ID: 1162359399

View in Genome Browser
Species Human (GRCh38)
Location 19:10208913-10208935
Sequence CTTTGGAAGGCCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162359399_1162359408 28 Left 1162359399 19:10208913-10208935 CCTTCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1162359408 19:10208964-10208986 GCCCAGCTGAAAATGAGTTTTGG 0: 1
1: 0
2: 1
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162359399 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr