ID: 1162373768

View in Genome Browser
Species Human (GRCh38)
Location 19:10293436-10293458
Sequence CCGCCCAAATACCACGCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162373768_1162373775 29 Left 1162373768 19:10293436-10293458 CCTAGGGCGTGGTATTTGGGCGG 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1162373775 19:10293488-10293510 TTTAAGTTTTTAGACGAAAAAGG 0: 1
1: 0
2: 2
3: 34
4: 457
1162373768_1162373773 -6 Left 1162373768 19:10293436-10293458 CCTAGGGCGTGGTATTTGGGCGG 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1162373773 19:10293453-10293475 GGGCGGAGTCGTGGAAAGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 154
1162373768_1162373772 -7 Left 1162373768 19:10293436-10293458 CCTAGGGCGTGGTATTTGGGCGG 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1162373772 19:10293452-10293474 TGGGCGGAGTCGTGGAAAGGCGG 0: 1
1: 0
2: 0
3: 7
4: 147
1162373768_1162373771 -10 Left 1162373768 19:10293436-10293458 CCTAGGGCGTGGTATTTGGGCGG 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1162373771 19:10293449-10293471 ATTTGGGCGGAGTCGTGGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162373768 Original CRISPR CCGCCCAAATACCACGCCCT AGG (reversed) Intronic
900613193 1:3553112-3553134 CCGCCTAACTACCAGGGCCTTGG + Intronic
901639803 1:10687477-10687499 TGGCCCACATACCACGCCCGGGG + Intronic
907409626 1:54274964-54274986 CAGCCCAAATGTCACCCCCTCGG + Intronic
908247764 1:62241563-62241585 CCGACCAAATGCCAGGCCCTGGG - Intronic
911160941 1:94682904-94682926 CCTCCCAATTCCCAAGCCCTAGG - Intergenic
913694988 1:121316124-121316146 CCTCCCAAATACCCGTCCCTGGG - Intronic
920482321 1:206334507-206334529 CCTCCCAAATACCCGTCCCTGGG - Intronic
921947424 1:220895627-220895649 CAGCGCAATTATCACGCCCTGGG - Intergenic
924810958 1:247401697-247401719 CCTCCCAAATCCCCAGCCCTAGG + Intergenic
1064824937 10:19387740-19387762 CCTCCCAAAGACCACACACTTGG + Exonic
1065316106 10:24465494-24465516 ACACCCAACTACCACGCTCTGGG - Intronic
1067848612 10:49741070-49741092 GCGCCCACACACCACGCACTGGG + Intronic
1074813704 10:117129129-117129151 CCTACCAAATGCCAGGCCCTGGG + Intronic
1077027587 11:448165-448187 CCGCCCACAGACCATGTCCTCGG + Intergenic
1077172867 11:1176179-1176201 CTGCCGAAATGCCACGCCCGGGG + Intronic
1085640738 11:78191118-78191140 CAGCCCCACTGCCACGCCCTGGG - Intronic
1106317778 13:28610087-28610109 CCTCCCTAATCCCAGGCCCTGGG + Intergenic
1110634821 13:77754623-77754645 CAGTCCAAATACCATGCCTTTGG + Intronic
1117376833 14:55125054-55125076 CAGCTCAAATACCACCTCCTTGG + Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1140214392 16:72995678-72995700 CCGCCCACAAACCCCGCGCTGGG + Intronic
1140664304 16:77213671-77213693 CCGCTCAGATACCACTTCCTAGG - Intergenic
1143839230 17:9718459-9718481 CAGCCCAAATGCCACACGCTGGG - Intronic
1145798542 17:27669476-27669498 CCTCCCAAGTTCCAAGCCCTGGG - Intergenic
1151300679 17:73222902-73222924 CAGCCCAACAACCACACCCTGGG + Intronic
1162101350 19:8341031-8341053 ACACCCAAATCCCAGGCCCTGGG + Intronic
1162373768 19:10293436-10293458 CCGCCCAAATACCACGCCCTAGG - Intronic
1166253881 19:41588947-41588969 CCTCCCAGAGACCACACCCTGGG - Intronic
1166409670 19:42548096-42548118 CCTCCCAGAGACCACACCCTGGG + Intronic
925990557 2:9250999-9251021 CCACCCAAATGCCACCTCCTTGG - Intronic
938910768 2:135883893-135883915 ACCCCCACATACCATGCCCTTGG - Intergenic
942840949 2:180360096-180360118 CCACCCAGATACCACACACTTGG + Intergenic
945092628 2:206189817-206189839 TGTCCCAAATACCACCCCCTGGG - Intronic
948685441 2:239666881-239666903 CCCGCCAAACACCATGCCCTGGG + Intergenic
950944540 3:16931067-16931089 CAGCCCAAATACTACATCCTTGG + Intronic
956192443 3:66620692-66620714 CAGCCCAACTGCCAGGCCCTGGG - Intergenic
962194834 3:133352695-133352717 CCTCCCATATACCTTGCCCTAGG - Intronic
968879738 4:3292909-3292931 CCGCCCCAACCCCACCCCCTTGG + Intergenic
976844189 4:89468667-89468689 ACTCCCAAATACCATGACCTTGG - Intergenic
985130591 4:186734847-186734869 ATGCCCAAATACCTCTCCCTAGG + Intergenic
990210746 5:53480040-53480062 CTGCCCAAATATCCCGCCCCGGG - Intergenic
1003545960 6:7058629-7058651 ACTGCCAAATACCACACCCTGGG - Intergenic
1011194376 6:84766610-84766632 CCGCCCCAATCCCAGGCTCTCGG + Intergenic
1014254163 6:119144804-119144826 CCACCCATCTACCACCCCCTAGG - Intronic
1027422945 7:78034949-78034971 CCCCCCAAATACCACGCAGGAGG - Intronic
1034893203 7:154858543-154858565 CCGCCCATACACCACCCCCGGGG + Intronic
1038312535 8:26455532-26455554 CCCCCCAATTATCACCCCCTGGG - Intronic
1058935653 9:109767326-109767348 CCACCCTAATACCACTTCCTTGG + Intronic
1062441379 9:136571197-136571219 CCGCTCACCTCCCACGCCCTGGG + Intergenic
1186194727 X:7099001-7099023 TGGCCCAGATACCATGCCCTGGG + Intronic
1186449565 X:9660892-9660914 ACCCCCAAATACCATCCCCTTGG - Intronic
1189004944 X:36985680-36985702 ACGCTCGTATACCACGCCCTGGG - Intergenic
1189044082 X:37572264-37572286 ACGCTCGTATACCACGCCCTGGG + Exonic