ID: 1162377603

View in Genome Browser
Species Human (GRCh38)
Location 19:10314379-10314401
Sequence CATCTGTCCCCCAGTGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162377603_1162377606 11 Left 1162377603 19:10314379-10314401 CCAATCTCACTGGGGGACAGATG 0: 1
1: 0
2: 1
3: 10
4: 148
Right 1162377606 19:10314413-10314435 AACAAAACAGCCTGGCATTGTGG 0: 1
1: 0
2: 21
3: 379
4: 5646
1162377603_1162377605 3 Left 1162377603 19:10314379-10314401 CCAATCTCACTGGGGGACAGATG 0: 1
1: 0
2: 1
3: 10
4: 148
Right 1162377605 19:10314405-10314427 AAGTAGGAAACAAAACAGCCTGG 0: 1
1: 0
2: 4
3: 53
4: 665

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162377603 Original CRISPR CATCTGTCCCCCAGTGAGAT TGG (reversed) Intronic
900272146 1:1796469-1796491 CATCAGTTCCCCAGTTACATGGG - Intronic
900636786 1:3669806-3669828 CCCCTGTCCCCCAGTTTGATGGG - Intronic
902113004 1:14098856-14098878 CATCTGTTCCCCAGGGAGGGTGG - Intergenic
903936926 1:26902109-26902131 CATCCTTCCCCAAGTGAGTTAGG + Intronic
904273245 1:29364045-29364067 CACCTGACCCCCAGTGACAGAGG + Intergenic
905875861 1:41431825-41431847 CATCTGTCCTGCATTGAGACCGG - Intergenic
906833756 1:49060992-49061014 CCCCTGTCCCCCACTGAGTTTGG - Intronic
908444672 1:64189604-64189626 CATCTGTGCCCCATTTAGCTTGG + Intergenic
911794512 1:102058945-102058967 CATCTGTGCCCCTGTCAGCTTGG - Intergenic
913278881 1:117165987-117166009 CAGCTGTCACCCTGTGAAATGGG + Intronic
914935917 1:151980188-151980210 CCTCGGTCTCCTAGTGAGATGGG + Intergenic
915243879 1:154542871-154542893 CCTCTGTCCCCCAGAGAGTGGGG + Intronic
918201742 1:182273940-182273962 CATCTGTCAGCCCTTGAGATGGG + Intergenic
919505851 1:198396941-198396963 GATCTATCACCCAGTGAGAGAGG + Intergenic
919900091 1:202037794-202037816 CCTCAGTCCTCCAGGGAGATTGG + Intergenic
920136892 1:203777108-203777130 CATCTGTCACCCAGTAAGGGTGG + Intergenic
920531768 1:206707295-206707317 CATCTCTCCCCCATGGAGAATGG + Intronic
922328545 1:224553455-224553477 CAGAGGTCTCCCAGTGAGATTGG - Intronic
1065659671 10:27992801-27992823 CATCTGACCCCTAGTTAGGTGGG - Intronic
1071060633 10:81567840-81567862 CATCTGTTCCCTACAGAGATTGG - Intergenic
1072991005 10:100193722-100193744 CATCTATCCCCAAGTTAGGTTGG + Intronic
1073417358 10:103395633-103395655 CCTCTCTCCACCTGTGAGATGGG + Intronic
1076738000 10:132467302-132467324 CATGTGTCACCCACTGAGCTGGG + Intergenic
1080047913 11:27828446-27828468 CAAATGTCCCCCAGAAAGATGGG + Intergenic
1081693820 11:45095482-45095504 CATCTGTGCCACAGTGACAAAGG - Intergenic
1082006875 11:47424232-47424254 CACCTGTCACCCAGTCAGTTGGG - Intronic
1083710221 11:64543422-64543444 CATCTGTTCCCCGGTTAGATGGG + Intergenic
1084032926 11:66491684-66491706 CTTCTCTCCCCCAGTTACATCGG + Exonic
1084209371 11:67613999-67614021 CATCTGGTCCCCAGGGAAATAGG - Intergenic
1084793171 11:71487898-71487920 CTTCTGTCCCGCAGTGAGAAAGG - Intronic
1089745544 11:120614347-120614369 CCACTGTGCCCCAGTGGGATTGG - Intronic
1090475211 11:127013991-127014013 CATCAGTCACAAAGTGAGATGGG - Intergenic
1093026805 12:14253031-14253053 CCTCTGCCTCCCAGTGAGGTGGG - Intergenic
1094227249 12:28059873-28059895 CATCTGGGCCCCAGTGAGATAGG - Intergenic
1094651478 12:32381655-32381677 AATCTGTCCCTCAGAGACATTGG + Intronic
1097204811 12:57311730-57311752 CATCTGTCCTTCAGAAAGATTGG + Intronic
1097281649 12:57848166-57848188 CATCTGTCCACAGGTGACATGGG + Intergenic
1098596841 12:72282883-72282905 CATCTCTCCCCAGTTGAGATGGG - Intronic
1102882150 12:116493836-116493858 GACCTGTCCCCCAGTGAGGGAGG - Intergenic
1103344470 12:120240248-120240270 CACCTGTCACCTGGTGAGATAGG - Intronic
1106890609 13:34241741-34241763 TTTCTGTTCCCCAGTGAGGTAGG - Intergenic
1107790029 13:43992526-43992548 CATCTGTTCCTAAGTGAGAATGG - Intergenic
1109316857 13:60759698-60759720 CATCTGTAAGCCAGTGATATGGG + Intergenic
1109382879 13:61587438-61587460 CATATGTCACCAAGTGTGATGGG - Intergenic
1110431600 13:75430615-75430637 CATCTGTCCCCCGATGAGCCTGG - Intronic
1111412130 13:87891052-87891074 CATTTGTCACCCAGTGAAAGAGG - Intergenic
1111619844 13:90710417-90710439 TATCCTTCCCCCAGTGAGTTAGG - Intergenic
1115961389 14:38838276-38838298 CAGCTGTTCCCCAGTGACCTTGG - Intergenic
1119147852 14:72332810-72332832 CATATATCTCCCAGGGAGATGGG + Intronic
1121452244 14:94016445-94016467 CATCTGGCCCCCAGTGAAGGGGG - Intergenic
1124171128 15:27374964-27374986 CATCTGTACCCCATTGTGTTGGG - Intronic
1126243329 15:46471975-46471997 GCTCTATCCTCCAGTGAGATGGG + Intergenic
1126315201 15:47362508-47362530 CATCAGTGCCCGTGTGAGATGGG - Intronic
1127453963 15:59141279-59141301 AACCAGTCCCCCAGGGAGATAGG - Intronic
1130977969 15:88791906-88791928 CATGTGTCACCCACTGTGATGGG + Intergenic
1131645949 15:94344144-94344166 TACATGTCCCCCAGTGATATTGG - Intronic
1132744098 16:1429611-1429633 CAGGCGTCCCCCAGTCAGATGGG - Intergenic
1133701602 16:8314525-8314547 AATCTGTCCACCAGTAAAATTGG + Intergenic
1133729445 16:8567288-8567310 CATCTGTTCCCATGTGAGCTAGG + Intergenic
1135205283 16:20478699-20478721 CCTCTGTTCCCCAGTGAGGATGG + Intronic
1135213621 16:20545113-20545135 CCTCTGTTCCCCAGTGAGGATGG - Intronic
1136552506 16:30989214-30989236 CTTCTGTCCCCACGTGGGATGGG - Intergenic
1138109707 16:54313815-54313837 CAGGAGTTCCCCAGTGAGATGGG + Intergenic
1143265101 17:5630698-5630720 CAGCTGTCCCCCAGGGAAGTAGG + Intergenic
1143274671 17:5701293-5701315 CATCTGGGACCCAGAGAGATGGG + Intergenic
1148006803 17:44438826-44438848 CCTCTGTCCCCGGCTGAGATTGG - Intronic
1152241933 17:79165469-79165491 CACCTGTCCCCCAGAGGGATGGG - Intronic
1152353337 17:79795218-79795240 GAGCTGTCCCCCGGTGAGCTGGG + Exonic
1153243658 18:3053225-3053247 CATGTGTCCCCCAGATAGAATGG - Intergenic
1156841763 18:41617436-41617458 CCTCTGTCCCCCTGTGCAATAGG - Intergenic
1158199937 18:54928696-54928718 CTTCTGTCCCCCAAAGAAATAGG - Intronic
1158975089 18:62703930-62703952 CAACTCTCCCTCAGTGAGAGAGG - Intergenic
1159391030 18:67791607-67791629 CATTTGTCCCCCAGTCACATAGG - Intergenic
1161754392 19:6121033-6121055 CTTCTGTACCCCAGTGTGGTGGG - Intronic
1162377603 19:10314379-10314401 CATCTGTCCCCCAGTGAGATTGG - Intronic
1162998253 19:14350071-14350093 CCTGTGTCTCCCAGGGAGATGGG - Intergenic
1163193929 19:15701408-15701430 CATCTCACCCCCATTGAAATGGG + Intergenic
1166539246 19:43594712-43594734 GATCCCTCCCCCAGTGAGTTTGG - Intronic
1167800337 19:51736597-51736619 CATCTGTCCCTCAGTGTCCTTGG + Intergenic
1168695833 19:58404209-58404231 AATCTGTTCCTCTGTGAGATGGG - Intronic
925173578 2:1767301-1767323 CAGCTGTGCCCCAGGGGGATGGG + Intergenic
926298194 2:11583308-11583330 CATCTGTCCCCAATTGCGATGGG - Intronic
927204703 2:20599828-20599850 CATCTGTTCCCCAGGGAGACAGG + Intronic
927772308 2:25874236-25874258 CCTCTGCCTCCCAGTGTGATGGG - Intronic
928238283 2:29564271-29564293 CACCTGTCACCCCTTGAGATTGG - Intronic
935595859 2:104876967-104876989 CATCTGCCCCCAAGGGAGAAGGG + Intergenic
938969314 2:136417639-136417661 CATCTGTGCCCCAGGTACATCGG - Intergenic
939371265 2:141303949-141303971 CATCTTTCCCCCAATTAGAATGG - Intronic
941277572 2:163509114-163509136 CATCCGTGCCCCAGAGAGATGGG - Intergenic
947422361 2:229952571-229952593 CATCTGTGGCCCTGTGAGAAAGG - Intronic
948198785 2:236114580-236114602 CATCTGTCAGCCAGGGAGAGAGG - Intronic
948229235 2:236337420-236337442 CATGTGGCCCCCAGAGAGAAAGG - Intronic
948939427 2:241188665-241188687 CCTCTGTCCCGCAGTGAGGACGG + Exonic
1170038558 20:12016448-12016470 CCTCAGTCACCCAGTGAGAATGG + Intergenic
1181884920 22:26013216-26013238 CAGCTGTCCCCTGTTGAGATGGG - Intronic
1183752956 22:39732513-39732535 GATCTGTTCTCCTGTGAGATCGG + Intergenic
1184453943 22:44598650-44598672 TCTCTGTCCCCCAGTGGGGTGGG - Intergenic
949547061 3:5081441-5081463 TCTCTGTCCCCCAGTGGGAAAGG - Intergenic
950433109 3:12962632-12962654 CATGGGTCCCTCAGTGAGTTAGG + Intronic
953469265 3:43153346-43153368 CATCTGACACCCAGAGAGAGGGG - Intergenic
955702569 3:61696574-61696596 CATCAGTCCATCAGTGAGAAAGG - Intronic
957755943 3:84487590-84487612 CATGTGTCCATCAGTGATATTGG + Intergenic
960520534 3:118649394-118649416 CATTTGTACCACAGTGAGGTAGG - Intergenic
964506548 3:157405936-157405958 CCTCTCTCCCTCAGTGATATAGG - Intronic
966574961 3:181490534-181490556 GATCAGTCCCCCAAAGAGATAGG + Intergenic
967121102 3:186383599-186383621 CCTCTGTCCAACAATGAGATCGG + Intergenic
969706694 4:8796277-8796299 CACCTCTCTCACAGTGAGATGGG + Intergenic
972278187 4:37578804-37578826 CCTCTGTCTCCCAGAGAGCTAGG - Intronic
973896540 4:55419417-55419439 AACCTGACCCCCAGAGAGATCGG + Intronic
977677019 4:99759176-99759198 CCTCTCTCCCACAGTGATATGGG + Intergenic
979568466 4:122184521-122184543 CCTCAGCCTCCCAGTGAGATGGG - Intronic
983156844 4:164358310-164358332 TTTATGTCCCCCAGTGACATTGG - Intronic
983962344 4:173770000-173770022 TTTATGTGCCCCAGTGAGATGGG + Intergenic
986107247 5:4671543-4671565 CATGTGACCCCCAGTGAATTGGG - Intergenic
986155846 5:5175348-5175370 CAGCTCTGCCCCAGTAAGATAGG - Intronic
987089504 5:14498505-14498527 CATCTGTGCCGCAGTGACCTGGG + Exonic
998484856 5:142492996-142493018 CAGCTGTCCCTCGGTGAGTTTGG - Intergenic
1001581932 5:172804850-172804872 CCTGTGGGCCCCAGTGAGATGGG + Intergenic
1002198728 5:177514906-177514928 CATCTGCCCCTCGGTAAGATAGG - Exonic
1003374277 6:5560876-5560898 CCTCTGTCCCCCAGAGTGTTGGG - Intronic
1003500909 6:6702078-6702100 CAGCTGTCCCTCGGGGAGATGGG - Intergenic
1005806238 6:29476581-29476603 CCTCTGTGCCTCAGTGAGCTCGG + Intergenic
1007185282 6:39966307-39966329 CATCTGCCCCCCAGAGTGCTGGG - Intergenic
1008144524 6:47875399-47875421 CATCTGTTTCACAGTGAGGTTGG + Intergenic
1009860069 6:69317372-69317394 CACCTATCCACTAGTGAGATTGG + Intronic
1010824148 6:80452233-80452255 CATCTCTACCCCACTGAAATCGG - Intergenic
1012267720 6:97166823-97166845 CATCTCTCCCTCTGTGGGATTGG + Intronic
1013460548 6:110371235-110371257 CAACTTACCCCCAGTGAGAACGG + Intergenic
1014672189 6:124319061-124319083 CCTATGTGCCCCACTGAGATAGG + Intronic
1016855980 6:148671193-148671215 CCTCCTTCCCCCAGGGAGATGGG + Intergenic
1019580964 7:1762763-1762785 CGTCGGTCCCTCCGTGAGATTGG + Intergenic
1022021719 7:26406096-26406118 CATCTGTCCCACATTGATATTGG + Intergenic
1022028531 7:26470445-26470467 CCTCTGTCCCCCAGGGAGAAGGG - Intergenic
1022378709 7:29840091-29840113 CACCTGTCCCGCAGTCAGCTGGG + Intronic
1022791236 7:33691261-33691283 CATCTGTCCCACAGAGTTATTGG - Intergenic
1023016870 7:35977102-35977124 ACTCTGTCCACCAGTGAGCTGGG - Intergenic
1023115996 7:36863074-36863096 CAGCTGTCCCTCATTGAGAGGGG + Intronic
1030384121 7:108847586-108847608 CCTCTCTCCCCTATTGAGATAGG - Intergenic
1031512744 7:122669888-122669910 GATCTGTCACTCACTGAGATAGG - Intronic
1031885935 7:127246470-127246492 GATTTGTCCCCCTCTGAGATTGG - Intronic
1032059939 7:128715884-128715906 CAGCTGTCACCCAGGGAGAAAGG + Intronic
1032135986 7:129278324-129278346 CATCAGTCTCCCAGTGTGTTGGG + Intronic
1036789223 8:11707425-11707447 CATCTCTCCCCAAGAAAGATGGG - Intronic
1037534035 8:19808388-19808410 CATCGGACCCACTGTGAGATGGG - Intergenic
1048937425 8:139368670-139368692 GATCTGACCCCAAGTGAGAAGGG + Intergenic
1049128733 8:140817063-140817085 CATCTGGCCCCCAGGGAGGAAGG + Intronic
1055012679 9:71584264-71584286 CATGTGTGCCACAGAGAGATGGG + Intergenic
1056940716 9:90953772-90953794 TTTCTTTCCCCCAGTGAAATAGG + Intergenic
1057213177 9:93212407-93212429 CATCTGTCAGCCAGACAGATGGG - Intronic
1061841237 9:133359626-133359648 CAACTGTGCCCCAGTGAGCTTGG - Intronic
1186212950 X:7269283-7269305 TATCTATGCCCCAGTGAGTTGGG - Intronic
1192150053 X:68706529-68706551 CCACTGTCCCCCAGGGAGAGAGG + Intronic
1193018847 X:76768142-76768164 GATTTCTCCCCCAGTGAGTTTGG + Intergenic
1198347216 X:135770256-135770278 CCTTTGTCCCCCAGTGACAATGG - Intergenic
1198349122 X:135787518-135787540 CCTTTGTCCCCCAGTGACAATGG - Intergenic
1198351028 X:135804790-135804812 CCTTTGTCCCCCAGTGACAATGG - Intergenic
1198352934 X:135822055-135822077 CCTTTGTCCCCCAGTGACAATGG - Intergenic
1198354843 X:135839311-135839333 CCTTTGTCCCCCAGTGACAATGG - Intergenic
1198356754 X:135856593-135856615 CCTTTGTCCCCCAGTGACAATGG - Intergenic
1198358667 X:135873873-135873895 CCTTTGTCCCCCAGTGACAATGG - Intergenic