ID: 1162366807

View in Genome Browser
Species Human (GRCh38)
Location 19:10254663-10254685
Sequence GTGGTGGGAAGGAGCTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 276}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162366803_1162366807 -8 Left 1162366803 19:10254648-10254670 CCTAAATGGAGCAAGGTGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1162366807 19:10254663-10254685 GTGGTGGGAAGGAGCTTCCTGGG 0: 1
1: 0
2: 3
3: 28
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162366807 Original CRISPR GTGGTGGGAAGGAGCTTCCT GGG Intronic
900143568 1:1148612-1148634 GTGGAAGGAATGAGGTTCCTGGG + Intergenic
900143831 1:1149635-1149657 GTGGTGGGAAGGGGCGTGGTGGG + Intergenic
900478328 1:2886652-2886674 GGGGTGGGAGGGAGCTGCCTGGG + Intergenic
900685562 1:3945744-3945766 GCGGCGGGAGGGAGCCTCCTGGG - Intergenic
900957000 1:5892339-5892361 GTGGGGGGCAGGAGCATGCTAGG - Intronic
901317905 1:8321527-8321549 GTGGAGGAAAGGGCCTTCCTGGG - Intronic
901762574 1:11480131-11480153 GGGCTGGGAAGGCGCCTCCTTGG + Intronic
902885595 1:19402614-19402636 GTGGTGGGAAGGTACTAGCTGGG - Intronic
903185059 1:21624185-21624207 GAGGAGGGAAGGAGGGTCCTGGG + Intronic
906579870 1:46927543-46927565 CTGTTGGGAAGGAGCTGCTTGGG + Intergenic
906603851 1:47151344-47151366 CTGTTGGGAAGGAGCTGCTTGGG - Intergenic
907300771 1:53485177-53485199 GGGGTGGGGGGCAGCTTCCTGGG + Intergenic
907447610 1:54519063-54519085 GGGGTGAGAAGGAGCTTTCCAGG + Intergenic
907834418 1:58095498-58095520 ATGATGGGAAGGAGCCTCCAAGG - Intronic
909680695 1:78288130-78288152 GAGGTGGTAAGGAGCTTGGTGGG - Intergenic
909803152 1:79840037-79840059 ATGGAGGGAAAGAGCTACCTGGG - Intergenic
910306171 1:85766540-85766562 GTGGTGGAAAGGACCTACTTGGG + Intronic
911234642 1:95398890-95398912 GTTGGTAGAAGGAGCTTCCTAGG - Intergenic
911935254 1:103961146-103961168 GAGGGGGCAAGGGGCTTCCTGGG + Intergenic
913225281 1:116693533-116693555 GTGGGGAGCAGGAGCCTCCTGGG + Intergenic
913393032 1:118335311-118335333 GTGCTGGATAGTAGCTTCCTGGG - Intergenic
913534412 1:119757535-119757557 GAGGTGGGAAGTAGTTCCCTGGG - Intronic
915368169 1:155326847-155326869 GGGGTCTGAAGCAGCTTCCTTGG - Exonic
916197827 1:162241221-162241243 GAGGTGGGAAAGAGCATTCTAGG + Intronic
916256875 1:162797608-162797630 GTGGGGGGAAGGAGGGTCTTTGG + Intronic
916643401 1:166756859-166756881 GTGGTGGCAAGAAGTGTCCTTGG - Intergenic
918597287 1:186307580-186307602 GTGGTGGGCGTGAGCTTCTTGGG - Exonic
919253792 1:195096155-195096177 GCGGAGGCAAGGAGCTTCCTGGG - Intergenic
920039008 1:203084041-203084063 GAGGTGGGAAGGTGGTACCTGGG + Intronic
920081772 1:203380011-203380033 GTGGTGCTAAGGAGCTGGCTAGG - Intergenic
920651914 1:207844048-207844070 GTGGTGTGAAGGTGCTCCCAGGG - Intergenic
1062969306 10:1633956-1633978 GTGCTGGCAAGGAGCTCCATGGG - Intronic
1063604187 10:7508281-7508303 GTGGTGGGAAGGAGAGGCCCAGG + Intergenic
1063949460 10:11208570-11208592 GGTGTGGGAAGGACCTTCCCTGG + Intronic
1066066686 10:31766005-31766027 GTGGTAAGGAGGAGCTCCCTGGG - Intergenic
1066723337 10:38363302-38363324 GTGGGGGGAAGGAGGGTCTTTGG + Intergenic
1067710567 10:48648333-48648355 GTGGTGGGACTGCACTTCCTGGG + Intronic
1067879184 10:50029055-50029077 GTTGTGGGGAGGAGGTTTCTGGG + Intergenic
1068933841 10:62617403-62617425 GGGGTGGAAGGGAGCCTCCTGGG + Intronic
1069547902 10:69341857-69341879 GTGGGGGCAAGGATCATCCTTGG + Intronic
1070961344 10:80502234-80502256 GAGGTGGGAAGGAGATGCCGTGG + Intronic
1072631493 10:97149991-97150013 ATGGTAAAAAGGAGCTTCCTTGG - Intronic
1072718274 10:97765743-97765765 GTGCCAGGAAGGAGCTCCCTGGG - Intergenic
1073175508 10:101554066-101554088 GGGGTGGGGAGAAGTTTCCTGGG + Exonic
1074476791 10:113781360-113781382 GTGTTGGGAAGGAGGTGTCTGGG - Intronic
1074476881 10:113781658-113781680 GTGTTGGGAAGGAGGTGTCTGGG - Intronic
1075076256 10:119352688-119352710 ATGGTGGGCAGGGGCTGCCTTGG - Intronic
1075660046 10:124187131-124187153 GTGCTGAGAGTGAGCTTCCTCGG + Intergenic
1075698009 10:124449896-124449918 GTGGTGGGAGGGAGCCGCCTTGG + Exonic
1076187065 10:128458360-128458382 ATGGTGGGAAGGAGCTGTCAGGG + Intergenic
1076522687 10:131090869-131090891 GAGGAGGGAAGGTGCTTGCTAGG - Intergenic
1076570881 10:131432187-131432209 GTGCTGGGAAGGCGCTGCCAGGG + Intergenic
1077638701 11:3861853-3861875 GTGGAGGGGAGTAGTTTCCTAGG + Intronic
1078345631 11:10545139-10545161 GTGGGGGCAAGGGGCTTCCTGGG + Intergenic
1079167159 11:18055419-18055441 GTGGTGGGCACCAGCTACCTGGG + Intergenic
1079673944 11:23202236-23202258 GTGGGAGCAGGGAGCTTCCTGGG - Intergenic
1079993103 11:27267033-27267055 GTGGAGAGGAGGAGCATCCTTGG - Intergenic
1081526735 11:43932814-43932836 GTTCTGGGAAGCAGCTTCCCTGG - Intronic
1081938400 11:46920176-46920198 GAGGTGGGAAGGAGGATGCTGGG - Intergenic
1083060675 11:59867543-59867565 GTGGTGGGAAGGAGATGCGGAGG + Intergenic
1083687531 11:64385494-64385516 GAGGTGGGGAGAAGCTGCCTGGG + Intergenic
1085226642 11:74927290-74927312 CTGTTGGGAAGGGGCTTGCTGGG - Intronic
1085334375 11:75679662-75679684 GCGGGGGCAAGGGGCTTCCTGGG + Intergenic
1087176328 11:95099427-95099449 GGGGTGGGAAGGAGGTGCCCAGG + Intronic
1089377235 11:118003125-118003147 GGGGTGGGACCCAGCTTCCTAGG - Intergenic
1090805247 11:130198423-130198445 GTGCTGGGGAGGGGCTGCCTGGG + Intronic
1091306170 11:134537475-134537497 GAGGGGGAGAGGAGCTTCCTGGG - Intergenic
1092104501 12:5912052-5912074 GGGGTTGGAAGGAGGTTTCTGGG - Intronic
1095509646 12:42936622-42936644 GAGGTGAGAAGGAGCATTCTAGG + Intergenic
1095634486 12:44416765-44416787 GTGGTGAGAATGAGTATCCTTGG + Intergenic
1097363652 12:58686582-58686604 GTAGAGGAAAGAAGCTTCCTAGG - Intronic
1101193226 12:102356230-102356252 GGGGTGGGAATGAGGTTTCTGGG - Intergenic
1101580983 12:106040552-106040574 GTGGGGGCAAAAAGCTTCCTGGG + Intergenic
1102603819 12:114053441-114053463 GTGGAATGAAGGAGCTTGCTTGG - Intergenic
1103341575 12:120223910-120223932 GCTGTGGGCAGGAGCCTCCTGGG - Intronic
1104213501 12:126713336-126713358 GTGGAGAAAAGGAGCTTGCTAGG - Intergenic
1105363498 13:19742859-19742881 GTGTTGCGAGGGAGGTTCCTTGG - Intronic
1106017049 13:25879510-25879532 GTGGTCCGAAGTAGCCTCCTTGG - Intronic
1108080848 13:46733384-46733406 TTGGTGGGAAGGAGGTTAATTGG + Intronic
1110142471 13:72147921-72147943 GTGGATGAAAGGGGCTTCCTGGG - Intergenic
1110744316 13:79035251-79035273 GTGGTGGCGAGGAAGTTCCTAGG - Intergenic
1111347214 13:86974544-86974566 GTGGGGGCAGGGAGCTTCCTGGG - Intergenic
1113344769 13:109466571-109466593 GTGGTGGGAAGTCGGTTTCTTGG + Intergenic
1114259533 14:21026492-21026514 GTGGTGGGAGGGTGGTTCCCAGG - Intronic
1119329990 14:73786811-73786833 GTGGGGGGAAGGGGCTTTCCGGG - Intronic
1119909309 14:78335216-78335238 GTGGTGGGCAGTGGCTCCCTTGG + Intronic
1121887924 14:97561737-97561759 GGGGTGGGGAGGAGCTGGCTGGG - Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124082992 15:26518352-26518374 TAGGTGGGAAGGAGCTTCTTGGG - Intergenic
1127693004 15:61415838-61415860 GAGGTGGGAAGTAGCTTCCTGGG + Intergenic
1127932677 15:63607365-63607387 GGGGTGGGAAGGCCCTGCCTGGG - Intergenic
1128288893 15:66461729-66461751 TTGGTGGGTAGCAGCTTCTTGGG - Intronic
1128312129 15:66637378-66637400 GAGGTGGGAGGGAGCAGCCTTGG + Intronic
1129888875 15:79057866-79057888 ATGGAGGGAAGGGGCTGCCTTGG + Intronic
1130030914 15:80312875-80312897 ATGGTGGGGAGGTTCTTCCTTGG - Intergenic
1130145280 15:81269349-81269371 ATGGTGGGGAGGGACTTCCTTGG - Intronic
1130930990 15:88427856-88427878 TTGCTGGGAAGGAGCTTCTTGGG - Intergenic
1132081103 15:98866190-98866212 GTGGACGGCAGGAGCGTCCTGGG - Intronic
1132091947 15:98954256-98954278 CTGCTGGGAAGCAGCTTCCTGGG - Intronic
1132195181 15:99909428-99909450 GAGGTGGGAAGGAGTCACCTGGG - Intergenic
1132372901 15:101310281-101310303 GTGGAGGACAGGAGTTTCCTGGG - Intronic
1133328406 16:4956432-4956454 ATGTTGGGAAGGATCTTACTGGG - Intronic
1134058272 16:11183439-11183461 ATGGGGTGAAGGGGCTTCCTGGG + Intergenic
1134892511 16:17853646-17853668 GTGGTGGCCTGGAGCTTCCTTGG - Intergenic
1135101552 16:19610697-19610719 TTGCTGGGAAGGAGGTTCCCAGG + Intronic
1135302678 16:21344678-21344700 CTGGTGTGCAGGAGCTTCCTCGG + Intergenic
1136279604 16:29200422-29200444 GAGCGGGGAAGGAACTTCCTGGG - Intergenic
1136994572 16:35181136-35181158 TGGGTGGGACGGAGCTCCCTAGG - Intergenic
1137538981 16:49349126-49349148 CAGGTGGAAAGGAGCTGCCTTGG - Intergenic
1138083747 16:54115554-54115576 GTGGTTGGGAAGAGCTTCCCAGG + Exonic
1138448271 16:57078052-57078074 CTGGTGGGGAGGAGGGTCCTCGG + Intronic
1140304928 16:73794188-73794210 GGGTTTGGAAGGAGCTCCCTCGG + Intergenic
1141134320 16:81455843-81455865 CTGGTGGGAAGGCCCTGCCTAGG + Intronic
1141410168 16:83827761-83827783 GGGGCGGGAAGGATCTTCCCGGG + Intergenic
1141592109 16:85076300-85076322 GTGGTGGGGAGGAGCAGCGTAGG + Intronic
1142061182 16:88030721-88030743 CTGGTAGGCAGGAGCTTCCTCGG + Intronic
1142766809 17:2069026-2069048 GTGGAGGGGAAGAGGTTCCTAGG - Intronic
1143121317 17:4608893-4608915 GGGGTGGGCAGGAGATCCCTGGG + Intergenic
1145018014 17:19411497-19411519 GGGGTGGGAAGGGCCCTCCTTGG + Intronic
1145755927 17:27390033-27390055 GGGGTGGGAAGGGGCCTCCTGGG - Intergenic
1146299790 17:31678932-31678954 GTGGTGGGAAAGAGAATGCTGGG + Intergenic
1148078849 17:44956226-44956248 GTGGTGGGAAGGAGCTGGACAGG - Intergenic
1150826444 17:68480332-68480354 GTTATGGGAAGGACCTTCCAGGG + Intergenic
1151364136 17:73606274-73606296 GGGCTGGGCAGGAGCTCCCTGGG + Intronic
1152855816 17:82664107-82664129 GTGGGGGGAGGGTGCTCCCTGGG + Intronic
1157323612 18:46653320-46653342 GGGGTGTGAAGGAGCATTCTGGG + Intronic
1157625672 18:49048808-49048830 GTGGTGGGAAGGATAGTCATGGG - Intronic
1159857956 18:73612170-73612192 GTGGGAAGAAGGAGCTTCTTGGG + Intergenic
1159927017 18:74278516-74278538 GTGGTGAGAAGGGGGTCCCTTGG - Intronic
1160010367 18:75102650-75102672 GTGGTGGGAAAGGGCTTCCTAGG + Intergenic
1160947679 19:1651290-1651312 GGGGTGGGGAGGAGCCTCCGAGG + Intronic
1161078062 19:2296084-2296106 GTGCTGGGAGGGAGCTTGCTGGG - Intronic
1161316670 19:3620538-3620560 GTGGAGGGAAACAGTTTCCTGGG + Intronic
1161954077 19:7483186-7483208 GGGGCGGGGAGGAGCTTCCTGGG - Intronic
1162366807 19:10254663-10254685 GTGGTGGGAAGGAGCTTCCTGGG + Intronic
1163551468 19:17968099-17968121 GTGGCGGGAAGGGGGATCCTCGG + Intronic
1164888644 19:31804544-31804566 GTGATGGGAAGCGGCTTCCCAGG + Intergenic
1164944951 19:32285660-32285682 GGCGGGGGAAGGACCTTCCTCGG + Intergenic
1166015825 19:39978641-39978663 GTGGCTGGAAGGAGAGTCCTGGG + Intronic
1166937721 19:46344833-46344855 GTGATGGGAGGGGGCTTCCAAGG - Intergenic
1167654717 19:50756084-50756106 GGGGTGGGAAGCAGATTCCAGGG - Intergenic
1167656396 19:50767163-50767185 GGGGTGGGAAGCAGATTCCAGGG - Intergenic
1168254179 19:55157030-55157052 AAGGTGGGACGGGGCTTCCTGGG - Exonic
924963776 2:57543-57565 CTGGTGGGAGGGAGCTCCCTGGG + Intergenic
926122033 2:10246638-10246660 GTAGTGGGAGGGCCCTTCCTGGG - Intergenic
926704203 2:15825362-15825384 CTGGTGGGAAGGAGATTTCTCGG + Intergenic
929592895 2:43158424-43158446 TGGGTGGGAAGGAGCTATCTGGG + Intergenic
929594773 2:43169291-43169313 GTGGTGGGAGGGAGGTTTCGGGG + Intergenic
930252164 2:49046876-49046898 GTGGAGCTAATGAGCTTCCTTGG - Intronic
930711303 2:54553315-54553337 GAGGTGGGCAAGAGGTTCCTAGG + Intronic
932452590 2:71823444-71823466 GGGGTGGGAAAGACCTTGCTAGG + Intergenic
932580983 2:72992596-72992618 GTTCTGGGCAGGAGCCTCCTGGG + Intronic
932700247 2:73986476-73986498 GTGATGGTAGGGAGCTTCCCGGG + Exonic
932704143 2:74010251-74010273 GTGACGGGGAGGAGCTTCCCAGG - Intronic
932903145 2:75723310-75723332 GCAGGGGGAAGGAGCTCCCTTGG + Intergenic
933042495 2:77487280-77487302 GCAGAGGCAAGGAGCTTCCTGGG - Intronic
933741185 2:85535496-85535518 GTGTTGAGAAGGAGGTTCCTAGG - Intergenic
934109567 2:88729508-88729530 GTGGTGGAAAGGAACCACCTCGG - Intronic
934188725 2:89766742-89766764 GTGGTGGGCAGGGGCAGCCTGGG - Intergenic
935581982 2:104763896-104763918 TTGGTACCAAGGAGCTTCCTTGG - Intergenic
936972516 2:118188774-118188796 GTGGTGGCCAGGTGCTTCTTTGG - Intergenic
936996287 2:118417442-118417464 GGGGTGGGAGGGAGCTTGCCAGG - Intergenic
937312699 2:120911829-120911851 GTGGTGGGGAGGGGCTTTCTAGG + Intronic
938026090 2:127949900-127949922 GTGGTGGTAAGCAGCTTTCCAGG + Exonic
938304290 2:130240719-130240741 GAGTTGGGAAGGAGTTTGCTGGG - Intergenic
939798839 2:146681630-146681652 GTGCAGGGAAGGAGCATCTTGGG - Intergenic
941688313 2:168470388-168470410 TTTGTGGGAAGAAGCTTCCTTGG + Intronic
943345748 2:186734979-186735001 GTGAGGGAAGGGAGCTTCCTGGG + Intronic
943661164 2:190561072-190561094 GCAGTGGGAAGGAGGTTCCTAGG + Intergenic
946184415 2:217971199-217971221 GGTGTGTGAAGGAACTTCCTTGG - Intronic
946495497 2:220192069-220192091 GTGGGGGCAAGGGGCTTCCTGGG - Intergenic
946495745 2:220193445-220193467 GTGGGGGCAGGGGGCTTCCTGGG + Intergenic
947763938 2:232623972-232623994 CTGGGAGGATGGAGCTTCCTAGG + Intronic
948467908 2:238160880-238160902 GTTTTGGGAGGGACCTTCCTGGG - Intronic
1169595989 20:7199173-7199195 TTGGTGAGAGTGAGCTTCCTAGG + Intergenic
1172364485 20:34338507-34338529 GCTGTGGGGAGAAGCTTCCTGGG - Intergenic
1172973563 20:38890440-38890462 GTGGTGGGGAGGAGCCCACTGGG - Intronic
1173182586 20:40815970-40815992 GTGGTGGGCAGGGGCTGCTTAGG + Intergenic
1173915892 20:46708847-46708869 GGGGTGGGAAGGAGCTTATGGGG - Intergenic
1174102651 20:48139006-48139028 GTGGTGCTAAGGAGCATCCAGGG + Intergenic
1174107413 20:48172430-48172452 GGGCTGGGAGGCAGCTTCCTGGG + Intergenic
1175426459 20:58870441-58870463 CTGGTGGGGAGGAGCTCCCATGG - Intronic
1175811349 20:61859984-61860006 GCAGTGGGAAGGAGCTTGCCTGG - Intronic
1177875494 21:26626362-26626384 GTGGGTGGAGGGGGCTTCCTGGG + Intergenic
1178259160 21:31082990-31083012 GTTGGGGGAAGGTGCTTCCGAGG - Intergenic
1179647283 21:42783786-42783808 GTGGCGGAACAGAGCTTCCTGGG - Intergenic
1179813299 21:43885921-43885943 GTGCTGGCAAGGGGGTTCCTTGG + Intronic
1180534953 22:16388293-16388315 GTGGTGGGCAGGGGCAGCCTGGG + Intergenic
1181829542 22:25548915-25548937 GGGGGAGGAGGGAGCTTCCTGGG - Intergenic
1181922836 22:26333845-26333867 GGGGTGGGTAGGAGTTTCCCAGG + Intronic
1182321637 22:29481607-29481629 GTAGTGGGAAGGAGCCTGGTAGG - Intronic
1182774616 22:32821684-32821706 GTGGGGGAAAGCAGCTTCCAGGG + Intronic
1183084338 22:35477391-35477413 GAGGAAGGCAGGAGCTTCCTTGG + Intergenic
1183706978 22:39480272-39480294 GTGGTGGGAAGGAGCTGGAGAGG + Intronic
1184119422 22:42440675-42440697 TAGGTGGGAAGGAGCTGGCTAGG + Intergenic
1184317044 22:43702596-43702618 GAGATGGGAATGGGCTTCCTGGG - Intronic
1184738518 22:46412995-46413017 GTGGTGGGAGGGACCCTGCTGGG - Intronic
1185246636 22:49776382-49776404 CTGGAGGGCAGGAGCTTCCCTGG - Intronic
951508988 3:23480363-23480385 ATGGGGGCAGGGAGCTTCCTAGG + Intronic
952845612 3:37685572-37685594 GTGGGGGAAAGGGGCTTCCTTGG + Intronic
954146464 3:48636721-48636743 CTCTTGGGAAGCAGCTTCCTGGG - Exonic
954148316 3:48645267-48645289 GAGGTGGGAAGCAGATGCCTGGG - Intronic
956425390 3:69129108-69129130 GTTGGGAGAAGGAACTTCCTAGG - Intergenic
956797771 3:72731956-72731978 GGGGTGGGAAGTGGCTTCCAGGG - Intergenic
959231675 3:103662276-103662298 GTTTTGAGAAGGAGTTTCCTCGG - Intergenic
960507301 3:118509327-118509349 GTGGTGGGATTGACCTTTCTAGG - Intergenic
960695036 3:120387943-120387965 GTGGTGGGAAGGGGGGTGCTAGG - Intergenic
961542003 3:127606483-127606505 GTGATGGGAGGGATCTTCCCGGG + Intronic
962864230 3:139434176-139434198 GTGCTGGGAAGAAGCTGGCTAGG - Intergenic
963049803 3:141131246-141131268 GTAGGGGGAAGGAGCTGGCTTGG - Intronic
964469292 3:157035364-157035386 ATGGTGGGCAGGGGCTTCTTGGG - Intronic
964927929 3:161979375-161979397 GTGGGGGTAGGGGGCTTCCTAGG + Intergenic
965367671 3:167820412-167820434 GCAGTGGGCAGGGGCTTCCTGGG - Intronic
966781015 3:183584226-183584248 ATGCTGGGAAGGTGCTTCCATGG - Intergenic
967877152 3:194275356-194275378 GAGGTGGGAATGAGCTTGCTTGG + Intergenic
973072910 4:45887343-45887365 GTGGTGAGAGTGAGCATCCTTGG + Intergenic
973137642 4:46727664-46727686 TTGCTGGCAAGGAGCTTCCCAGG + Intergenic
974686911 4:65242503-65242525 GCGGTGGCAAGGAGCTTCCTGGG + Intergenic
975155412 4:71066886-71066908 GTGCTGGGAGGGAGCTTAGTGGG + Intergenic
975685119 4:76913085-76913107 GGTGTGGGAAGGAGTTTCCCTGG + Intergenic
975723682 4:77271888-77271910 GTGGTAGAATGGATCTTCCTTGG + Intronic
979478193 4:121183314-121183336 GTGGTGGCAAGTAGCTGCTTAGG - Intronic
979480574 4:121211892-121211914 GTGGTGGCACAGAGCTTGCTTGG - Intronic
982206189 4:152998950-152998972 GAGGATGGCAGGAGCTTCCTAGG + Intergenic
983163922 4:164451719-164451741 GTGGTGGGAATGAGACTCCTAGG - Intergenic
984296554 4:177861670-177861692 GTGGGGGCAAGGGGCTTCCTGGG - Intronic
987402398 5:17491698-17491720 TTGGTGGCCAGGGGCTTCCTGGG + Intergenic
987412220 5:17625889-17625911 TTGGTGGCCAGGGGCTTCCTGGG + Intergenic
987415257 5:17655468-17655490 TTGGTGGCCAGGGGCTTCCTGGG + Intergenic
987416764 5:17670513-17670535 TTGGTGGCCAGGGGCTTCCTGGG + Intergenic
989279288 5:39622351-39622373 TTGGTGGGCAGGAGCTCCCTGGG - Intergenic
990225161 5:53642527-53642549 GTGGTTGCAAGAAGCTTGCTGGG + Intronic
990719327 5:58676017-58676039 CTGATGGGAGGAAGCTTCCTGGG - Intronic
994163092 5:96579186-96579208 GTGGAGGTGGGGAGCTTCCTAGG + Intronic
997605612 5:135173802-135173824 GTGGAGTCAAGGAGCTGCCTGGG - Intronic
998131304 5:139652433-139652455 GTGGAGGGTTGGAGATTCCTGGG - Intronic
1000368404 5:160511811-160511833 GTGGTGGGCAGGGGCATCCAGGG + Intergenic
1000450482 5:161380546-161380568 TTGAGGGGAATGAGCTTCCTGGG + Intronic
1001020670 5:168179864-168179886 GTGCTCAGGAGGAGCTTCCTGGG - Intronic
1001808770 5:174610892-174610914 GTGGTGGAAAGGATCATCCACGG + Intergenic
1002168500 5:177362494-177362516 GTGGTGGGAAGGGGCATTCAAGG + Intronic
1003533597 6:6957131-6957153 TTGGTGGGCAGGTGCTTCCCAGG - Intergenic
1006024534 6:31138710-31138732 GTGGGGGGGACGAGTTTCCTCGG - Exonic
1006516354 6:34547815-34547837 TTGGTGGGGAGTAGATTCCTTGG - Intronic
1007232810 6:40360453-40360475 GTGTTGGGTAGGAGATTCCTGGG - Intergenic
1007498520 6:42278603-42278625 GGGTTGGGAGGAAGCTTCCTGGG - Intronic
1009873483 6:69476146-69476168 CAGGTGAGAAGGAGCCTCCTGGG - Intergenic
1010322686 6:74530980-74531002 GTGGTGAGGATGAGCATCCTTGG - Intergenic
1012093694 6:94931981-94932003 GAGATGGGAAGGAGATCCCTGGG - Intergenic
1015514963 6:134074247-134074269 GTGGTGGGGGTGAGCATCCTGGG + Intergenic
1017318016 6:153055089-153055111 GATTTGGGAAGGACCTTCCTAGG - Intronic
1019707789 7:2504777-2504799 GTCGTGGGAAGGGGCTTCGGGGG + Intergenic
1020223209 7:6257846-6257868 GTGGAGGTAGGGAGGTTCCTGGG + Intronic
1022405820 7:30088931-30088953 GTTGTGGGATGGAGTTTGCTGGG + Intronic
1022490309 7:30812729-30812751 GGGGTGGGAATCAGCTTCCCAGG - Intronic
1022535664 7:31096681-31096703 GTGGTGGGCAGGAAGTTCCCAGG + Intronic
1023226719 7:37977598-37977620 GAGATGGGAAGGAGTTTGCTGGG + Intronic
1023820107 7:43975865-43975887 GTGCTGGGCAGGGGCTCCCTGGG + Intergenic
1024676157 7:51639505-51639527 GGGGTGGGAAGGAGCCACCACGG - Intergenic
1026703407 7:72668508-72668530 GTGTTGAGAAGGAGTTTTCTCGG - Intronic
1028575618 7:92346931-92346953 GGGGTGGAAAGGAGAATCCTAGG - Intronic
1029748385 7:102529318-102529340 GTGCTGGGCAGGGGCTCCCTGGG + Intergenic
1029766332 7:102628405-102628427 GTGCTGGGCAGGGGCTCCCTGGG + Intronic
1030981201 7:116186714-116186736 GTGGGAGCAAGGAGCTTTCTGGG + Intergenic
1031821381 7:126506449-126506471 GAGGTGGGAAGGGGTTTTCTGGG - Intronic
1034405422 7:150899547-150899569 GTGGAGGGAAGCAGGTGCCTAGG - Intergenic
1034641645 7:152608599-152608621 GTTGTGGGATGAAGCTTCTTGGG + Intergenic
1034967448 7:155400086-155400108 CTGGTGGGAGGGAGTTTTCTAGG - Intergenic
1035704443 8:1664377-1664399 GGGGTTGAAAGAAGCTTCCTGGG - Intronic
1036002980 8:4629925-4629947 CTAGAGAGAAGGAGCTTCCTGGG - Intronic
1036638306 8:10566333-10566355 GTGGTGTGGAAGGGCTTCCTAGG - Intergenic
1036677591 8:10847881-10847903 GTGGTGGGGGGGAGTTTCTTTGG + Intergenic
1038090724 8:24249929-24249951 GCGGTAGGAAGGAGCTTGGTGGG + Intergenic
1040285447 8:46098330-46098352 GGGAAGGGAAGGACCTTCCTGGG - Intergenic
1040288361 8:46111806-46111828 TTGGTTGGAAGGGGCCTCCTGGG + Intergenic
1040843487 8:51809464-51809486 GTGGTGGAAAGCAGCTCCCAGGG + Intergenic
1043496851 8:80810893-80810915 GTGGCGGGGAGGAGCATCCACGG - Intronic
1044619744 8:94177193-94177215 GTGCTGGGATGGAGCTCCTTTGG - Intronic
1045329605 8:101143584-101143606 GGTGAGGGAAGGAGCTTCCCGGG - Intergenic
1045473708 8:102535932-102535954 GTGGGCGGAAGGCGCCTCCTGGG - Intronic
1045530543 8:102981113-102981135 GTGGTAGGAAGGATGTACCTAGG + Intergenic
1049396237 8:142402571-142402593 GTTGTAAGAAGGTGCTTCCTGGG - Intronic
1049469800 8:142770211-142770233 CTGGTGGGAAGGAGGGTCTTGGG + Intronic
1052251600 9:26404959-26404981 GTGGTAGGAAGGACTTTCCAGGG - Intergenic
1056465182 9:86846782-86846804 GTGATGGGGAGAGGCTTCCTAGG + Intergenic
1057190447 9:93084245-93084267 GGTGTGGGAAGGGACTTCCTGGG - Intronic
1057211473 9:93203131-93203153 GCGCTGGGAAGGTCCTTCCTGGG + Intronic
1057279224 9:93698309-93698331 GTGGTGGGCATGAGAGTCCTTGG - Intergenic
1058182928 9:101819925-101819947 GTGGTGAGAGGGGGCGTCCTTGG - Intergenic
1061369524 9:130190676-130190698 GAGGTGGGCAGGATCATCCTTGG + Intronic
1061543662 9:131291237-131291259 GTGGAGGGTGGAAGCTTCCTGGG - Intronic
1061750802 9:132775738-132775760 TAGGTGGGAAGAAGCTTCCAGGG - Intronic
1061870387 9:133517209-133517231 GTGGCAGGAAGGAGCGTGCTGGG - Intronic
1062424077 9:136498057-136498079 GGAGTGGGAAGGGGCTTCCCAGG + Intronic
1062475924 9:136727458-136727480 TTGGTGGCAGGGAGCTTCTTTGG - Intergenic
1189267936 X:39730730-39730752 GTGGTGGGGCGGGGCTTCCTGGG + Intergenic
1190023795 X:46903796-46903818 GTGGTAGGAAAGTGCTTCCCTGG - Intergenic
1190448926 X:50558059-50558081 GTGATGGGGAGGAGATTCCCAGG - Intergenic
1191130383 X:57002222-57002244 GTTGTGGTAATGAACTTCCTTGG + Intergenic
1192201506 X:69069243-69069265 ATGGCAGGAAGAAGCTTCCTTGG - Intergenic
1193386126 X:80873290-80873312 GGGGTGGGAATGCTCTTCCTTGG + Intergenic
1193947781 X:87759927-87759949 GTGCTGGGAGTGAGCATCCTTGG + Intergenic
1195671140 X:107471052-107471074 CTGCTGCCAAGGAGCTTCCTGGG - Intergenic
1197952023 X:131908129-131908151 GGGGTGGGGAGGTCCTTCCTGGG - Intergenic
1198328147 X:135595279-135595301 ATGAAGTGAAGGAGCTTCCTTGG - Intergenic
1198332600 X:135635399-135635421 CTGGCAGGAGGGAGCTTCCTAGG + Intergenic
1198338314 X:135689720-135689742 ATGAAGTGAAGGAGCTTCCTTGG + Intergenic
1200111074 X:153741145-153741167 GTGGTGGGCAGGGGCAGCCTGGG + Intronic