ID: 1162381235

View in Genome Browser
Species Human (GRCh38)
Location 19:10333181-10333203
Sequence TGCGCGGGGGTCGTTGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162381235_1162381245 -1 Left 1162381235 19:10333181-10333203 CCCCCGCCAACGACCCCCGCGCA 0: 1
1: 0
2: 1
3: 5
4: 95
Right 1162381245 19:10333203-10333225 ACCTCAGCGTTGGTGTCGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 62
1162381235_1162381250 24 Left 1162381235 19:10333181-10333203 CCCCCGCCAACGACCCCCGCGCA 0: 1
1: 0
2: 1
3: 5
4: 95
Right 1162381250 19:10333228-10333250 CCCCCCGCGCACGCGCACCGTGG 0: 1
1: 1
2: 1
3: 15
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162381235 Original CRISPR TGCGCGGGGGTCGTTGGCGG GGG (reversed) Intronic
900100785 1:961139-961161 GGGGCGGGGGTCCTTGGCGGAGG + Intronic
901022138 1:6260920-6260942 GCCGCGGGGGTGGCTGGCGGCGG + Exonic
901660311 1:10794908-10794930 CGCGCTGGGGCCGCTGGCGGGGG - Intronic
902072132 1:13749303-13749325 AGAGCGGCGGTTGTTGGCGGGGG - Intronic
902689945 1:18104843-18104865 TGAGCTGGAGTCCTTGGCGGAGG - Intergenic
903875985 1:26473071-26473093 TGCGCGGGGAACGTGGGCGAGGG - Intronic
916069072 1:161159600-161159622 TGCACGGGGGTAGTAGGGGGTGG + Exonic
918064409 1:181089560-181089582 TGCGCGGCGGGGGTGGGCGGCGG + Exonic
924414988 1:243849872-243849894 CGCGCCGGGGGCGTGGGCGGGGG - Intronic
1063115063 10:3067344-3067366 TACGCGGGGGTCGTCGTAGGTGG - Intronic
1067951281 10:50740136-50740158 TGCCCGGGAGTCGTTGGGAGAGG + Intronic
1068144577 10:53051241-53051263 GGCGGGGGGGTGGTTGGGGGTGG - Intergenic
1068560812 10:58512876-58512898 CGCGCGGGCGTTGCTGGCGGGGG + Intergenic
1070886605 10:79905195-79905217 TGCCCGGGGGTCGTTGGGAGAGG + Intergenic
1076117876 10:127913134-127913156 TGCACGGGGATCGGTGGAGGTGG + Intronic
1076360726 10:129887037-129887059 TGGGTGGGGGTTGTGGGCGGGGG + Intronic
1076710599 10:132331882-132331904 TGCGCGGGGGTGGCAGGGGGTGG - Intergenic
1077216049 11:1395554-1395576 GGCGGGAGGGTCGTTGGAGGCGG + Intronic
1077554134 11:3217883-3217905 TGAGCGAGGGTCGGTGGGGGTGG + Intergenic
1082022470 11:47546253-47546275 TGGGCGGGGGCCGGGGGCGGGGG + Intronic
1085050502 11:73377684-73377706 TGCGCGGGGGAGGGGGGCGGGGG - Intronic
1088406042 11:109480269-109480291 TGAGCGGGGGGCGGGGGCGGGGG - Intergenic
1091286822 11:134412441-134412463 TCCGCGGGGGACGGTGCCGGGGG - Intergenic
1091434231 12:460572-460594 GGCGCGGGGGTGGGCGGCGGCGG + Intronic
1091915659 12:4270658-4270680 GGCGCGGGGGTGGGGGGCGGCGG - Intergenic
1092207965 12:6627833-6627855 TGGGCGGGGGTAGTTGGGGGCGG - Intronic
1097251114 12:57632744-57632766 TGCCCGGGGGTGGGTGGGGGTGG - Intronic
1107017728 13:35721163-35721185 TGCACGGGGGTCTCTGGCTGGGG + Intergenic
1107851418 13:44576574-44576596 AGCTCGGGGCTCGCTGGCGGCGG - Intronic
1110712511 13:78665300-78665322 TGCGCGGGGGGTGGGGGCGGGGG - Intergenic
1112505078 13:99970573-99970595 TGCGCGGGCGCCGGCGGCGGCGG + Exonic
1113794791 13:113050750-113050772 GGTGCGGGGGGCGGTGGCGGGGG + Intronic
1115810299 14:37099589-37099611 TGAGGGGGAGTCGGTGGCGGGGG - Intronic
1117547840 14:56808037-56808059 TGCGCGGGGGGCGCGGGCAGTGG - Intronic
1121453726 14:94025608-94025630 GGCGCGGGGGGCGGGGGCGGGGG + Intergenic
1122418393 14:101561028-101561050 GGCGTGGGCGGCGTTGGCGGCGG + Intergenic
1127546698 15:59999670-59999692 AGTGCAGGGGTCGCTGGCGGGGG + Intergenic
1128078208 15:64841534-64841556 AGCGCTGGGGGCGCTGGCGGTGG - Intergenic
1129286164 15:74526785-74526807 TTTGCGGGGGGCGTTGGCAGGGG + Intergenic
1130051660 15:80488686-80488708 TGCGTGGGGTTTGTTGGCAGGGG - Intronic
1131171870 15:90184784-90184806 TGGCCGGGGGCCGGTGGCGGTGG + Intronic
1134696983 16:16232527-16232549 TGCGCGGCGGCGGCTGGCGGCGG + Exonic
1136519498 16:30786826-30786848 AGCGCGGGGGTCGGTGGCGGGGG - Intronic
1140172599 16:72622472-72622494 TGGGCGGGGGGCGGTGGGGGCGG + Intergenic
1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG + Intronic
1147615011 17:41822450-41822472 TGCGAGGGGGACAGTGGCGGTGG + Exonic
1150168409 17:62966389-62966411 GGCGCGGAGGGCGGTGGCGGCGG - Intergenic
1152062324 17:78086937-78086959 TGCGGCGGGGGCGGTGGCGGTGG - Exonic
1154317166 18:13313575-13313597 CGTGCGGGGGACGGTGGCGGGGG - Intronic
1154355660 18:13621782-13621804 GGCGGTGGGGTTGTTGGCGGTGG + Intronic
1157162259 18:45324747-45324769 TGTGCGGGGGTGGGGGGCGGTGG - Intronic
1160592530 18:79952140-79952162 TGCGCCGGGGCCGTCGCCGGGGG + Intergenic
1160875763 19:1295555-1295577 GGCGCGGGGGACGACGGCGGGGG + Exonic
1161594479 19:5144193-5144215 AGCGCGGGTGTCGGTGGGGGCGG - Intronic
1161752924 19:6110542-6110564 TGCGCGAGGCTGGCTGGCGGCGG - Intronic
1162381235 19:10333181-10333203 TGCGCGGGGGTCGTTGGCGGGGG - Intronic
1163552586 19:17973981-17974003 TGTGCGGGGGTTGTGGGGGGTGG - Exonic
1166360152 19:42249629-42249651 TGAGCGGGGGTCCTCGGTGGGGG + Exonic
1168281037 19:55305435-55305457 TGGGAGGGGGTGGTTGGAGGAGG - Intronic
925447761 2:3942673-3942695 TGGGCAGGGGCCGTTGGAGGCGG + Intergenic
927606500 2:24491233-24491255 CGAGCGGGGGGCGGTGGCGGCGG + Intergenic
937480594 2:122254476-122254498 GGCGGGGGGGTCGGTGGCAGGGG - Intergenic
938677985 2:133658092-133658114 GGGGTGGGGGTCGTTGGGGGTGG - Intergenic
941905898 2:170716110-170716132 TGCGTGGGGTGCGGTGGCGGGGG + Intronic
944766707 2:202871688-202871710 GGCGCGGGGCTCGCGGGCGGTGG - Intronic
1170969088 20:21101864-21101886 CACGCGGGGGTGGTTGGGGGCGG + Intergenic
1175998103 20:62820299-62820321 TGCCCGGGGGTCCCTGGTGGTGG - Intronic
1176145038 20:63561799-63561821 TGCGCCGGGGTCGGCGGTGGGGG - Intronic
1184342112 22:43891769-43891791 GGCGCGGGGCTCGCTGGCGCAGG + Exonic
1184736081 22:46398500-46398522 TGCGTGGGGGTTGTGGGGGGCGG - Intronic
961000961 3:123373761-123373783 TGCGGGGGGGTCGGGGGGGGGGG - Intronic
961366477 3:126402802-126402824 TGCCTGGGGGTCGGTGGTGGGGG + Intronic
965415577 3:168388312-168388334 TGAGAGGGGGTAGTTGGGGGAGG + Intergenic
968775399 4:2536866-2536888 GGCGCGGGGGCCGCGGGCGGCGG - Intronic
969115499 4:4868474-4868496 TGCGCGGGGGCGGGTGGGGGGGG - Intergenic
970333199 4:15004381-15004403 TGGGCGGGGGACGGAGGCGGGGG + Intronic
972793868 4:42397822-42397844 TGCGCGGGGCGAGTTGGCGAGGG - Exonic
973820551 4:54658400-54658422 TGCGCGGGGGGCGGAGGCGGGGG + Intronic
978990733 4:115078838-115078860 TGGGCGGGGGTTGGTGGGGGCGG - Intronic
984206463 4:176792769-176792791 TGCGGCGGGGGCGCTGGCGGCGG + Intergenic
987088106 5:14487923-14487945 AGCGCGCGCGTCCTTGGCGGGGG - Exonic
991109803 5:62886781-62886803 TGGGCGTGGGTAGTTGGTGGAGG - Intergenic
1002051938 5:176576207-176576229 TGGGCGGGGGTGGCTGGGGGAGG + Intronic
1002632445 5:180590767-180590789 TGCGCTGGAGTCGGCGGCGGAGG - Exonic
1002991859 6:2245721-2245743 CGCGCGGTGGCCGTCGGCGGAGG - Intergenic
1006123450 6:31821842-31821864 TGCGCGCTGGCCGTGGGCGGTGG + Intergenic
1022101955 7:27174143-27174165 GGCGCGGGGGGCGGCGGCGGTGG - Exonic
1026774981 7:73225809-73225831 TGTCAGGGGGTCATTGGCGGGGG + Intergenic
1027015836 7:74779180-74779202 TGTCAGGGGGTCATTGGCGGGGG + Intronic
1029459769 7:100687949-100687971 TGGGCGAGGGGGGTTGGCGGTGG - Intronic
1038176589 8:25185752-25185774 TGCGCAGGGGTTGCTGGTGGTGG + Intronic
1038828453 8:31032874-31032896 GGCGTGGGGGTCGCGGGCGGCGG - Exonic
1039628449 8:39080861-39080883 TGCGTGGTGGTTGTTGGTGGTGG + Intronic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1043463954 8:80486952-80486974 AGCGCGGGCGGCGCTGGCGGCGG - Exonic
1044606654 8:94053898-94053920 TGGGAGGGTGTCGTTGGGGGAGG - Intergenic
1047317820 8:123750625-123750647 TGAGCGGGGGCAGTGGGCGGTGG + Intergenic
1050744120 9:8857661-8857683 GGCGCGGGAGGCGGTGGCGGCGG - Intronic
1053410636 9:37914269-37914291 TGCGTGGTGGTGGGTGGCGGTGG - Intronic
1057869706 9:98708673-98708695 CGCGCGGGCGGCGGTGGCGGCGG + Exonic
1060283491 9:122228884-122228906 TGCGCGCGGGCCGGGGGCGGGGG - Intronic
1062212754 9:135373482-135373504 TGGGCGGGGCGCGTTGGCGTGGG - Intergenic