ID: 1162381480

View in Genome Browser
Species Human (GRCh38)
Location 19:10334265-10334287
Sequence AGGCTCCAGCCGGGAGGTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 276}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162381480_1162381492 17 Left 1162381480 19:10334265-10334287 CCGGCACCTCCCGGCTGGAGCCT 0: 1
1: 0
2: 4
3: 24
4: 276
Right 1162381492 19:10334305-10334327 CTCGGGGTACGGGTTGCCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 56
1162381480_1162381493 22 Left 1162381480 19:10334265-10334287 CCGGCACCTCCCGGCTGGAGCCT 0: 1
1: 0
2: 4
3: 24
4: 276
Right 1162381493 19:10334310-10334332 GGTACGGGTTGCCCCTGGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 101
1162381480_1162381485 -1 Left 1162381480 19:10334265-10334287 CCGGCACCTCCCGGCTGGAGCCT 0: 1
1: 0
2: 4
3: 24
4: 276
Right 1162381485 19:10334287-10334309 TTCCTTCAAACACCGCAGCTCGG 0: 1
1: 0
2: 0
3: 8
4: 95
1162381480_1162381490 7 Left 1162381480 19:10334265-10334287 CCGGCACCTCCCGGCTGGAGCCT 0: 1
1: 0
2: 4
3: 24
4: 276
Right 1162381490 19:10334295-10334317 AACACCGCAGCTCGGGGTACGGG 0: 1
1: 0
2: 0
3: 5
4: 29
1162381480_1162381488 1 Left 1162381480 19:10334265-10334287 CCGGCACCTCCCGGCTGGAGCCT 0: 1
1: 0
2: 4
3: 24
4: 276
Right 1162381488 19:10334289-10334311 CCTTCAAACACCGCAGCTCGGGG 0: 1
1: 0
2: 0
3: 1
4: 45
1162381480_1162381486 0 Left 1162381480 19:10334265-10334287 CCGGCACCTCCCGGCTGGAGCCT 0: 1
1: 0
2: 4
3: 24
4: 276
Right 1162381486 19:10334288-10334310 TCCTTCAAACACCGCAGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 119
1162381480_1162381489 6 Left 1162381480 19:10334265-10334287 CCGGCACCTCCCGGCTGGAGCCT 0: 1
1: 0
2: 4
3: 24
4: 276
Right 1162381489 19:10334294-10334316 AAACACCGCAGCTCGGGGTACGG 0: 1
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162381480 Original CRISPR AGGCTCCAGCCGGGAGGTGC CGG (reversed) Exonic
900411806 1:2515963-2515985 TGGCTGCAGCGGGGAGGTGCTGG - Intronic
900531863 1:3157839-3157861 AGCATCCAGCCCGGCGGTGCTGG - Intronic
900612672 1:3550956-3550978 AGGCTCCAGCCGGCCAGGGCTGG + Intronic
900634805 1:3657779-3657801 AGGCGCCAGGCGGGAGGTGCTGG - Intronic
902046796 1:13530671-13530693 AGGCACGAGCAGGGAGGTGCTGG - Intergenic
902354081 1:15883503-15883525 TTGCTCCACCCGGGAGGTGGAGG - Intronic
903287498 1:22285994-22286016 AGGCCCCAGAGGGGAGCTGCTGG + Intergenic
904468293 1:30720666-30720688 AGGCTGCAGTGGGGAAGTGCTGG + Intronic
904784346 1:32974062-32974084 ACGCCCCATCCGGGAGGTGAGGG - Intergenic
905247508 1:36625382-36625404 AGGCTCCAGGCACGAGGTGATGG - Intergenic
905270144 1:36782284-36782306 AGGCCCCAGGTGGGAGATGCAGG - Intergenic
908132111 1:61083550-61083572 AGGCTCCACCCGGCCGGCGCGGG - Intronic
910387908 1:86704874-86704896 AGGCGGCAGCCGGGCGGAGCCGG - Exonic
911078941 1:93909285-93909307 AGGCTCCAGCCGCGCGGCGCCGG - Exonic
912701715 1:111882798-111882820 AGAGTCCAGCAGGGAGGGGCTGG + Intronic
913047924 1:115089494-115089516 AGGCTCCGGCGGGGAGGGGGCGG + Intronic
913203169 1:116512674-116512696 AGGCTGAACCCGGGAGGTGGAGG + Intergenic
916501711 1:165393104-165393126 AGTGTGCAGCCGGGAGGGGCAGG + Intergenic
916642963 1:166751019-166751041 GGGCTCCAGCTGGCTGGTGCAGG + Intergenic
916741289 1:167649304-167649326 GGGCTTGATCCGGGAGGTGCCGG + Intronic
917375670 1:174349318-174349340 TGGCCCCATCCGGGAGGTGAGGG - Intronic
919442911 1:197660987-197661009 AGGCTCTAGGAGGGAGATGCTGG + Intronic
919806356 1:201383067-201383089 AGCCTCCAGCCGGAAGGTGAGGG - Exonic
919880498 1:201897769-201897791 AGGCTCCAGACAGGAGGAGTGGG - Exonic
920055249 1:203186437-203186459 AGGCTGCAACCAGGAGGTGGGGG - Intronic
920228949 1:204457740-204457762 AGGCTGCATGCGGGAGGGGCAGG + Exonic
1065138812 10:22700658-22700680 AGGCTCCAGGTGGTAGGGGCAGG - Intronic
1065239640 10:23693585-23693607 CTGCTCCAGCCGGGAGGCGGCGG + Intergenic
1067804983 10:49386140-49386162 AGGCCCCACCCGTGAGCTGCAGG + Intronic
1069883478 10:71608786-71608808 AGCCTCCAGGCGAGAGATGCGGG + Intronic
1070967771 10:80539970-80539992 GGGCTCAGGCCGGGTGGTGCTGG - Intronic
1072433112 10:95390964-95390986 AGGCACCATCTGGGAGGTACTGG + Intronic
1073057668 10:100712796-100712818 AGGCTCCAACTGGGAGGAGGAGG - Intergenic
1073225843 10:101918135-101918157 CGCCTGAAGCCGGGAGGTGCAGG - Intronic
1073544651 10:104338097-104338119 AGCCCCCACCCGGGAGGAGCAGG + Intronic
1075948440 10:126457422-126457444 ATGGCACAGCCGGGAGGTGCTGG + Intronic
1076610861 10:131725236-131725258 AGGCTCCAGCTTGGAGGGGTAGG + Intergenic
1076613606 10:131742513-131742535 ATGCTGCAGGTGGGAGGTGCTGG - Intergenic
1076685192 10:132195524-132195546 AGCTTCCAGCCTGGAGGTGGGGG + Intronic
1077133227 11:985359-985381 TGGGTGCAGCCGGGAGGGGCAGG + Intronic
1077342596 11:2032726-2032748 AGGGTCCAGCAAGGGGGTGCAGG - Intergenic
1077444637 11:2585274-2585296 AGGCTGCCGCCGGGATCTGCCGG - Exonic
1078317385 11:10304840-10304862 GGGCTCCAGGCGGTTGGTGCAGG - Intronic
1079723730 11:23852040-23852062 AGGCTGAACCCGGGAGGTGGAGG + Intergenic
1080315007 11:30938035-30938057 AGGTTCAAGCAAGGAGGTGCAGG - Intronic
1083992474 11:66255272-66255294 TGGCTCAAGCCAGGAGGTGGAGG - Intergenic
1084563303 11:69916004-69916026 AGGCTCCAGCAGGGAGGAGCAGG + Intergenic
1084615593 11:70233829-70233851 TGGCTCCAGCCTGGACGTGGAGG - Intergenic
1084688832 11:70713018-70713040 AGACCCCAGCAGCGAGGTGCAGG + Intronic
1085651063 11:78269147-78269169 AGGCTCCAGCCCAGAGGCGGAGG - Intronic
1088626140 11:111732027-111732049 AGGCTCCAGCAGGGTGGGGAAGG + Intronic
1089015836 11:115164491-115164513 AGGCTACAGTGGGGAGGGGCGGG + Intergenic
1089572223 11:119418419-119418441 AGGCACCAGCCAGCAGGGGCTGG + Exonic
1090334368 11:125953038-125953060 TGGAGCCAGCCGGGAGGTGGGGG + Intergenic
1202825582 11_KI270721v1_random:87915-87937 AGGGTCCAGCAAGGGGGTGCAGG - Intergenic
1093383367 12:18521598-18521620 TGGCTCCAGCCAGGAGGGGTGGG + Intronic
1094025909 12:25959198-25959220 AGGCTGCAGGCGGGACGGGCGGG - Intronic
1095944468 12:47746234-47746256 AGTCTCCAGCAGGCAGGGGCTGG + Intronic
1096105579 12:48995479-48995501 AGTCTCCAGCCGTGCGGGGCCGG - Exonic
1096670693 12:53196729-53196751 GCGCTCCAGCCGGGTGGGGCAGG + Exonic
1097194583 12:57236456-57236478 GGGCTCCAGCCCTGAGATGCCGG + Intronic
1102083554 12:110117465-110117487 AGGCTGAGGCCGGGAGGTACAGG + Intergenic
1102198917 12:111044108-111044130 TGGCTCCCTCCGGCAGGTGCAGG + Intronic
1102354926 12:112225101-112225123 AAGCTCCAGCTGGGAGATCCAGG - Intronic
1104015645 12:124960004-124960026 AGGCTGCAGCCAGGAAGAGCCGG + Intronic
1104018709 12:124977331-124977353 AGGCTTCAGCAGGTAGGGGCTGG - Exonic
1104682699 12:130762326-130762348 AAGCTCCAGGAGGGAGGCGCTGG - Intergenic
1106114567 13:26806260-26806282 CCGCCCCATCCGGGAGGTGCGGG - Intergenic
1106546085 13:30732174-30732196 AGGCGCCTGGCGAGAGGTGCCGG - Intronic
1107154144 13:37146618-37146640 AGGCATCAGCCTGGAGTTGCTGG + Intergenic
1108503373 13:51087767-51087789 AGGCTCCAGCTTGGAGGTGCAGG + Intergenic
1112504602 13:99968535-99968557 AGGCGGCTGCCGGGAGCTGCGGG - Intronic
1113878111 13:113607277-113607299 AGGGGCCAGCCGTGAGCTGCGGG + Intronic
1115540097 14:34411914-34411936 ACGCCCCATCCGGGAGGTGAGGG + Intronic
1116776560 14:49188394-49188416 AGGCTGCAGCTGAGAGGTGCTGG + Intergenic
1118796725 14:69151843-69151865 GGGCTCCGGCCGGGCGGTGTAGG - Intronic
1119400039 14:74357077-74357099 AGGCCTCAGCCTGGAGCTGCGGG + Exonic
1121281715 14:92703751-92703773 AGGCCCCCGCTAGGAGGTGCAGG + Intergenic
1122203213 14:100135120-100135142 AGGTGCCAGCCTGCAGGTGCTGG - Intronic
1122712026 14:103665861-103665883 AGGCGCCACCCTGGAGGTGGGGG + Intronic
1124410504 15:29432760-29432782 AGGCTGCAGCAGGGAGCTGGGGG - Intronic
1125457707 15:39877642-39877664 TGCCTGCACCCGGGAGGTGCAGG - Intronic
1126573240 15:50173017-50173039 AGCCCCCATCCGGGAGGTGGGGG + Intronic
1127119595 15:55759559-55759581 AGGCTGCAGCAGGGAGATGGAGG - Intergenic
1127384504 15:58456530-58456552 AGGCCCCTGGAGGGAGGTGCTGG + Intronic
1128498289 15:68210563-68210585 AGGCTGCAGCTGGGAGGTGAGGG - Intronic
1129225681 15:74169070-74169092 AGGCTCCAGCTGGAAGGTCAAGG + Intergenic
1129711887 15:77824669-77824691 AGGCTCCAGACAGAAGGGGCTGG + Intergenic
1129980535 15:79865504-79865526 AGCCCCCAGCCAGGAGGAGCAGG + Intronic
1130512344 15:84600393-84600415 AGGCTCCACCCAGGAGAAGCTGG + Intergenic
1131166752 15:90147361-90147383 ACACTCCAGCCTGGAGGTGGAGG + Intergenic
1131171992 15:90185178-90185200 AGGGGCCGGGCGGGAGGTGCGGG - Intronic
1133058485 16:3159175-3159197 AGGCTCCAGTCAGGAGGCGCAGG - Intergenic
1134513812 16:14870607-14870629 AGGCCCCAGCTAGGAGGGGCAGG - Intronic
1134700068 16:16257703-16257725 AGGGCCCAACAGGGAGGTGCAGG + Intronic
1134701456 16:16269103-16269125 AGGCCCCAGCTAGGAGGGGCAGG - Intronic
1134970376 16:18525543-18525565 AGGCCCCAGCTAGGAGGGGCAGG + Intronic
1134971758 16:18536957-18536979 AGGGCCCAACAGGGAGGTGCAGG - Intronic
1137783130 16:51114542-51114564 AGGCTCCAGCCTGGAGCTCCGGG - Intergenic
1138476016 16:57271015-57271037 AGGGTCCACGCGGGAGGTGGGGG - Intronic
1139957524 16:70700245-70700267 AGGCTCCAGCCGGGGCAGGCTGG - Intronic
1140065926 16:71611162-71611184 AGGCTCAGGCTGGGAGGCGCGGG - Intergenic
1140318545 16:73923821-73923843 AGGCTCCAGGCAGTATGTGCTGG + Intergenic
1141428879 16:83960733-83960755 AGGCTCCCCCGGGGAGGTTCCGG - Exonic
1141761714 16:86033089-86033111 GGGCTCCAGCCGGCAGAGGCGGG + Intergenic
1141821036 16:86445974-86445996 AGCATGCAGCTGGGAGGTGCTGG - Intergenic
1141951997 16:87345301-87345323 AGGCTCCAGCAGGAGGGTGCGGG + Intronic
1142151299 16:88513611-88513633 AGGCTCCAGGAGGCAGGTGAGGG + Intronic
1142467888 17:146506-146528 AGGCTCGAGGCAGGAGGTGGGGG - Intergenic
1145279432 17:21457105-21457127 AGGCGCCTGCGGGGAGGGGCGGG - Intergenic
1146938080 17:36824909-36824931 AGCCTCCAGCTGGGAGTTGGTGG + Intergenic
1146970212 17:37066184-37066206 AGGCTCCTGCCGGGCAGGGCAGG + Intergenic
1147139549 17:38453689-38453711 CGCCTTCAGCCGGGAGGCGCAGG + Intronic
1149556201 17:57575156-57575178 CTGCTCCAGCCGGGGGGTGGCGG - Intronic
1151651250 17:75471133-75471155 AGGCTGCAGCAGGGAATTGCTGG + Intronic
1151715669 17:75829942-75829964 TGGCCCCAGCCAGGAGGAGCAGG + Intronic
1152941795 17:83176715-83176737 AGGCTGCACCCTGGAGGGGCAGG - Intergenic
1154004751 18:10517517-10517539 TGGCTGCAGCTGGGAGATGCGGG + Intergenic
1154041423 18:10859835-10859857 AGGCAGCAGCGGGGAGGTGGTGG + Intronic
1157232908 18:45935887-45935909 AGGAGCCAGCCTGGAGGTGTGGG - Intronic
1157301911 18:46485253-46485275 AGGCTGCAGCCTGGGGGTGGGGG + Intronic
1157568953 18:48699431-48699453 GGGCTGGAGCCGGGTGGTGCAGG + Intronic
1157674738 18:49560882-49560904 TCGCTCCAGCCGGGAGGATCCGG - Intronic
1160021481 18:75185143-75185165 AGGCACCAGCAGGCAGGTGCAGG - Intergenic
1160145474 18:76360163-76360185 AGGCTCCATCCTGGAGGCTCTGG - Exonic
1160509183 18:79443811-79443833 AGACCCCAGCCCCGAGGTGCTGG + Intronic
1160756716 19:761273-761295 AGGCTCCATCCGGGAGGTGGAGG + Intronic
1160838189 19:1134325-1134347 AGGGTCCACCCGGGAGCTGTGGG - Intronic
1161232005 19:3179115-3179137 GGGCGCCAGACGGAAGGTGCGGG - Exonic
1161617817 19:5281956-5281978 AGGCTCCCCAGGGGAGGTGCTGG - Intronic
1161672686 19:5622961-5622983 AGCCTCCCGCCGGGAACTGCCGG - Exonic
1161764319 19:6198219-6198241 AGGGTCCAGCAGGGAGGCACAGG - Intronic
1162329870 19:10021251-10021273 TGGCTCCACCAGGGAGATGCTGG - Exonic
1162381480 19:10334265-10334287 AGGCTCCAGCCGGGAGGTGCCGG - Exonic
1162449707 19:10747485-10747507 GGCCTCGAGCCGGGAGCTGCAGG + Intronic
1163469002 19:17486211-17486233 AGAGTCCAGGCTGGAGGTGCTGG + Intronic
1163551409 19:17967932-17967954 AGGCTCCTGGCGGGTGGTGATGG + Intronic
1164705170 19:30314265-30314287 AGTCTCGAGCGGGGCGGTGCGGG + Intronic
1165060425 19:33202516-33202538 AGGCTACACCTTGGAGGTGCCGG + Intronic
1165436167 19:35796783-35796805 AGGCTCCTGCGGAGAGGTGAGGG - Intergenic
1165729665 19:38136815-38136837 AGGCGAGAGCCGGGAGGAGCTGG + Intronic
1166851454 19:45763433-45763455 AGGCTCCGGCCCCGAGGTGTGGG + Intronic
1168414450 19:56159696-56159718 AGGCGCCAGCGGGGGGCTGCTGG - Exonic
925898117 2:8488687-8488709 AGGGCCCAGCTGGGATGTGCAGG + Intergenic
927267227 2:21163594-21163616 TGTCTGCAGCAGGGAGGTGCGGG - Intergenic
930720013 2:54629581-54629603 AGTCTCCAGACGTGAGGGGCAGG + Exonic
931300282 2:60972967-60972989 CTGCTGCAGCCGGGAGGTGTGGG + Intronic
932211238 2:69932450-69932472 AGGCTGCAGCAGTGAGGCGCCGG + Intronic
932508617 2:72262379-72262401 AGACTTCAGCTGGGAGGTGCAGG - Intronic
934618261 2:95788785-95788807 AGGCTACATCCCGGAGGGGCAGG + Intergenic
934642632 2:96035774-96035796 AGGCTACATCCCGGAGGGGCAGG - Intronic
934664221 2:96158616-96158638 AGGCTCCATGCAGCAGGTGCTGG + Intergenic
935349722 2:102142808-102142830 CGGCGCCGGCCGGGAGGAGCCGG + Exonic
936071528 2:109374737-109374759 CCGCTCCAGCCGGGATCTGCAGG + Intronic
936676646 2:114723362-114723384 AGGCTCCAGCAAGGAGATGATGG + Intronic
937053962 2:118915277-118915299 AGCAGCCAGCCAGGAGGTGCTGG - Intergenic
937871766 2:126791336-126791358 AGGTTCCAGGAGGCAGGTGCTGG - Intergenic
938098219 2:128477059-128477081 AGGGTCCCTTCGGGAGGTGCTGG + Intergenic
938406968 2:131038221-131038243 AGGCTGCAGGAGGGAGGGGCTGG - Intronic
938406990 2:131038312-131038334 AGGCTGCAGGAGGGAGGGGCTGG - Intronic
938407047 2:131038525-131038547 AGGCTGCAGGAGGGAGGGGCTGG - Intronic
943739737 2:191397783-191397805 ACGCCCCATCCGGGAGGTGAGGG - Intronic
946193467 2:218019933-218019955 AGGCTGCAGCCGGGGAGTGGGGG - Intergenic
948993419 2:241565660-241565682 AGGCCCCAGCCCTGAGGTGCGGG - Intronic
1168862383 20:1055086-1055108 AGGCCCCAGCCTAGAGATGCTGG - Intergenic
1169191193 20:3660147-3660169 AGCCTCCTGCAGGTAGGTGCAGG - Exonic
1170150051 20:13220027-13220049 AGGCTCCATCCCGGAGGCACTGG + Intergenic
1171268987 20:23798830-23798852 TGGATCCAGCCTGGAGGTTCAGG + Intergenic
1171415833 20:24979838-24979860 AGGACCCAGCAGGGAGGGGCTGG - Intronic
1172035946 20:32010782-32010804 AGGCTGCAGGAGGGAGCTGCGGG - Intronic
1172585982 20:36085177-36085199 AGGGTCCAGGCTGAAGGTGCAGG + Intergenic
1173953621 20:47013185-47013207 AGGCTCCAGGAGGGCGGGGCTGG - Intronic
1175121095 20:56716923-56716945 GGGCTCCAGCAGGGAGAGGCCGG - Intergenic
1175361146 20:58413736-58413758 CGGCCCCACCCGGGAGGTGACGG - Intronic
1175768398 20:61606884-61606906 AGGCTACCGCCGGGATGTCCTGG + Intronic
1175889153 20:62308484-62308506 TGGCTCTGGCCTGGAGGTGCAGG - Intronic
1175975494 20:62708598-62708620 AGGCTGCACCCGGGCGGGGCGGG + Intergenic
1176010171 20:62889182-62889204 CGGTGCCATCCGGGAGGTGCTGG + Intronic
1176108605 20:63401032-63401054 AGGCGCCAGCAAGGAGGGGCCGG - Intergenic
1176264715 20:64203150-64203172 AGGCTGGGGCCGGAAGGTGCAGG + Intronic
1177148360 21:17430278-17430300 AGGCCACAGCCTGGAAGTGCAGG + Intergenic
1179906186 21:44424451-44424473 AGGCTCCTCCTGGGAGGTGCAGG + Intronic
1180935486 22:19622554-19622576 AGGCTCCAGCTGGAAGCTGCTGG - Intergenic
1183068662 22:35381160-35381182 ACGCTCCATCCGGCCGGTGCTGG - Exonic
1183286225 22:36965906-36965928 AGCCTCCAGCCGGGCAGTGGGGG - Intergenic
1183343339 22:37294129-37294151 AGACACCAGCCGGGAGAGGCAGG + Intronic
1183392605 22:37554056-37554078 AGGCTTCAGCAGAGAGGTGGAGG - Intergenic
1183500451 22:38175676-38175698 AGGCTGCAGGGCGGAGGTGCGGG - Intronic
1184099808 22:42336164-42336186 ACGCTCCAGCCGGGATCTGTTGG + Intronic
1184208319 22:43019738-43019760 AGGCTCCAGCCGGGCATGGCAGG - Intergenic
1184301937 22:43566584-43566606 AAGCTCCTGCCAGCAGGTGCTGG + Intronic
1184661576 22:45967866-45967888 AGGCTCCAGCCAGCAGTTGGAGG - Intronic
1184679171 22:46061327-46061349 AGGCTCCGGCCGGGCGGGCCCGG - Intronic
1185080302 22:48706028-48706050 GGGCTGCAGACGGGAGGTGGGGG + Intronic
1185086126 22:48742066-48742088 AGGCTCCAGCTGGGAGGCTGTGG + Intronic
950016434 3:9757774-9757796 GGGCACCAGCCAGGAGGGGCAGG - Exonic
951718678 3:25674840-25674862 TGGCCCCAGTGGGGAGGTGCAGG - Intergenic
954003841 3:47577717-47577739 AGCTTCCAGCCAGGCGGTGCCGG + Exonic
954326953 3:49869148-49869170 ATGTTCCTGCTGGGAGGTGCGGG - Intronic
954332253 3:49897308-49897330 AGGCACCAGCCGGGCTGTGCTGG - Exonic
954648422 3:52145239-52145261 AGGCTCCAGGTGGGAGTTGGAGG - Intronic
958435578 3:94091889-94091911 TGGCTCCAGCCACGAGGTGAGGG - Intronic
959932511 3:111999446-111999468 TGGCTTAAGCCGAGAGGTGCAGG + Exonic
961430134 3:126875425-126875447 AGCCTCTAGCTGGCAGGTGCTGG + Intronic
961491407 3:127258974-127258996 AGCCTCCATCCTGGAGTTGCTGG - Intergenic
962804690 3:138918293-138918315 AGGCTGTACCCGGGAGGTGGAGG - Intergenic
962954131 3:140248460-140248482 AGGCTCTAGCAGGGATGTGGGGG + Intronic
966188749 3:177251989-177252011 AGCCTCCACCTGGGAGGTGGAGG - Intergenic
966889799 3:184398653-184398675 AGGCATCAGCCAGCAGGTGCAGG - Intronic
968746092 4:2361371-2361393 TGGCTGCAGGTGGGAGGTGCGGG + Intronic
972882635 4:43445300-43445322 AGGCTCCAGCCAGGTGGTTTAGG + Intergenic
973627828 4:52790623-52790645 AGGCACCAGGCTGGATGTGCGGG - Intergenic
978620734 4:110632709-110632731 CGGTTCCAGCCGGGAGGAGTAGG + Intronic
979967128 4:127088662-127088684 AGGCCCCAGCTGGGAGGACCTGG - Intergenic
981154923 4:141423700-141423722 TGGCTCCTGTCGGGAGGTGGGGG - Intergenic
981770139 4:148299518-148299540 CAGCTCCAGCCAGGAGGTGAGGG - Intronic
982338856 4:154272466-154272488 AGGCACCAGGTGGGAGGTGATGG + Intronic
985659973 5:1152155-1152177 AGGGTCCAGCTGGGAGGTGATGG - Intergenic
985774547 5:1833971-1833993 AGGGAGCAGCCGGGAGGTGGAGG - Intergenic
986200362 5:5573554-5573576 AGGCTCCAGCCCGGAGGGAGAGG - Intergenic
986203353 5:5599746-5599768 AGGTTCCAGCCTGGAGATGATGG - Intergenic
992162320 5:74015453-74015475 AGGCACCAGCAGGAAGGTGGAGG - Intergenic
994092878 5:95824232-95824254 AGGCCCCTGCCAGGAGGTCCAGG + Intronic
1001234760 5:170020101-170020123 AGGCTGGAGCCGGGAGGGCCGGG - Intronic
1001315021 5:170635890-170635912 AGACACAGGCCGGGAGGTGCAGG + Intronic
1001852435 5:174981144-174981166 AGGCTCCAGCCCTGGGGTGGGGG - Intergenic
1003060311 6:2857680-2857702 AGGCTGCAGGCGGGAGAGGCCGG + Intergenic
1003529430 6:6925537-6925559 AGGGTCCTGCCAGGAGGGGCAGG + Intergenic
1005069500 6:21851321-21851343 ACGCCCCATCCGGGAGGTGAGGG - Intergenic
1005102761 6:22191228-22191250 AGTCTCCAGCAGGGAGGAGGAGG + Intergenic
1005917929 6:30370430-30370452 AGGCTGCAGCTGGGAGGTCAGGG - Intergenic
1005957277 6:30672913-30672935 AGGCTCCAGCCGAGGGCTCCAGG - Exonic
1006364978 6:33610009-33610031 AGGGTCCAGGCAGCAGGTGCTGG - Intergenic
1007409171 6:41651852-41651874 GGGCACCAGCTGGGAGGTGGTGG - Intronic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1009289798 6:61868407-61868429 AGGCTCCAGTTGGGAGATCCCGG + Intronic
1010327137 6:74577594-74577616 AGGCTCCAGCCCTGAGATGCAGG - Intergenic
1015298694 6:131628400-131628422 CTTCTCCAGCCGGGAGGTGGCGG - Intergenic
1015997852 6:139013457-139013479 AGGCTGGAGCTGGGAGGAGCAGG + Intergenic
1017352697 6:153460589-153460611 AGGGTCCATCTGGGAGGTGGTGG + Intergenic
1018144801 6:160875855-160875877 AGGGTCCAGCTGGGAGGTGGTGG - Intergenic
1018670651 6:166174086-166174108 AGGCTGCAGCCTGGAGGTAATGG + Intergenic
1018876375 6:167826326-167826348 TGGTTCCAGACGGGCGGTGCTGG - Intergenic
1019295514 7:272051-272073 AGGCCCCTGCAGGGAGGAGCGGG + Intergenic
1019295550 7:272182-272204 AGGCCCCTGCAGGGAGGAGCGGG + Intergenic
1019480159 7:1262711-1262733 AGGCCCCAGCCCGGAGTTGCTGG + Intergenic
1019611229 7:1937621-1937643 CGCCCCCAGCAGGGAGGTGCAGG + Intronic
1019728564 7:2617096-2617118 GGGATCCAGTGGGGAGGTGCTGG - Intergenic
1019737556 7:2658234-2658256 AGGCCCCAGCAGGAAGGAGCTGG - Intronic
1019888031 7:3922272-3922294 AGGATTCAGTCGGGATGTGCTGG + Intronic
1021615620 7:22500151-22500173 CCGCTGCTGCCGGGAGGTGCCGG + Exonic
1024001228 7:45190605-45190627 AGGCTCCTGTCAGGAGGTTCAGG - Intergenic
1024782319 7:52865429-52865451 AGGCTCCAGACAGTAGGTTCAGG - Intergenic
1024942832 7:54780071-54780093 AGCTTCCAGCTGGGAGGAGCGGG + Intergenic
1025227598 7:57178362-57178384 AGGCCCCACCCTGGACGTGCTGG - Intergenic
1026727274 7:72879581-72879603 AGGGGCCAGGCGGGAGGTGGTGG + Exonic
1026915922 7:74120475-74120497 ATGCCCCGGCCGGGAGGTCCAGG - Intronic
1033656986 7:143381307-143381329 AGCCTCCAGCCGGGCGGGGAGGG - Exonic
1034930101 7:155154742-155154764 AGGCTGCAGCAGGGACGTGCTGG + Intergenic
1034940421 7:155226910-155226932 GGGCATCAGCTGGGAGGTGCTGG - Intergenic
1035566313 8:643537-643559 AGGGCCCAGCCGGCAGGGGCAGG - Intronic
1035926482 8:3733591-3733613 AGGATGCAGCAGGGCGGTGCAGG - Intronic
1036781558 8:11651334-11651356 AGGCTCCAGCCCAGACTTGCTGG - Intergenic
1037547651 8:19939816-19939838 AGGCTCCGCCGGGGAGGTTCCGG + Intronic
1037819810 8:22130203-22130225 AAGCCCCAGGCGGGAGGTGACGG + Intronic
1038744632 8:30246516-30246538 ACGCCCCATCCGGGAGGTGAGGG - Intergenic
1039982070 8:42416199-42416221 AGGACCCAGCAGGGAAGTGCAGG - Intergenic
1040109867 8:43562496-43562518 AGGGTCCACCGGGAAGGTGCTGG + Intergenic
1040480053 8:47817228-47817250 ACGCTGCTGTCGGGAGGTGCTGG - Intronic
1044450964 8:92335564-92335586 AGGCTGCAGCTGGGAGGACCTGG + Intergenic
1049006089 8:139856476-139856498 AGGCTGCAGCGGGGAGCTGGTGG - Intronic
1049372580 8:142274792-142274814 TGGCTCCAGCCAGGAGCTGGCGG + Exonic
1049378581 8:142301123-142301145 AGGCTCCTGGCGGGAGGTGAAGG - Intronic
1051629601 9:19129025-19129047 TGGCTCCAGCCAGGAGGGACTGG + Intronic
1057695005 9:97316958-97316980 AGGCTGGAGAGGGGAGGTGCAGG - Intronic
1057818827 9:98315736-98315758 AGGGTCCAGCCTGGTGGTGGTGG + Intronic
1058893918 9:109383764-109383786 AGGCTGCAGCCTGGAGGAGGAGG + Intronic
1059287361 9:113186298-113186320 GGGCTGCAGCTGGGAGGTGACGG + Exonic
1059437154 9:114283841-114283863 AGCCTTCAGCTGGGAGGTGGTGG - Intronic
1059697341 9:116741683-116741705 AACCTCAAGCTGGGAGGTGCTGG + Intronic
1059760845 9:117336140-117336162 AGGCCTCAGACAGGAGGTGCTGG + Intronic
1060587427 9:124795243-124795265 AGACTCCAGCCAGGAGCTGGGGG + Intronic
1060877546 9:127094017-127094039 AGGCTCCAGCTGGGAGCCACAGG + Intronic
1061258077 9:129464323-129464345 AGGCCCCAGCCAGGAGCTGAGGG - Intergenic
1061414014 9:130436183-130436205 AGGGTCCAGCCAGGAGGTTGGGG + Intergenic
1061425686 9:130496905-130496927 AGCCTCCAGGAGGGAGGGGCTGG - Intronic
1061881300 9:133570563-133570585 AGGCTTGAGGCGGGAGGGGCGGG - Intronic
1061911438 9:133727317-133727339 GGGCTCCAGCTGGCAGGTGAGGG - Intronic
1062371632 9:136242289-136242311 AGCCTCCAGCTGGAAGGAGCAGG - Intronic
1062392624 9:136339998-136340020 AGGCACCAGCTGGGGGCTGCAGG - Intronic
1062462593 9:136668133-136668155 AGGCTCCAGCGGAGATGAGCTGG + Intronic
1203781593 EBV:104046-104068 AGGCCTCTGCCGGGAGGTGCTGG + Intergenic
1187915651 X:24150115-24150137 AGGCTGCAGGCGTGAGGTGAAGG + Intronic
1190360710 X:49645573-49645595 TGGCTACAGCCGGGAGGCACAGG - Intergenic
1190803413 X:53813463-53813485 AGGCCCCAGCTGGGAGGACCCGG + Intergenic
1193769454 X:85571832-85571854 ATGCTCCAGCAGGGTGGTGATGG - Intergenic
1194379195 X:93174439-93174461 TGGCTGTAGCAGGGAGGTGCAGG + Intergenic
1198110140 X:133495858-133495880 AGGCTCCAGCCAGGAGGGACTGG - Intergenic
1198696040 X:139339362-139339384 GGACTCCAGCCAGGAGGTGGTGG + Intergenic
1199851004 X:151724889-151724911 AGGCTGCAGCTGGGAAGGGCTGG + Intergenic
1199968508 X:152841022-152841044 AGGCTGCAGCCTGGAGGGGGAGG - Intronic
1200102074 X:153693193-153693215 AGGCTGCAGCAGGGCGCTGCGGG + Intronic
1200167406 X:154046345-154046367 AAACTCCAGCTGGGAGGTGCAGG + Intronic
1200371387 X:155728527-155728549 AGGCTGCAGCCTGGAGGGGGAGG - Intergenic
1200418333 Y:2935754-2935776 AGGCTGCAGGCGTGAGGTGAAGG + Exonic