ID: 1162373127

View in Genome Browser
Species Human (GRCh38)
Location 19:10290611-10290633
Sequence ATCAGGAAGGACCCTACACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162373127 Original CRISPR ATCAGGAAGGACCCTACACC CGG (reversed) Intronic
903930606 1:26859880-26859902 ATGAGGAAGGACCCCAAGCCAGG - Intergenic
904424996 1:30417387-30417409 ATGAGGAAGGTCCCCATACCTGG + Intergenic
906863620 1:49390935-49390957 ATCAAAAAGGCCCTTACACCAGG + Intronic
907636313 1:56137944-56137966 ATCAGGGATGACCATACACGAGG - Intergenic
915901096 1:159847206-159847228 TTCAGGAGGGACCCTCCACCTGG + Intronic
922452283 1:225746849-225746871 ATCAGGCAGGACCCCACCCCAGG + Intergenic
923063483 1:230497801-230497823 ATAAGGAACCACTCTACACCGGG - Intergenic
1067181353 10:43988337-43988359 GTCAGGAAAGACCCTACTTCAGG - Intergenic
1071247365 10:83779615-83779637 ACCAGGAAGTACCCTGGACCTGG + Intergenic
1074383028 10:112995598-112995620 ATCTAGAAGGACCTTTCACCTGG + Intronic
1074947403 10:118294796-118294818 ATCAGTAAGGAGCCTCCACATGG + Intergenic
1081760893 11:45575794-45575816 CTCAGGAAGGACTCTGCACATGG - Intergenic
1084839541 11:71833835-71833857 ACCAGGGATGACCCCACACCAGG + Intronic
1085417479 11:76329007-76329029 AGCAAGAAGGGCCCTTCACCGGG - Intergenic
1092285871 12:7129064-7129086 CTCAGGAAGGATCCTGCTCCAGG - Intergenic
1092617390 12:10227680-10227702 ATGAGGCAGGGCCCTACACAGGG - Intergenic
1093364196 12:18272386-18272408 ATCAGGAAGCACAAAACACCTGG + Intronic
1096595842 12:52694974-52694996 AGAAGGAAGGAGCCTAAACCTGG + Intronic
1100489408 12:95064372-95064394 ATCAGAAAGGACACTACTGCAGG + Intronic
1108575624 13:51788080-51788102 ACTTGGAAGGACCCTGCACCTGG + Intronic
1109000210 13:56791858-56791880 ACCAGGAAGGGACCTTCACCAGG - Intergenic
1113035856 13:106047813-106047835 ATCAGGAAGGGGCCCTCACCAGG + Intergenic
1122075398 14:99231870-99231892 CTCAGGAAGGACCCCCCACGTGG + Intronic
1129150883 15:73687100-73687122 CTCAGAATGGACCCCACACCTGG + Intronic
1131035341 15:89218413-89218435 ACCAGGAAGGACCTTAGAACCGG + Intronic
1137408180 16:48206410-48206432 AACAGGAAGAACACTACAGCAGG - Intronic
1140674332 16:77312560-77312582 ATCAGGAAAAATCTTACACCTGG + Intronic
1143136409 17:4714950-4714972 CTCAGCAGGGACCCCACACCAGG - Intronic
1143834874 17:9683072-9683094 ATCAGAAAGGACCCTACTTCTGG - Intronic
1144640210 17:16932692-16932714 CTCAGGAAGGAGCCTACTCCTGG - Intronic
1146011313 17:29196982-29197004 ATGAGGAAGGACCGTGCTCCAGG - Intergenic
1152662868 17:81551046-81551068 ATCGGGCAGGGCCCTGCACCAGG + Exonic
1153261774 18:3231123-3231145 ATCAGAAATGACCCATCACCTGG - Intergenic
1154165397 18:12010776-12010798 ATCATAAAGGAGCCCACACCCGG - Intronic
1160688417 19:448342-448364 GGCAGGAAGGACCCTCCCCCGGG - Intronic
1161950546 19:7465285-7465307 AACAGGAAGGACCCAGGACCGGG - Intronic
1162373127 19:10290611-10290633 ATCAGGAAGGACCCTACACCCGG - Intronic
1162394889 19:10411814-10411836 TTGAGGCAGGACCCTCCACCAGG - Intronic
1163688281 19:18724715-18724737 AGCCGGGAGGACCCTACATCGGG - Intronic
1167539192 19:50074512-50074534 ATCATGAGGGACCCAACAGCTGG + Intergenic
1167630516 19:50623346-50623368 ATCATGAGGGACCCGACACCTGG - Intronic
926432094 2:12798249-12798271 AGCAGAAAGGAGCCTACTCCTGG - Intergenic
928103056 2:28450521-28450543 ATCAGGAAGGAGCCCACCCAGGG + Intergenic
928216350 2:29364581-29364603 CTTAGCAAGGACCCTACACTGGG - Intronic
929820298 2:45267968-45267990 ATCAGGATGGCCCCTATGCCTGG - Intergenic
929874069 2:45781877-45781899 ATGAGGCAGGACCCTGGACCAGG - Intronic
936970898 2:118175310-118175332 ATTAGGAAGGGCTCTACACTGGG + Intergenic
937266953 2:120622793-120622815 ACCAGGCAGGACACTACAACAGG - Intergenic
939332784 2:140786422-140786444 ATCAGGAACGCCCCTCCACCTGG + Intronic
946247437 2:218395838-218395860 ATCCAGAAGACCCCTACACCAGG + Exonic
1172271234 20:33656878-33656900 CTCAGGCAGGACCCAGCACCAGG + Intergenic
1172904531 20:38359107-38359129 ATCAAGAAGGATTCTACACTGGG - Intronic
1175807807 20:61840238-61840260 ACCGGGAAGGCCCCTGCACCAGG - Intronic
1176177828 20:63737050-63737072 AGCAGGAGGGACCCTGCACCCGG - Intronic
1179269212 21:39836846-39836868 CAGAGGAAGGACCCTGCACCTGG + Intergenic
1180997162 22:19971304-19971326 AGCAGGAAGGCCCCTCCCCCCGG - Exonic
1182342081 22:29631347-29631369 CTCAGGAAAGACCTTACTCCCGG + Intronic
1185147694 22:49148183-49148205 ATGAGGAAGGACCCCAGGCCAGG + Intergenic
950953947 3:17030622-17030644 ATCAGGAAGAACGCCACACCTGG + Intronic
951346423 3:21551749-21551771 GTCAGGAAAAAACCTACACCAGG + Intronic
952912562 3:38203484-38203506 ATAGGGCTGGACCCTACACCTGG + Intronic
954381574 3:50221690-50221712 ATTAGGAGAGACCCTGCACCAGG + Intergenic
954438382 3:50508123-50508145 ATCAGACAGGACCCTACCTCTGG + Intergenic
957052032 3:75418417-75418439 ACCAGGAAGTACCCTCCACCCGG - Intergenic
961984952 3:131122372-131122394 ATCAGGAGTGTGCCTACACCTGG - Intronic
961998366 3:131269830-131269852 TTCAGGAAGGAGCCCACACATGG + Intronic
962898231 3:139735120-139735142 CTCTGGATGGAACCTACACCTGG + Intergenic
966883838 3:184363672-184363694 CTGAGGGAGGTCCCTACACCAGG - Intronic
969488262 4:7484584-7484606 AACAGGAAGGCCTCTGCACCTGG + Intronic
972045667 4:34663071-34663093 ATCAGGATGGACCTGACATCTGG + Intergenic
976663540 4:87565588-87565610 AGCAGGAAGAGCCCTAAACCTGG + Intergenic
977626509 4:99194364-99194386 TTAAGAAAGGACCCCACACCTGG - Intergenic
982435867 4:155383298-155383320 CTCAGGCCGGACCCTGCACCAGG + Intergenic
982806502 4:159772069-159772091 AACAAGAAGGACCCTAATCCTGG - Intergenic
986094586 5:4542174-4542196 ATCAGGAAAGGCCAGACACCTGG + Intergenic
993113415 5:83688119-83688141 ATCAGGAAGGAGCTAACACTTGG - Intronic
996088947 5:119331601-119331623 ACCAGCAAGGTCCCAACACCAGG - Intronic
1001524032 5:172415855-172415877 AGAGGGAAGGACCCGACACCAGG + Intronic
1007350641 6:41271171-41271193 ATCACGGATCACCCTACACCTGG + Intronic
1007817289 6:44533604-44533626 ATCCTGAAGGAGCCAACACCTGG + Intergenic
1012252093 6:96991302-96991324 CCCAGGAAGGACCCTTCAGCTGG - Intronic
1013773680 6:113654649-113654671 GTCAGGAAAGAACCTAGACCAGG - Intergenic
1014816772 6:125944324-125944346 ATCAGGAACAAGGCTACACCTGG - Intergenic
1018937628 6:168284016-168284038 ATCATGGAGCACCCTGCACCCGG - Intergenic
1019510175 7:1413881-1413903 ACCAGGAAGGACCCCACGCGGGG - Intergenic
1029262339 7:99311879-99311901 GTCAGGAAGGACACTACCCTGGG - Intergenic
1033539960 7:142347450-142347472 ATTTGGAAGGACCCTGCACTTGG - Intergenic
1036607823 8:10323178-10323200 ACCAGGCAGGACACTACACTGGG + Intronic
1037705831 8:21314366-21314388 CCCAGGAAGGATCCTACACTTGG - Intergenic
1037764400 8:21763427-21763449 CTCAGGAATGACCTCACACCTGG + Intronic
1041225445 8:55692777-55692799 AGGAGGAAGGACGCCACACCAGG - Intergenic
1044289329 8:90448949-90448971 ATCAGGAAGACCCCCCCACCAGG - Intergenic
1044830036 8:96238302-96238324 AACAGGAAGGCCACTATACCTGG + Intergenic
1048196957 8:132339204-132339226 ATCTGGAAGGGCCCTGCTCCTGG - Intronic
1051720555 9:20032781-20032803 AACAGGAAGGACCCAACCCAGGG + Intergenic
1056666932 9:88588612-88588634 CTGAGGAAGGAGCCTTCACCTGG + Intergenic
1057130157 9:92649234-92649256 ACCAGGAATGAGCCTAAACCTGG + Intronic
1186293784 X:8126474-8126496 TTAAGGAAGGCCCCTAAACCGGG + Intergenic
1196785811 X:119420606-119420628 ATCAAGAAGGACACAACAACAGG - Intronic
1200003214 X:153072579-153072601 ACCAGGAGGGACCCTGCCCCGGG + Exonic
1200004509 X:153077430-153077452 ACCAGGAGGGACCCTGCCCCGGG - Intergenic