ID: 1162373773

View in Genome Browser
Species Human (GRCh38)
Location 19:10293453-10293475
Sequence GGGCGGAGTCGTGGAAAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162373763_1162373773 1 Left 1162373763 19:10293429-10293451 CCCCTAGCCTAGGGCGTGGTATT 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1162373773 19:10293453-10293475 GGGCGGAGTCGTGGAAAGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 154
1162373759_1162373773 14 Left 1162373759 19:10293416-10293438 CCGGGTGGGCGTGCCCCTAGCCT 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1162373773 19:10293453-10293475 GGGCGGAGTCGTGGAAAGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 154
1162373768_1162373773 -6 Left 1162373768 19:10293436-10293458 CCTAGGGCGTGGTATTTGGGCGG 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1162373773 19:10293453-10293475 GGGCGGAGTCGTGGAAAGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 154
1162373765_1162373773 -1 Left 1162373765 19:10293431-10293453 CCTAGCCTAGGGCGTGGTATTTG 0: 1
1: 0
2: 0
3: 11
4: 80
Right 1162373773 19:10293453-10293475 GGGCGGAGTCGTGGAAAGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 154
1162373764_1162373773 0 Left 1162373764 19:10293430-10293452 CCCTAGCCTAGGGCGTGGTATTT 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1162373773 19:10293453-10293475 GGGCGGAGTCGTGGAAAGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162373773 Original CRISPR GGGCGGAGTCGTGGAAAGGC GGG Intronic
900187181 1:1337936-1337958 GGGCGGAGCCGGGGAAGGGCAGG + Intronic
900365799 1:2311495-2311517 GGGAGGAGTTGGGGAAGGGCTGG + Intergenic
900389957 1:2429476-2429498 GGGTGATGTGGTGGAAAGGCGGG + Intronic
900589675 1:3454109-3454131 GGACCGAGTCCTGGAAAGGAAGG - Intergenic
900785075 1:4644332-4644354 GGGGGGAGGCGTGGGATGGCAGG + Intergenic
905311843 1:37054577-37054599 GGGCGGTGTTGTGGAGGGGCTGG - Intergenic
906895452 1:49765161-49765183 GGGCCGAGCCTTGGAATGGCTGG - Intronic
908608859 1:65833334-65833356 GAGGGGAGAAGTGGAAAGGCTGG - Intronic
910502570 1:87909614-87909636 GGGAGCAGTGGTGGAGAGGCTGG - Intergenic
912576221 1:110674863-110674885 GGGCGGAGGCGGCGAAAGGGCGG - Exonic
920227817 1:204450816-204450838 GAGGGGAGCTGTGGAAAGGCAGG + Intronic
920567823 1:206989635-206989657 GGGCGGAGATGTGGAAACCCAGG - Intergenic
1065349533 10:24783103-24783125 GGGCTGAGTAGGGGAAGGGCAGG - Intergenic
1073201680 10:101740558-101740580 GGGCAGAGCTGTGGAAAGGGTGG + Intergenic
1073496786 10:103898899-103898921 GGGCTGAGCTGTGAAAAGGCTGG + Exonic
1075224982 10:120620731-120620753 GGCAGGAGTCGAGGGAAGGCAGG - Intergenic
1076594011 10:131613846-131613868 GGGCAGAGTGCTGGAGAGGCAGG - Intergenic
1077156588 11:1094742-1094764 GGGCGTAGTCGTTGGAGGGCTGG - Intergenic
1077266745 11:1654709-1654731 GGGCGGATTCGGGGAAGCGCAGG - Intergenic
1080571095 11:33557898-33557920 GGGCGGGGTAGAGAAAAGGCGGG + Intronic
1080588471 11:33700993-33701015 GGGCGGAGTCGAGGGACGGGAGG - Intronic
1081465799 11:43315716-43315738 AGGCAGAGTGGGGGAAAGGCAGG - Intronic
1081813176 11:45924486-45924508 GGGCTGTGTGGGGGAAAGGCAGG - Exonic
1083478669 11:62929818-62929840 GGGCAGTGTCCGGGAAAGGCTGG - Intergenic
1084165214 11:67372360-67372382 GCACGGAGTTGTGGAAAGGAAGG + Intronic
1088316213 11:108509277-108509299 AGTGGGAGTGGTGGAAAGGCAGG + Exonic
1092171896 12:6378806-6378828 GGGGGTAGTCCTGGGAAGGCAGG - Intronic
1094837188 12:34327659-34327681 GGGCGGAGTCTTGGAGATCCTGG - Intergenic
1097013050 12:55966754-55966776 GGGCGGAGCCAGGGAAACGCGGG + Exonic
1101311776 12:103587136-103587158 GGGCAGAGTAGAGGAGAGGCAGG + Intergenic
1102381087 12:112467451-112467473 GGCCGGAGTGGTGGCAAGGGTGG + Intronic
1102760453 12:115380499-115380521 GGGCAGAGTCTCGGAAAGACAGG + Intergenic
1104001185 12:124861690-124861712 GGGCCGAGTGGTGTGAAGGCAGG - Intronic
1105795038 13:23843304-23843326 GAGCGGAGTCTGGAAAAGGCAGG + Intronic
1106057628 13:26253840-26253862 GGGCGGAGTCGTAGAAGGGGCGG + Intergenic
1108107906 13:47032997-47033019 GGGAGGAGTTGCGGAGAGGCTGG - Intergenic
1112456993 13:99572028-99572050 GGGCAGAGTAGTGGCAAGTCTGG - Intergenic
1115854086 14:37611167-37611189 GGGCAGAGGCGCGGAGAGGCGGG + Intronic
1117043480 14:51789244-51789266 GGGAGGGGTAGGGGAAAGGCAGG - Intergenic
1121312728 14:92943910-92943932 GAGCTGAGAGGTGGAAAGGCTGG + Intronic
1122779706 14:104138519-104138541 GGGCGGGGCCGGGGAAGGGCGGG - Intergenic
1125462453 15:39920120-39920142 TGGCGGAGTCCTGGAGAAGCCGG + Exonic
1125717633 15:41828078-41828100 GCGGGGCGTCGGGGAAAGGCGGG + Exonic
1126108601 15:45162800-45162822 AGGAGGAGTGGTGGCAAGGCAGG + Intronic
1126670348 15:51110394-51110416 GGGTGGAGGCATGGAAAGGGTGG + Intergenic
1129682194 15:77664206-77664228 AGGCGGAGGGGTGGAAAGGGAGG + Intronic
1130557037 15:84930022-84930044 GGGCTGAGTCCTGCACAGGCAGG - Intronic
1132580816 16:683920-683942 GGGCAGAGTCGCGGCCAGGCCGG + Intronic
1134632971 16:15770335-15770357 GGGCGTAGGCGTGGGAAGGAAGG + Intronic
1135597362 16:23754744-23754766 CGGGGGAGGCGTGGAAACGCGGG + Exonic
1136455656 16:30378398-30378420 AGGCGGAGCCGAGGTAAGGCCGG + Exonic
1136498485 16:30658367-30658389 GGGCGCAGTCGTTGATAGGCTGG - Intergenic
1139136079 16:64206223-64206245 GGGCGGAGTGGTGGAGGGGGTGG + Intergenic
1140517612 16:75555757-75555779 GGGCAGAGTCGGGGATAGGGTGG - Intronic
1143166213 17:4898446-4898468 GGGCTGAGCCTTAGAAAGGCTGG + Exonic
1146413903 17:32614239-32614261 GGGCGGGGGCATGGAAGGGCAGG - Intronic
1146621378 17:34401240-34401262 GGGCGGAGTGGGGGACAGGGAGG - Intergenic
1147904909 17:43816422-43816444 TAGCCGAGTCCTGGAAAGGCTGG + Intronic
1148441388 17:47713423-47713445 GGGAGGATTAGAGGAAAGGCTGG - Intergenic
1152305929 17:79520155-79520177 GGGAGGAGGCGGGGCAAGGCTGG - Intergenic
1152853067 17:82648762-82648784 GGGGCGAGGCGAGGAAAGGCGGG + Intergenic
1153285012 18:3449353-3449375 AGGCGGAGTCTTGGTGAGGCAGG + Intronic
1156477832 18:37417380-37417402 GGCAGGAGAAGTGGAAAGGCAGG - Intronic
1157773838 18:50374943-50374965 TGGCCGAGCCGGGGAAAGGCGGG - Intergenic
1158066247 18:53412983-53413005 GGGAGGATTAGTGGAAAGGTGGG - Intronic
1160679599 19:406694-406716 GGGCGGGGCCGTGGACAGGGAGG - Exonic
1161104515 19:2436777-2436799 GTGCGGAGTCCTGGAGAGGGCGG - Intronic
1161847610 19:6720687-6720709 GGGCTGAGTGGGGGAAAGGCAGG - Intronic
1161983849 19:7643698-7643720 GGGCGGAGCCTTGGAGAGGTGGG + Intronic
1161983861 19:7643732-7643754 GGGCGGAGCCTTGGAGAGGTGGG + Intronic
1161983909 19:7643869-7643891 GGGCGGAGCCTTGGAGAGGTGGG + Intronic
1162021858 19:7871726-7871748 GGGCGGAGACGGGGAAGGACTGG + Exonic
1162373773 19:10293453-10293475 GGGCGGAGTCGTGGAAAGGCGGG + Intronic
1163115734 19:15187771-15187793 GGGCGGGGTTGTAGCAAGGCAGG - Intronic
1163316303 19:16542647-16542669 GCGCGGCGCCGCGGAAAGGCTGG + Intronic
1163664489 19:18596864-18596886 GGGCGGAGTCAGGGAAGGGGAGG + Intronic
1163679058 19:18670125-18670147 GCGCGGAGGGGTGGAAAGGAGGG - Exonic
1166150961 19:40875642-40875664 GGGCGGGGCCAGGGAAAGGCGGG - Exonic
1166357705 19:42236784-42236806 GGGAGCAGTGGGGGAAAGGCAGG + Intronic
1166364017 19:42269488-42269510 GGGCGGAATGGTGGGAAGGGAGG + Intronic
1166381914 19:42359106-42359128 GGGCTGAGGCGTGGAAAAGCCGG - Exonic
1166389731 19:42402248-42402270 GGGGGGAGTTGTGGGAAGGATGG + Intronic
928167172 2:28979928-28979950 GGGCGGGGACGTGACAAGGCAGG - Intronic
928359489 2:30651528-30651550 GGGAGGAGTCGGGGAGAGCCAGG + Intergenic
933808013 2:86014162-86014184 GGGAGGAGCAGTGGAAAGGGTGG + Intergenic
937316918 2:120937579-120937601 GGGTGGGGTTGGGGAAAGGCTGG - Intronic
938548230 2:132353645-132353667 GGGCGGAGTCACGGCCAGGCGGG + Intergenic
938649911 2:133372298-133372320 GGGCAGTGTTGTGGAAAGACAGG + Intronic
942367328 2:175241307-175241329 GGGAGGAGTTCTGGAAAGGGGGG - Intergenic
1169608974 20:7357862-7357884 GGGAGGAGGCATGGAGAGGCTGG - Intergenic
1170614834 20:17940094-17940116 GTGCTGAGACCTGGAAAGGCAGG - Intergenic
1173529998 20:43762053-43762075 GGACGGAGGGGTGGACAGGCCGG + Intergenic
1173801014 20:45894589-45894611 TGGTGGGGTCGTGGAGAGGCTGG + Intronic
1175809842 20:61852114-61852136 GGGGGGATCCGTGGAGAGGCAGG - Intronic
1179902619 21:44401909-44401931 GGGCTGGGGCGTGGAAAAGCGGG - Intronic
1180110168 21:45643791-45643813 GGGCGGGGTCGGGGCGAGGCGGG - Exonic
1183427188 22:37746259-37746281 GGGCAGCGTCGGGGAAAGGAAGG + Intronic
1184898698 22:47429699-47429721 GGGAGGGGTTGTAGAAAGGCAGG + Intergenic
1185417863 22:50720058-50720080 GGGTGGAGTCGGGTCAAGGCTGG + Intergenic
950016677 3:9759439-9759461 GGGAGGAGTCCTGGGGAGGCTGG + Intronic
952888187 3:38024560-38024582 GGGCGGAGTCCAGGAATGGGAGG + Exonic
954389188 3:50260075-50260097 GGGCGGGCTCGCGGAAAGGCTGG + Intergenic
954827515 3:53387151-53387173 GGAAGGAGTGGTGGAAGGGCAGG + Intergenic
955144938 3:56307756-56307778 TGGGGGAGTAGTGGAAAGGAAGG + Intronic
961389228 3:126542533-126542555 GGGCGGAGTAGTTGAAAAGCAGG - Exonic
962009857 3:131382081-131382103 CGGCGGATTCGTGGACACGCAGG + Exonic
966924103 3:184633463-184633485 GGGCAGAGTCGGGGAAGGGGGGG - Intronic
968178265 3:196569406-196569428 GACTGGAGCCGTGGAAAGGCGGG - Intronic
969413179 4:7042875-7042897 AGGCGGAGACGGGGAAAGCCTGG - Exonic
969422114 4:7103477-7103499 GGGCGGAGCCAAGGAAGGGCGGG - Intergenic
969694977 4:8729305-8729327 GGGGGGCGTCATGGAAAGGAGGG + Intergenic
969832573 4:9809518-9809540 AGGAAGAATCGTGGAAAGGCTGG + Intronic
970194378 4:13541086-13541108 GGTGGGCGCCGTGGAAAGGCTGG + Exonic
980550642 4:134329111-134329133 GGAGGGAGCCGTGGAAAGCCAGG - Intergenic
985421189 4:189786567-189786589 GGGTGGGGTCGGGCAAAGGCAGG - Intergenic
985668375 5:1193503-1193525 TGGCTGAATGGTGGAAAGGCTGG + Intergenic
985688646 5:1295068-1295090 GGGCGGGGCCGCGGAAAGGAAGG + Intronic
990165408 5:52989031-52989053 GGGCGGAGTGGTGCCAGGGCGGG + Intergenic
991454887 5:66792319-66792341 AGGCGGAGTCGGGGGAAGGATGG - Intronic
997377320 5:133406402-133406424 GGGCTGAGTGGTGGGATGGCAGG - Intronic
997467665 5:134099099-134099121 GGGCAGAGAGGTGGACAGGCAGG + Intergenic
998632824 5:143919100-143919122 TGGGGGAGTGGGGGAAAGGCTGG + Intergenic
1003560089 6:7172915-7172937 GGGCTGAGTCTTGGCTAGGCTGG - Intronic
1004484313 6:16051554-16051576 GGCCGGAGTGGAGGTAAGGCTGG - Intergenic
1005959950 6:30687344-30687366 GGGCGGAGCCGAGGAGAGGGCGG + Exonic
1006413732 6:33891310-33891332 TGGCGGAGTGGTGGAGTGGCTGG - Intergenic
1007074856 6:39059973-39059995 GGACGGGGTTGGGGAAAGGCTGG - Intronic
1014045341 6:116877671-116877693 GGGCGGAGGGGAGGAAAGGGGGG - Intronic
1016981614 6:149860152-149860174 TGGCGGAGACAGGGAAAGGCTGG + Intronic
1021510253 7:21427082-21427104 GGGCGGCGGCGTGGGGAGGCGGG - Intergenic
1025115463 7:56254509-56254531 GGGCGGGGCTGTGGAAAGCCAGG - Intergenic
1026506202 7:70986536-70986558 GGACAGAGTCCTGGAAAGGAGGG - Intergenic
1026737991 7:72960975-72960997 GTGCGCAGGCGTGGAGAGGCTGG - Intronic
1026765802 7:73158787-73158809 GGGTGGAGTCAGGGAAGGGCTGG + Intergenic
1027042276 7:74968484-74968506 GGGTGGAGTCAGGGAAGGGCTGG + Intronic
1027081366 7:75233874-75233896 GGGTGGAGTCAGGGAAGGGCTGG - Intergenic
1027105743 7:75404093-75404115 GTGCGCAGGCGTGGAGAGGCTGG + Intronic
1029389952 7:100268475-100268497 GGGTGGAGTCAGGGAAGGGCTGG - Intronic
1029542894 7:101194954-101194976 GGGAGGATGCGTGGAGAGGCAGG - Intergenic
1029813799 7:103074571-103074593 GGGAGGAGTGGAGGGAAGGCGGG - Intronic
1030205036 7:106944314-106944336 GGCAGGAGTCGGGGAAAGGCCGG + Intergenic
1035959062 8:4116734-4116756 GGGCGGCTACGTGGAGAGGCAGG + Intronic
1036021328 8:4850525-4850547 GGGAGGAGTGGTGCAAAGGAGGG - Intronic
1039542398 8:38382549-38382571 CGGAGGAGGCGTGGAAAGGTGGG + Intergenic
1040533133 8:48282262-48282284 GGGCGGATGCCTGGGAAGGCGGG + Intergenic
1046098177 8:109584782-109584804 TTGCTGAGTCCTGGAAAGGCAGG + Intronic
1048915603 8:139179952-139179974 GGGAGGAGTAGTGGAGAGGTGGG - Intergenic
1049844192 8:144792193-144792215 GGGCGGGGTCCCGGAAAGCCGGG - Intronic
1049850319 8:144827166-144827188 GAGCGGAGTCGGGGCGAGGCTGG - Intergenic
1053120916 9:35547016-35547038 GGCTGGAGTGGTGGAAGGGCAGG + Exonic
1056926710 9:90840395-90840417 GGGTGGAGTGGGGGAAAAGCAGG + Intronic
1057852701 9:98577564-98577586 GGGCGCATGTGTGGAAAGGCAGG + Intronic
1058110698 9:101028694-101028716 GGGCGGAGGAGGGGAGAGGCGGG - Exonic
1059938040 9:119331263-119331285 AGGAGGAGCCTTGGAAAGGCAGG + Intronic
1060418437 9:123449829-123449851 TTGCGGACTCGGGGAAAGGCTGG + Intronic
1061134413 9:128724951-128724973 GGGAGGTGCTGTGGAAAGGCGGG - Intergenic
1061482991 9:130906359-130906381 GTGCGGAGCCGGGGAGAGGCAGG - Intronic
1062075058 9:134583414-134583436 GGGCTGAGTCGAGGAAGAGCAGG + Intergenic
1186425897 X:9464652-9464674 CGAGGCAGTCGTGGAAAGGCTGG + Intronic
1186512390 X:10139544-10139566 TGGCGGAGGCGTGGCAAGGCCGG + Intronic
1192577553 X:72255094-72255116 GGGCAGAGCCGCAGAAAGGCAGG + Intronic
1195574818 X:106438080-106438102 GGGTGGAGGAGTGGAAAGACGGG - Intergenic
1196085849 X:111681603-111681625 GGGCGGAGCCGTTGGAAGGAGGG - Intronic
1200861671 Y:7998807-7998829 GGGCAGTGTTGTGGAAAGTCAGG - Intergenic