ID: 1162373772

View in Genome Browser
Species Human (GRCh38)
Location 19:10293452-10293474
Sequence TGGGCGGAGTCGTGGAAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162373759_1162373772 13 Left 1162373759 19:10293416-10293438 CCGGGTGGGCGTGCCCCTAGCCT 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1162373772 19:10293452-10293474 TGGGCGGAGTCGTGGAAAGGCGG 0: 1
1: 0
2: 0
3: 7
4: 147
1162373768_1162373772 -7 Left 1162373768 19:10293436-10293458 CCTAGGGCGTGGTATTTGGGCGG 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1162373772 19:10293452-10293474 TGGGCGGAGTCGTGGAAAGGCGG 0: 1
1: 0
2: 0
3: 7
4: 147
1162373764_1162373772 -1 Left 1162373764 19:10293430-10293452 CCCTAGCCTAGGGCGTGGTATTT 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1162373772 19:10293452-10293474 TGGGCGGAGTCGTGGAAAGGCGG 0: 1
1: 0
2: 0
3: 7
4: 147
1162373765_1162373772 -2 Left 1162373765 19:10293431-10293453 CCTAGCCTAGGGCGTGGTATTTG 0: 1
1: 0
2: 0
3: 11
4: 80
Right 1162373772 19:10293452-10293474 TGGGCGGAGTCGTGGAAAGGCGG 0: 1
1: 0
2: 0
3: 7
4: 147
1162373763_1162373772 0 Left 1162373763 19:10293429-10293451 CCCCTAGCCTAGGGCGTGGTATT 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1162373772 19:10293452-10293474 TGGGCGGAGTCGTGGAAAGGCGG 0: 1
1: 0
2: 0
3: 7
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162373772 Original CRISPR TGGGCGGAGTCGTGGAAAGG CGG Intronic
900782524 1:4627345-4627367 TGGGCGGTAACGTGCAAAGGAGG + Intergenic
905006861 1:34716865-34716887 TGTGGGGAGTTGTGGAGAGGAGG - Intronic
905015432 1:34775079-34775101 TGAGCCGAGACGTGGAAATGAGG + Intronic
907136088 1:52141330-52141352 TGGGATGAGGGGTGGAAAGGTGG + Intergenic
910309082 1:85802722-85802744 TGTGGGGAGGTGTGGAAAGGAGG - Intronic
914398804 1:147296563-147296585 TGGGAAGAGTAGTGGATAGGAGG - Intergenic
916880681 1:169016998-169017020 TGGGTTGAGTCCTGGAAGGGAGG - Intergenic
917490478 1:175494081-175494103 TGGGAGGAATCCGGGAAAGGAGG - Intronic
922427281 1:225510641-225510663 TGGGGGGAGTGGTGAAAAGATGG + Intronic
1065164153 10:22957298-22957320 TGGGGAGAGACGTGGAAGGGCGG + Intronic
1067781655 10:49211968-49211990 TGGAGGGAGTGGAGGAAAGGAGG + Intergenic
1074098095 10:110331460-110331482 TGGGCGGAACCGTGGAACCGGGG + Intergenic
1074432872 10:113408648-113408670 TGGGGGCAGTGGTGGGAAGGAGG - Intergenic
1075013190 10:118892085-118892107 TGGGGGGGGTCGGGGACAGGGGG + Intergenic
1076417745 10:130303576-130303598 AGGGCGGAGTCCTGGAGATGAGG - Intergenic
1076839871 10:133040648-133040670 GGGGCGGGGTGGCGGAAAGGGGG + Intergenic
1083173903 11:60937812-60937834 TGGAGGGAGGCTTGGAAAGGAGG - Intronic
1089680508 11:120116614-120116636 TGGGAGCAGCCTTGGAAAGGGGG + Intronic
1097166499 12:57089055-57089077 GGGGCGGAGGCGCGGAGAGGCGG + Exonic
1100536539 12:95516032-95516054 TGGGGGGAGGCTTGGAAAAGGGG - Intergenic
1102619982 12:114186659-114186681 TATGCGGAGTCGAGGACAGGAGG + Intergenic
1103090599 12:118095475-118095497 TGCTCGGAGCCTTGGAAAGGAGG - Intronic
1103856015 12:123972266-123972288 ACGGCGGAGTCGGGGAAAGAGGG - Intronic
1104602973 12:130165474-130165496 TGGACTGATTTGTGGAAAGGAGG + Exonic
1115434854 14:33360835-33360857 TGGGCCGAGGCGTGGAGAGTAGG - Intronic
1117076015 14:52105258-52105280 TGGCTGGAGTTGAGGAAAGGTGG - Intergenic
1117474330 14:56078604-56078626 TGGGAGGAGGCTTGGAAAGCAGG - Intergenic
1118906705 14:70028697-70028719 TGGAGGGAGTGGAGGAAAGGTGG + Intronic
1119386815 14:74262389-74262411 TGGGTGGGGTGGTGGATAGGTGG - Exonic
1120834191 14:89026216-89026238 TGAGCGGAGTCGGGGAAGGCTGG - Intergenic
1125724280 15:41860489-41860511 TGGGCCAAGTAGTGGAAGGGTGG + Intronic
1128011297 15:64299089-64299111 TGGGGGGAGTGGTGGGAGGGTGG - Intronic
1128377754 15:67089452-67089474 TGGGTGGAGACATGGCAAGGTGG + Intronic
1129603234 15:77012337-77012359 TGGGTGGACTGGTGGACAGGTGG - Intronic
1133292912 16:4734510-4734532 TGGGCGGGGTGGGGGGAAGGCGG + Exonic
1133510398 16:6452174-6452196 TGGGTGGAGTCATGGAAGGAAGG - Intronic
1133970018 16:10560755-10560777 TGGGCGGAGTGGTGGGGAGAGGG + Intronic
1139534407 16:67562669-67562691 TGGCCGGAGCCGTGGAGCGGCGG + Exonic
1145799295 17:27672918-27672940 TGGGTGCAGTGGTGGAAGGGGGG - Intergenic
1147424980 17:40342092-40342114 GGGGCGGGGCGGTGGAAAGGGGG + Intronic
1147839700 17:43362426-43362448 TGGGCGGAGCCTTGGGAAAGGGG + Intergenic
1149669240 17:58391312-58391334 TGGGGGTAGTGGTGGAGAGGTGG - Intronic
1151183862 17:72349492-72349514 TGGAAGGAGGCGTGGGAAGGTGG + Intergenic
1152870504 17:82751132-82751154 TGGGAGGGGTCGGGGGAAGGGGG - Exonic
1158066248 18:53412984-53413006 GGGGAGGATTAGTGGAAAGGTGG - Intronic
1161829140 19:6590227-6590249 TGGGATGAGAGGTGGAAAGGAGG - Intronic
1161983848 19:7643697-7643719 GGGGCGGAGCCTTGGAGAGGTGG + Intronic
1161983860 19:7643731-7643753 GGGGCGGAGCCTTGGAGAGGTGG + Intronic
1161983908 19:7643868-7643890 GGGGCGGAGCCTTGGAGAGGTGG + Intronic
1162373772 19:10293452-10293474 TGGGCGGAGTCGTGGAAAGGCGG + Intronic
1162393689 19:10404336-10404358 TGGGGGGAATCGTGGAGGGGTGG + Intronic
1162527644 19:11215792-11215814 TCGGCGAAGTCGTGGTAAGAGGG - Exonic
1163679059 19:18670126-18670148 GGCGCGGAGGGGTGGAAAGGAGG - Exonic
1165762490 19:38329819-38329841 TGGGCTGAGCCATGGAAGGGAGG + Intergenic
1166150962 19:40875643-40875665 TGGGCGGGGCCAGGGAAAGGCGG - Exonic
928228849 2:29478492-29478514 AAGGAGGAGTCGTGGAAAGAAGG - Intronic
929395695 2:41519716-41519738 AGGGAGGAGTCATGGAAAGGAGG - Intergenic
931019519 2:58027563-58027585 TTGGTGGATTGGTGGAAAGGGGG + Intronic
933084790 2:78042673-78042695 TGGGAGGTGTTGTGGAAGGGAGG - Intergenic
933372940 2:81440397-81440419 TGGGGGGAGTAGTGGGAAGCAGG + Intergenic
934857422 2:97737919-97737941 TGGGCGGTGTGGTGGGGAGGGGG + Intronic
938992582 2:136644515-136644537 TGGTCTGAGTCTTTGAAAGGAGG + Intergenic
939021438 2:136962481-136962503 TAGGCAGAGTCGTGGAGAGTTGG + Intronic
942367329 2:175241308-175241330 GGGGAGGAGTTCTGGAAAGGGGG - Intergenic
943024104 2:182607995-182608017 TGGGCTGAGTCCTGGGAAGAGGG + Intergenic
1173819351 20:46010665-46010687 TGGGCGGGGTCAGGGAAGGGAGG + Intronic
1174216037 20:48917121-48917143 AGGGCAGAGTGGTGGGAAGGGGG + Intergenic
1178385800 21:32149370-32149392 TGGGCGAAGCCAGGGAAAGGTGG - Intergenic
1180028066 21:45179958-45179980 TGGGCGTAGGCGTGGGCAGGTGG + Intronic
1181451280 22:23023552-23023574 TGGTGGGGGTCGGGGAAAGGTGG + Intergenic
1181822737 22:25488075-25488097 TAGGTGGAGATGTGGAAAGGTGG + Intergenic
1184607519 22:45582544-45582566 TGGGAGGGGTCCTGGAAAGGAGG - Intronic
1185131382 22:49041045-49041067 TGGGAGGAATGGTGGACAGGTGG + Intergenic
949941983 3:9162388-9162410 TGGGGGGAGGTGTGTAAAGGGGG - Intronic
953033619 3:39193248-39193270 TGGGTGTAGTGGTGCAAAGGAGG - Intergenic
954965215 3:54604526-54604548 GGGTCTGAGTCTTGGAAAGGAGG - Intronic
960356050 3:116654928-116654950 TGGGTGGATTATTGGAAAGGTGG + Intronic
963990667 3:151649755-151649777 TGGGTGGAGTAGCAGAAAGGAGG - Intergenic
966091541 3:176144289-176144311 TAGGCTGAGTCTTGGAATGGAGG - Intergenic
966924104 3:184633464-184633486 GGGGCAGAGTCGGGGAAGGGGGG - Intronic
968178266 3:196569407-196569429 TGACTGGAGCCGTGGAAAGGCGG - Intronic
969640474 4:8395353-8395375 TGGGTGGATGCGTGGACAGGTGG + Intronic
969640481 4:8395373-8395395 TGGGGGGATGCGTGGACAGGTGG + Intronic
969694976 4:8729304-8729326 TGGGGGGCGTCATGGAAAGGAGG + Intergenic
969699870 4:8762126-8762148 TGGGAGGAGCCGTGGGCAGGAGG + Intergenic
984534276 4:180953858-180953880 TGGCCGGAGACGAGGAAAGGTGG - Intergenic
986827043 5:11533064-11533086 GGGGCGGAGAAGAGGAAAGGTGG + Intronic
988983664 5:36596414-36596436 GGGGCGGAGTTAAGGAAAGGAGG - Intergenic
991208090 5:64073071-64073093 TGGGCTGAATAGTGAAAAGGAGG + Intergenic
997795989 5:136811764-136811786 TGTGCAGAGTCCTGGAAAGATGG - Intergenic
1001126280 5:169022396-169022418 TGGACACAGTCCTGGAAAGGAGG + Intronic
1001859664 5:175042957-175042979 TGAGAGGAGGAGTGGAAAGGAGG - Intergenic
1002072932 5:176691185-176691207 TGGGGTGTGTCGTGGGAAGGAGG + Intergenic
1002272384 5:178081121-178081143 TGGGCAGAGTCTGGGAAGGGAGG - Intergenic
1005980343 6:30831523-30831545 TGGGCTGAGTCCTGGGGAGGTGG + Intergenic
1008745197 6:54661353-54661375 TGGGAGGAGTGGTGGGAATGGGG - Intergenic
1010339170 6:74727289-74727311 TGGGTGGGGTGGTGGAAGGGTGG + Intergenic
1014045342 6:116877672-116877694 GGGGCGGAGGGGAGGAAAGGGGG - Intronic
1014991290 6:128080277-128080299 TGGGAGGAGTCATGCAAAGAAGG + Intronic
1015029746 6:128580515-128580537 TGGCCGGGGTCGTAGTAAGGGGG + Intergenic
1016857607 6:148686814-148686836 TGGGAGGAAGCGTGGGAAGGGGG - Intergenic
1018655037 6:166026539-166026561 TGGGCGGAGGTGTGGGAGGGTGG + Intergenic
1025006953 7:55362843-55362865 TGGGCGGGGTGGGGGAGAGGGGG + Intergenic
1026506203 7:70986537-70986559 AGGACAGAGTCCTGGAAAGGAGG - Intergenic
1027723173 7:81770242-81770264 TGGGGGGAGGCGGGGAATGGGGG - Intronic
1030685378 7:112480925-112480947 TGGCAGGAGTGCTGGAAAGGTGG + Intronic
1033277914 7:139986511-139986533 TGGGGGGAGAGGTGGGAAGGGGG - Intronic
1034264285 7:149773610-149773632 AGGGAGGAGCCGGGGAAAGGTGG + Intergenic
1034402810 7:150876983-150877005 TGGGCGGGGTGGTGGGGAGGAGG - Intergenic
1035269734 7:157712103-157712125 GGGGCTGCGTCGTGGAAGGGGGG + Intronic
1035417948 7:158705130-158705152 CGGGCGGTGTTGTGGGAAGGAGG + Intergenic
1036021329 8:4850526-4850548 GGGGAGGAGTGGTGCAAAGGAGG - Intronic
1039226683 8:35396331-35396353 GGGGCTGAGTCGGGGAAAGCAGG + Intronic
1039542397 8:38382548-38382570 CCGGAGGAGGCGTGGAAAGGTGG + Intergenic
1040533132 8:48282261-48282283 TGGGCGGATGCCTGGGAAGGCGG + Intergenic
1047673095 8:127170365-127170387 TGGGAGGAGTAGTGTAAATGAGG - Intergenic
1048047969 8:130791229-130791251 TGGGTGGAGTCAGGGAAAAGGGG + Intronic
1048915604 8:139179953-139179975 TGGGAGGAGTAGTGGAGAGGTGG - Intergenic
1053536387 9:38930784-38930806 TGGGGGGAGTCGAAGTAAGGTGG - Intergenic
1054629747 9:67433164-67433186 TGGGGGGAGTCGAAGTAAGGTGG + Intergenic
1055636711 9:78286444-78286466 TGGGCAGAGCTGTGTAAAGGAGG + Intergenic
1057313711 9:93956282-93956304 TGGGCGGAGTTGGGGCCAGGGGG + Intergenic
1057497967 9:95575186-95575208 TAGGAGGATTCGTGGAAATGAGG - Intergenic
1060109188 9:120894506-120894528 TGGGAGGCGTCGTGGAAAAAGGG - Intronic
1060823820 9:126676276-126676298 TGGGCTGAGACGGGGAGAGGAGG - Intronic
1061134414 9:128724952-128724974 TGGGAGGTGCTGTGGAAAGGCGG - Intergenic
1187389402 X:18875909-18875931 CAGGAGGAGTGGTGGAAAGGAGG + Intergenic
1189473995 X:41334890-41334912 CGGGCGAAGGCCTGGAAAGGAGG + Intronic
1189549079 X:42074654-42074676 TGGGCTCAGTGGTGGAAAGAGGG + Intergenic
1190732370 X:53234360-53234382 TGGGGGGAGGGGTGGATAGGAGG + Exonic
1191955037 X:66634886-66634908 TGGGCTGGGTCATGGAGAGGTGG + Intronic
1193386380 X:80876721-80876743 TGGGGGGAGGGGTGGGAAGGGGG + Intergenic
1196085850 X:111681604-111681626 GGGGCGGAGCCGTTGGAAGGAGG - Intronic
1196442560 X:115729219-115729241 TGGGCAGAGCCGTGGAGAGTTGG - Intergenic
1196442997 X:115731685-115731707 TGGGCAGAGCCGTGGAGAGTTGG + Intergenic
1196443663 X:115734654-115734676 TGGGCAGAGCCGTGGAGAGTTGG + Intergenic
1196445318 X:115843600-115843622 TGGGCAGAGCCGTGGAGAGTTGG + Intergenic
1196445989 X:115846581-115846603 TGGGCAGAGCCGTGGAGAGTTGG + Intergenic
1196446660 X:115849562-115849584 TGGGCAGAGCCGTGGAGAGTTGG + Intergenic
1196447328 X:115852545-115852567 TGGGCAGAGCCGTGGAGAGTTGG + Intergenic
1196447999 X:115855524-115855546 TGGGCAGAGCCGTGGAGAGTTGG + Intergenic
1196448668 X:115858515-115858537 TGGGCAGAGCCGTGGAGAGTTGG + Intergenic
1196449339 X:115861506-115861528 TGGGCAGAGCCGTGGAGAGTTGG + Intergenic
1196450008 X:115864489-115864511 TGGGCAGAGCCGTGGAGAGTTGG + Intergenic
1196450678 X:115867474-115867496 TGGGCAGAGCCGTGGAGAGTTGG + Intergenic
1196451349 X:115870453-115870475 TGGGCAGAGCCGTGGAGAGTTGG + Intergenic
1196452020 X:115873440-115873462 TGGGCAGAGCCGTGGAGAGTTGG + Intergenic
1196452690 X:115876409-115876431 TGGGCAGAGCCGTGGAGAGTTGG + Intergenic
1196453360 X:115879402-115879424 TGGGCAGAGCCGTGGAGAGTTGG + Intergenic
1196454030 X:115882411-115882433 TGGGCAGAGCCGTGGAGAGTTGG + Intergenic
1196454696 X:115885400-115885422 TGGGCAGAGCCGTGGAGAGTTGG + Intergenic
1196455110 X:115887482-115887504 TGGGCAGAGCCGTGGAGAGTTGG + Intergenic
1198160779 X:134005794-134005816 TGGGCAGAGTTGATGAAAGGAGG - Intergenic
1200179308 X:154140785-154140807 TGGGAGGAGGCCTGGAAAGGCGG - Intergenic
1200238143 X:154479000-154479022 TGGGCGGAGTCGTGCGCAGGGGG - Exonic