ID: 1162381492

View in Genome Browser
Species Human (GRCh38)
Location 19:10334305-10334327
Sequence CTCGGGGTACGGGTTGCCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162381487_1162381492 -7 Left 1162381487 19:10334289-10334311 CCTTCAAACACCGCAGCTCGGGG 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1162381492 19:10334305-10334327 CTCGGGGTACGGGTTGCCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 56
1162381482_1162381492 8 Left 1162381482 19:10334274-10334296 CCCGGCTGGAGCCTTCCTTCAAA 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1162381492 19:10334305-10334327 CTCGGGGTACGGGTTGCCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 56
1162381484_1162381492 -3 Left 1162381484 19:10334285-10334307 CCTTCCTTCAAACACCGCAGCTC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1162381492 19:10334305-10334327 CTCGGGGTACGGGTTGCCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 56
1162381476_1162381492 22 Left 1162381476 19:10334260-10334282 CCCCACCGGCACCTCCCGGCTGG 0: 1
1: 0
2: 2
3: 15
4: 229
Right 1162381492 19:10334305-10334327 CTCGGGGTACGGGTTGCCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 56
1162381478_1162381492 21 Left 1162381478 19:10334261-10334283 CCCACCGGCACCTCCCGGCTGGA 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1162381492 19:10334305-10334327 CTCGGGGTACGGGTTGCCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 56
1162381480_1162381492 17 Left 1162381480 19:10334265-10334287 CCGGCACCTCCCGGCTGGAGCCT 0: 1
1: 0
2: 4
3: 24
4: 276
Right 1162381492 19:10334305-10334327 CTCGGGGTACGGGTTGCCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 56
1162381479_1162381492 20 Left 1162381479 19:10334262-10334284 CCACCGGCACCTCCCGGCTGGAG 0: 1
1: 0
2: 2
3: 17
4: 250
Right 1162381492 19:10334305-10334327 CTCGGGGTACGGGTTGCCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 56
1162381483_1162381492 7 Left 1162381483 19:10334275-10334297 CCGGCTGGAGCCTTCCTTCAAAC 0: 1
1: 0
2: 0
3: 22
4: 140
Right 1162381492 19:10334305-10334327 CTCGGGGTACGGGTTGCCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 56
1162381481_1162381492 11 Left 1162381481 19:10334271-10334293 CCTCCCGGCTGGAGCCTTCCTTC 0: 1
1: 1
2: 1
3: 22
4: 243
Right 1162381492 19:10334305-10334327 CTCGGGGTACGGGTTGCCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162381492 Original CRISPR CTCGGGGTACGGGTTGCCCC TGG Exonic
900540649 1:3201030-3201052 CTCCGGCTAAGGGTTGACCCTGG - Intronic
901054763 1:6443990-6444012 CTCGGGGTAAGGGTGGGGCCTGG - Intronic
903927751 1:26842931-26842953 CTGGGGGTATAGGCTGCCCCAGG + Intronic
908241868 1:62195020-62195042 CGTGGGGTCCGGGGTGCCCCGGG + Intronic
908241886 1:62195060-62195082 CGTGGGGTCCGGGGTGCCCCGGG + Intronic
1062837372 10:644593-644615 GTGGGGGTGGGGGTTGCCCCCGG - Intronic
1071315273 10:84389501-84389523 TTCGAGGTACTGGTTGCCCTGGG + Intronic
1075006469 10:118833977-118833999 CTTGGGGTAGGGGTAGACCCAGG + Intergenic
1078659875 11:13278019-13278041 TTCGGCGGCCGGGTTGCCCCCGG - Intronic
1083993067 11:66258307-66258329 CTCAGTGTCCGGGTTTCCCCGGG - Intronic
1084022565 11:66426369-66426391 CTCAGGGCACGGGCTGGCCCGGG - Exonic
1084347611 11:68565785-68565807 CTCGGAGTACCGTTTGCACCTGG + Intronic
1094474272 12:30829235-30829257 CTCAGGGTGGGGGTTGCACCAGG - Intergenic
1103477468 12:121229279-121229301 CTCGGGGGCCGGGATGGCCCCGG - Intronic
1104493910 12:129218982-129219004 CTGGGGTTACAGGTTTCCCCGGG + Intronic
1122142787 14:99672831-99672853 CTGGGGGAAGGGGATGCCCCAGG + Intronic
1123948614 15:25250834-25250856 CTTGGGGTGGGGGTTGCCCTTGG + Intergenic
1127988396 15:64093395-64093417 CTCTGGGTTCGGCTTGCCCCAGG + Intronic
1139949977 16:70663968-70663990 CTCTGGGGATGGGCTGCCCCAGG + Exonic
1139952937 16:70680755-70680777 CTGGAGGTTGGGGTTGCCCCAGG - Intronic
1142292823 16:89200672-89200694 CTCGGGGTAAAGGCTGCCTCAGG + Intronic
1151413907 17:73949052-73949074 CTCTGGGTACAGGCTGTCCCTGG - Intergenic
1155054207 18:22170615-22170637 CTCGGGGTGAGGGTTCCCCACGG - Intronic
1155130918 18:22933653-22933675 CCCGGGGTAGGGGTGGCTCCCGG + Intronic
1160684029 19:425176-425198 CTCGTGGTCCGGGGGGCCCCGGG + Exonic
1161614983 19:5265081-5265103 CTCAGGGTCAGGGTTGCCGCTGG + Exonic
1162381492 19:10334305-10334327 CTCGGGGTACGGGTTGCCCCTGG + Exonic
1163103294 19:15109928-15109950 CTCGGGCTCCGGGTGCCCCCAGG - Exonic
1163798346 19:19349846-19349868 CTCAGGGTACAAGTGGCCCCTGG + Intronic
1166960381 19:46493247-46493269 TTGGGGGCCCGGGTTGCCCCCGG - Exonic
1168318135 19:55493193-55493215 CTAGGGGGAGGGGTTGCCACTGG + Intronic
929127744 2:38536336-38536358 CTCGGGTGACCGGTTACCCCCGG - Intergenic
948237128 2:236399725-236399747 CTCGGGGCATGGGGTACCCCAGG - Intronic
1171388535 20:24786471-24786493 CTCGGGGGACGGGGAGGCCCTGG - Intergenic
1175162470 20:57019211-57019233 CTGGGGGTGGGGGTTGCCCCTGG - Intergenic
1176178432 20:63739190-63739212 CTTGGGGGACTGGCTGCCCCCGG + Intronic
1181108101 22:20586475-20586497 CTCTGGGAAGGGGTAGCCCCAGG - Intronic
953022585 3:39125172-39125194 CTGGGGGTATGGGTTGCTCCAGG + Intronic
954289995 3:49644591-49644613 CTCGGGGAAAGGGGTGCACCAGG + Intronic
969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG + Intronic
969650161 4:8461610-8461632 CTCGGGGTAGGGTCTTCCCCAGG - Intronic
969690561 4:8701871-8701893 CTCGGGGCAGTGGGTGCCCCTGG - Intergenic
985672072 5:1212256-1212278 CTCAGGGTACGGGTCCCCCAAGG - Intronic
1019008820 6:168825626-168825648 CTCGGGGTGAGGGTGGCCCGTGG - Intergenic
1019439950 7:1040975-1040997 CTCTGGCTTCGGGTTGACCCCGG - Intronic
1019475331 7:1241563-1241585 CTCGGGGTGCGGGCAGCCCTCGG - Intergenic
1019989851 7:4683231-4683253 CTTGGGGTATGGGTGGCTCCAGG - Intronic
1023633348 7:42184739-42184761 CTGGGGGTGAGGGCTGCCCCAGG - Intronic
1023756183 7:43419147-43419169 CTGGTGGTGCTGGTTGCCCCAGG + Intronic
1024862507 7:53861948-53861970 CTGGGGGTGGGGGTTGCCCATGG + Intergenic
1033967111 7:146989373-146989395 CACTGGATACAGGTTGCCCCAGG + Intronic
1043444312 8:80304374-80304396 GTTGGGGTAGGAGTTGCCCCAGG + Intergenic
1048288371 8:133160737-133160759 CTCTGAGTACTGGCTGCCCCAGG - Intergenic
1049519520 8:143080825-143080847 CTGGGGGTGGGGGTTGCCCTCGG + Intronic
1049756167 8:144312154-144312176 CTCGGTGTCCGTGTGGCCCCTGG - Exonic
1060408604 9:123385110-123385132 CTAGAGGTAAGGGTTGACCCAGG - Intronic
1061900767 9:133670921-133670943 CTCGGGGGAGCGGTCGCCCCAGG - Intronic
1062290797 9:135793520-135793542 CTGGGGGTCAGGGCTGCCCCAGG + Intergenic
1185857696 X:3551068-3551090 CTGGGGCTAAGGGTTTCCCCAGG + Intergenic
1196339528 X:114581716-114581738 CTCGGGGTACCGGGTTCCGCCGG - Intergenic