergenic
1006274514 6:32991768-32991790 TACTGCCCAAAGCAATCTACAGG - Intergenic
1008325505 6:50176136-50176158 TTCTAGCCACATCGACCTTCTGG - Intergenic
1008458253 6:51737183-51737205 TTCTGACCACATACACCTTCAGG - Intronic
1008894915 6:56542015-56542037 CTCTGCCGAAATTAACATTCAGG - Intronic
1009185659 6:60571791-60571813 GTCTGCCCAAAGCCACCTTGTGG + Intergenic
1010377200 6:75184912-75184934 TTTTTCACAAATCAACCTGCAGG + Intronic
1010678259 6:78769032-78769054 TTTTGCCCAGATCAATATTCTGG - Intergenic
1011866849 6:91839725-91839747 TTCTTCCCAAAACAATCTTCTGG + Intergenic
1012833671 6:104238537-104238559 TTTTTCCCAAATCAGTCTTCAGG + Intergenic
1015122111 6:129711067-129711089 TTCTGTTCAAATCCAGCTTCTGG - Intergenic
1016033151 6:139358139-139358161 TGCTGCTCAAATCCCCCTTCAGG - Intergenic
1017832137 6:158140275-158140297 TTCTGCCCTACTCAACCTCTAGG + Intronic
1018081281 6:160261369-160261391 TTGTGCCCAGACTAACCTTCTGG + Intronic
1020735036 7:11937735-11937757 TACTGCCCAAAGCAATCTACAGG + Intergenic
1022459453 7:30591084-30591106 TTCTCCCCAAATTAAACTACAGG + Intergenic
1023435963 7:40140916-40140938 TTGTGCCCAAAGCAATCTGCAGG - Intronic
1024108135 7:46114541-46114563 TTCTGCCCAAATTGACCTACAGG - Intergenic
1026224865 7:68431427-68431449 ATTTGCCCTTATCAACCTTCTGG + Intergenic
1026453345 7:70548980-70549002 TTCTGCCCAAATTGACCTGTGGG - Intronic
1028781504 7:94742706-94742728 TTCTGCACAAATCAAAGCTCAGG + Intergenic
1031192757 7:118575654-118575676 TTCTTCCCATATCAATTTTCAGG - Intergenic
1032295912 7:130638484-130638506 TTCCGCCCAGTTCAAACTTCTGG + Intronic
1032681139 7:134184802-134184824 CTCAGCCCAAATCACCCTCCAGG + Intronic
1033134406 7:138773037-138773059 TTCCCCCCAGGTCAACCTTCTGG + Intronic
1037154248 8:15680156-15680178 TTCTGCCCAAAGCAATCTACGGG - Intronic
1037371826 8:18188261-18188283 GTCTGCCCAAGCCCACCTTCCGG + Intronic
1039405619 8:37309967-37309989 TTCTCCCCCACTCATCCTTCAGG + Intergenic
1039679748 8:39718945-39718967 TTCTGTCAAAATCATCCATCAGG + Intronic
1042220444 8:66468001-66468023 TTCTGCCGAAACCAATCTTGGGG - Intronic
1042285811 8:67109153-67109175 TTCTGCCCCACTCAAGCCTCCGG - Intronic
1042498162 8:69479058-69479080 TTCTGCCCACATCACTCTCCAGG + Intronic
1043342256 8:79254490-79254512 TTCTGGCTAAATCAACCTAAAGG + Intergenic
1043653747 8:82634807-82634829 TTCTTCTCATATCAAACTTCTGG - Intergenic
1043702371 8:83305143-83305165 TTTTGGCCAAACCAACCTTCTGG + Intergenic
1044006915 8:86948829-86948851 TTTTGCCCAAACCAACGTCCTGG + Intronic
1044803123 8:95977370-95977392 TTGTAGCAAAATCAACCTTCAGG + Intergenic
1045124416 8:99073301-99073323 TACTGCCCAAAGCAATCTACAGG - Intronic
1045727824 8:105196104-105196126 ATCTGCCCAAATCATCCTCCAGG - Intronic
1046949181 8:120003548-120003570 TACTGCCCAAAACACCCTTCAGG - Intronic
1048581503 8:135732799-135732821 TTCTGACCTCATCAGCCTTCTGG - Intergenic
1049988963 9:975148-975170 CTCTCCGCAAATCAGCCTTCTGG + Intergenic
1050857507 9:10378380-10378402 TTTTGCCCAGATCAATGTTCTGG + Intronic
1052204535 9:25823239-25823261 TTTTTCCCAGATCAACGTTCTGG + Intergenic
1054889145 9:70232878-70232900 CTCTGCCCAGTTCAAACTTCTGG - Intergenic
1054974214 9:71122990-71123012 TTATGCCCATGTCAACCTTATGG + Intronic
1055150368 9:72990920-72990942 TTCTGCCCAAATCATCCAGGTGG + Intronic
1056503441 9:87233349-87233371 TTCTCCCTAAACCATCCTTCTGG + Intergenic
1057451333 9:95163521-95163543 TACTACCCAAAGCAATCTTCAGG - Intronic
1057643237 9:96848746-96848768 TTCTGCCCAAAGCAATCTACAGG + Intronic
1057790678 9:98122769-98122791 ATCTGCCCACATCATCCTGCAGG + Exonic
1058139125 9:101339456-101339478 GTCTGACCAAATTAAACTTCTGG + Intergenic
1059058301 9:111007692-111007714 TATTGCCAAAATCATCCTTCAGG - Intronic
1061430152 9:130525917-130525939 TTCAGCCCAAATCATCTTTTGGG + Intergenic
1189182323 X:39016054-39016076 TTCTGGCCAAAGAAATCTTCTGG + Intergenic
1189247171 X:39572223-39572245 TTCTGCAGAAATCATCATTCTGG + Intergenic
1189556197 X:42147876-42147898 TTCTGCCCATATCAATCAGCAGG + Intergenic
1190412771 X:50153499-50153521 TTCTGCACTAAGCATCCTTCTGG - Intergenic
1191656728 X:63606649-63606671 TTCTGCCCAAATCAATCTACAGG + Intergenic
1191760179 X:64638546-64638568 TACTGCCCAAAGCAATCTACGGG - Intergenic
1191900871 X:66039738-66039760 TTCTGCCCAAACTTGCCTTCTGG + Intronic
1192068036 X:67907049-67907071 TTTTGCCCAGATCAACGTCCTGG - Intergenic
1192890300 X:75383565-75383587 TTCTGACCAAATCAACTCACGGG + Intronic
1193194370 X:78612781-78612803 TTCTTCCCAAATTAATCTACAGG - Intergenic
1193887510 X:87001075-87001097 TTTTGCCCAGATCAATGTTCTGG - Intergenic
1194219147 X:91169974-91169996 TTTTGCCCAAATCAATGTTTTGG + Intergenic
1195502509 X:105618488-105618510 TTCTGCTCAACTCAACTATCTGG + Intronic
1196390423 X:115202071-115202093 TACTGCCCAAAGCAATCTACAGG + Intronic
1196862551 X:120041590-120041612 GTCTGCCCAAATCTTCCTTCTGG + Intergenic
1196880551 X:120194754-120194776 GTCTGCCCAAATCTTCCTTCTGG - Intergenic
1197716216 X:129707924-129707946 TTCTGCCCAAAGGCACTTTCTGG + Intergenic
1199111836 X:143944786-143944808 TTCTGCACAATACAACCTTCAGG - Intergenic
1199242141 X:145559762-145559784 TACTGCCCAAAGCAGTCTTCAGG + Intergenic
1199810498 X:151344054-151344076 CTCTGCCAAATTTAACCTTCTGG + Intergenic
1200555662 Y:4633731-4633753 TTTTGCCCAAATCAATGTTTTGG + Intergenic