ID: 1162382344

View in Genome Browser
Species Human (GRCh38)
Location 19:10339027-10339049
Sequence CTGTCTCGGCACAAGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162382344_1162382350 5 Left 1162382344 19:10339027-10339049 CCTCTCTCCTTGTGCCGAGACAG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1162382350 19:10339055-10339077 TTCCTGCCTTCATGGTCCAGTGG 0: 1
1: 0
2: 2
3: 19
4: 224
1162382344_1162382351 6 Left 1162382344 19:10339027-10339049 CCTCTCTCCTTGTGCCGAGACAG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1162382351 19:10339056-10339078 TCCTGCCTTCATGGTCCAGTGGG 0: 1
1: 0
2: 1
3: 11
4: 156
1162382344_1162382354 11 Left 1162382344 19:10339027-10339049 CCTCTCTCCTTGTGCCGAGACAG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1162382354 19:10339061-10339083 CCTTCATGGTCCAGTGGGAAAGG 0: 1
1: 0
2: 0
3: 18
4: 170
1162382344_1162382349 -3 Left 1162382344 19:10339027-10339049 CCTCTCTCCTTGTGCCGAGACAG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1162382349 19:10339047-10339069 CAGAAGGGTTCCTGCCTTCATGG 0: 1
1: 1
2: 4
3: 39
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162382344 Original CRISPR CTGTCTCGGCACAAGGAGAG AGG (reversed) Intronic
900507337 1:3036329-3036351 CTGGCTGGGCACATGGAGTGAGG + Intergenic
903785051 1:25855230-25855252 CTGTCTGTGCTCAAGGAAAGGGG + Intronic
903954733 1:27017522-27017544 CTGTCCAGGCACAGGGAGATGGG - Intergenic
904722739 1:32522843-32522865 CTGTCTCGGGGCAGGGGGAGTGG - Intronic
905567662 1:38978613-38978635 CTGTCACGGGACATAGAGAGGGG + Intergenic
907010129 1:50954995-50955017 CTGTCTCGCCAAAAAGAAAGAGG + Intronic
917496850 1:175548249-175548271 CTGTCCTGGGAAAAGGAGAGTGG - Intronic
919544903 1:198903432-198903454 CTGTCTAGGCACTGGGGGAGGGG + Intergenic
919823053 1:201484867-201484889 CTGGCTGGGCACTAGGAGTGGGG - Intronic
923681729 1:236124017-236124039 CTGTCTGTGACCAAGGAGAGTGG + Intergenic
924696643 1:246407448-246407470 ATGTTTTGGCACTAGGAGAGCGG - Intronic
1065784823 10:29203430-29203452 CTGTCTCGAAAGAAAGAGAGAGG + Intergenic
1070418074 10:76208738-76208760 CTGGATAGGCACAAGCAGAGGGG - Intronic
1071074350 10:81732995-81733017 CTGCCTTGTCACAAGGACAGAGG - Intergenic
1071450855 10:85790523-85790545 CTGTCTGGGCAGAGGGAGTGGGG + Intronic
1074607638 10:114989483-114989505 ATGTCTCAGCTCAAGCAGAGAGG - Intergenic
1075338966 10:121630259-121630281 CTGTCTCGGAAGAAGGAAGGAGG + Intergenic
1076175097 10:128362334-128362356 CTGACTCTGAACAAGGAGAGAGG + Intergenic
1076294648 10:129375215-129375237 CCCTCTCGGCAGAGGGAGAGAGG + Intergenic
1077227601 11:1445173-1445195 CGGGCTGGGCACAGGGAGAGTGG + Intronic
1077442029 11:2573355-2573377 CTGGCAGGGCCCAAGGAGAGCGG + Intronic
1078113904 11:8426045-8426067 CTGCCTCATCACAAGGACAGAGG + Intronic
1080994255 11:37580802-37580824 CTGTGTGGGCAAAAGGAAAGAGG + Intergenic
1081232903 11:40607735-40607757 CTGCCTCATCACAAGGAGAGAGG - Intronic
1082708650 11:56525752-56525774 CTGTCGTGGCAGAAGGAGAAAGG + Intergenic
1084696310 11:70757646-70757668 CTGTGTCCCCTCAAGGAGAGAGG + Intronic
1084911742 11:72395215-72395237 CTTTCTGAGAACAAGGAGAGTGG + Intronic
1086395681 11:86412951-86412973 CTGTCTTATCACAAGGAGAGAGG + Intronic
1087618816 11:100519341-100519363 CTGTCATGGCAGAAGGTGAGGGG + Intergenic
1089295763 11:117466670-117466692 CTGTCTCAACAAAAGGAGGGTGG + Intronic
1090022675 11:123141528-123141550 CTGTCACAGCACAAGGAAGGAGG - Intronic
1091908756 12:4211774-4211796 CTGCCTGGGCCCAAGCAGAGGGG + Intergenic
1093165935 12:15804357-15804379 CTCTCTCTTTACAAGGAGAGGGG - Intronic
1093503296 12:19836490-19836512 CTGCCTGGTCACAAGGACAGAGG - Intergenic
1093993709 12:25618569-25618591 CAGTCTCATCACAAGGAGAAAGG - Intronic
1094325940 12:29239178-29239200 CTGCCTGTTCACAAGGAGAGGGG + Intronic
1097017379 12:55997149-55997171 CTGTCTCGGCTCCAGGAGGCGGG + Intergenic
1097149874 12:56968791-56968813 CTATCTCGGCACAGGGAGTGTGG + Intergenic
1097691523 12:62738848-62738870 CTGCCTCTGCACTGGGAGAGAGG - Intronic
1106235343 13:27856493-27856515 CTACCTCGTCACAAGGACAGAGG + Intergenic
1109089382 13:58020907-58020929 CTGTCTTGTTACAAGGAGAACGG - Intergenic
1109711366 13:66165032-66165054 CTGCCTTGTCACAAGGACAGAGG + Intergenic
1117336947 14:54764028-54764050 CTGTCTCTGCACCTGGCGAGGGG + Intronic
1127187342 15:56493222-56493244 CTGACTCTGCCAAAGGAGAGTGG + Intergenic
1128769079 15:70268492-70268514 GGGTCTCAGGACAAGGAGAGTGG - Intergenic
1130199558 15:81812208-81812230 ATGTCTAGCCACAAGGAAAGTGG + Intergenic
1131438110 15:92438993-92439015 TTGTCTCACTACAAGGAGAGTGG + Intronic
1132015455 15:98312497-98312519 CTGTGTGGACACTAGGAGAGGGG - Intergenic
1138165477 16:54797462-54797484 ATGTCTCAGCTCAAGGAAAGAGG + Intergenic
1140107382 16:71973180-71973202 CTGCCTGGGCAAAAGGAGGGAGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1142201010 16:88761175-88761197 CTGTCTCTGCCCAGGGAGCGGGG + Intronic
1144812352 17:18008612-18008634 CTGTCTGGGCCCCAGGACAGAGG - Intronic
1152847964 17:82614128-82614150 CCGTCCCGACACAGGGAGAGAGG + Intronic
1153321562 18:3778872-3778894 CTGGCTGGGGCCAAGGAGAGAGG - Intronic
1153773778 18:8435422-8435444 CTGCCTTATCACAAGGAGAGAGG - Intergenic
1154176769 18:12091355-12091377 CTGTCTAGGGACAGGGAGTGGGG + Intergenic
1156397282 18:36709527-36709549 GTGTCTGGGGACAAGGAGTGTGG + Intronic
1160510027 18:79448247-79448269 CTGCCTCTGCAGGAGGAGAGGGG + Intronic
1162382344 19:10339027-10339049 CTGTCTCGGCACAAGGAGAGAGG - Intronic
1164063541 19:21695167-21695189 CTCTCTCAGCAGGAGGAGAGGGG + Intergenic
1164649087 19:29879294-29879316 CAGCCTCAGCTCAAGGAGAGGGG - Intergenic
1168182503 19:54671842-54671864 CTGTCATGGCCCATGGAGAGAGG + Intronic
926218297 2:10918960-10918982 CTGTCTCCGCACAGGCAGACAGG - Intergenic
929588521 2:43130830-43130852 CCCCCTCTGCACAAGGAGAGAGG + Intergenic
930015219 2:46965409-46965431 CTGTCTTGGCCCCAGGTGAGAGG + Intronic
933723762 2:85414464-85414486 CTGTCGCGGCACCTGGAGTGCGG + Intronic
935486631 2:103663988-103664010 GTGCCTAGGCTCAAGGAGAGAGG + Intergenic
935543642 2:104378147-104378169 CTATCTTGTCACAAGGACAGAGG + Intergenic
936498993 2:113051125-113051147 CTGGCCCGGCACACTGAGAGCGG + Intronic
944017139 2:195054824-195054846 CTGTCTGTACTCAAGGAGAGGGG + Intergenic
946301727 2:218828145-218828167 GTGTCTCAGCACAAGGACACTGG - Intronic
1170367616 20:15615261-15615283 CTCTCTCTTCACATGGAGAGGGG - Intronic
1170648306 20:18216144-18216166 CTGTCTCTTCACAAGGAGAAGGG - Intergenic
1171029428 20:21663977-21663999 CTGTCTCGAAAAAAGGAGGGAGG - Intergenic
1173150415 20:40562218-40562240 CTGTCTGGGGACAAGCAGACAGG - Intergenic
1177639887 21:23833105-23833127 CTATCTTGTCACAAGGACAGAGG + Intergenic
1178787088 21:35663762-35663784 TTGTCTAGGCAAGAGGAGAGAGG - Intronic
1178793473 21:35721993-35722015 CAGTGTAGCCACAAGGAGAGAGG - Intronic
1183606908 22:38871508-38871530 CTGTATGGGCCCAAGAAGAGGGG - Exonic
952562300 3:34609259-34609281 CTGTTTAGGCAAAAGGTGAGGGG + Intergenic
955480593 3:59385557-59385579 CTGTCTTATCACAAGGACAGAGG - Intergenic
956274111 3:67479507-67479529 CTGTCTGGGGAAAAGGACAGTGG - Intronic
959419971 3:106117115-106117137 CTGCCTTGTCACAAGGACAGAGG + Intergenic
962902661 3:139774758-139774780 AGGTCTCGGCACCAGGAGACTGG + Intergenic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
965799556 3:172477526-172477548 CTGTCTGGTTTCAAGGAGAGAGG + Intergenic
969624640 4:8296197-8296219 CTGTCTCAGGAGAAAGAGAGAGG - Intronic
971958403 4:33453649-33453671 TGGTCTCTGCACAAGAAGAGTGG - Intergenic
981198015 4:141943064-141943086 GGATCTCTGCACAAGGAGAGTGG - Intergenic
981423828 4:144581222-144581244 CTGTCTTATCACAAGGACAGTGG - Intergenic
981726000 4:147847992-147848014 TTGGCTTGGCCCAAGGAGAGGGG + Intronic
983396492 4:167204196-167204218 ATGTCGTGGCACAAGGAGGGTGG + Intronic
985421122 4:189786140-189786162 CTTTCTGGGAACAAGGAGAGAGG - Intergenic
985679166 5:1246930-1246952 CTGACTCGCCACACGGAGGGAGG + Intergenic
986087751 5:4468612-4468634 CTGACTCAGCAGGAGGAGAGAGG - Intergenic
987411670 5:17620960-17620982 CAGGCTCAGCCCAAGGAGAGGGG - Intergenic
991950889 5:71945946-71945968 CAGTGTGGCCACAAGGAGAGGGG + Intergenic
994329211 5:98486567-98486589 TAGTCTCTGCACAAGGAGAGAGG + Intergenic
997692050 5:135833695-135833717 CTGCCCCGGCACACAGAGAGTGG - Intergenic
998174565 5:139893921-139893943 CTGGCTTGGCACCAGGAGATAGG - Intronic
999695614 5:154186239-154186261 CTGCTTTAGCACAAGGAGAGGGG + Intronic
1001175962 5:169469148-169469170 CTCTGTCAGCACAAAGAGAGTGG + Intergenic
1003753755 6:9092797-9092819 TTGTCTTGGCACAAAGAGATTGG - Intergenic
1015281991 6:131443636-131443658 CTGTCTCTCCAGGAGGAGAGTGG - Intergenic
1017599707 6:156067398-156067420 CTGTCTCTGGACAAGCAAAGAGG + Intergenic
1017617727 6:156262881-156262903 CTGTCTGGGCCAAAGCAGAGAGG + Intergenic
1017897106 6:158690089-158690111 AGGGCTGGGCACAAGGAGAGTGG - Intronic
1018965102 6:168478932-168478954 CTGTCTCGGGAAAAGGAGTCAGG + Intronic
1018965113 6:168479007-168479029 CTGTCTCGGGAAAAGGAGTCAGG + Intronic
1018965125 6:168479082-168479104 CTGTCTCGGGAAAAGGAGTCAGG + Intronic
1019508224 7:1404116-1404138 CTGCCTGGGAACACGGAGAGGGG - Intergenic
1031990837 7:128197894-128197916 GTGTCTGGGGACAGGGAGAGGGG - Intergenic
1032410407 7:131690120-131690142 CTGTCTTGGCACATGGAGGGAGG + Intergenic
1033892816 7:146036386-146036408 GTGTCTCTGCACAAGTAGACTGG + Intergenic
1034252957 7:149706802-149706824 CTGGCTAGGCACTAGGAGTGCGG - Intergenic
1034621447 7:152460293-152460315 CTATTTCGTGACAAGGAGAGTGG - Intergenic
1034700933 7:153095128-153095150 CAGTCACGGCAGAAGGAGAAAGG + Intergenic
1035595453 8:854022-854044 CTGTCTCTGGACCAGGAAAGAGG + Intergenic
1037807760 8:22067778-22067800 CTGCCTCGGCAAAACAAGAGAGG + Intronic
1040351819 8:46576619-46576641 CTGACCAGGCTCAAGGAGAGAGG + Intergenic
1041212414 8:55565856-55565878 CAATCTCTGAACAAGGAGAGGGG - Intergenic
1041948148 8:63470147-63470169 CAGTCTCAGCAGAAAGAGAGAGG + Intergenic
1042020192 8:64364707-64364729 CTTTCCCGGCACAAGGAGACTGG + Intergenic
1043518249 8:81016754-81016776 CAGTCTAGACACAAGGAGTGGGG - Intronic
1049501339 8:142968881-142968903 CTATCTCGGCACAGAGAGTGTGG + Intergenic
1049783004 8:144437325-144437347 CTGTCTCCCCACAAGGGGACCGG - Intronic
1052398648 9:27972981-27973003 ATGTCTCAGCTCAAGAAGAGAGG - Intronic
1052767028 9:32651339-32651361 CTGTCTGGTGACAAGCAGAGTGG - Intergenic
1055132740 9:72794084-72794106 CTGTCTGGTGACAAGGAGGGGGG - Intronic
1056869945 9:90268013-90268035 CTGTCCTGGCCCAAGGAGATGGG - Intergenic
1057548988 9:96038425-96038447 GTGTCTGGGCACTGGGAGAGAGG + Intergenic
1057878925 9:98778532-98778554 CTGTCTGGGCCCCAGGAGAGGGG - Intronic
1059987651 9:119835822-119835844 TTTTCTAGGCACAAGGAGAGGGG - Intergenic
1060506334 9:124200945-124200967 CTTTCTGGCCACAAGGAGGGAGG - Intergenic
1191185127 X:57603304-57603326 CTTTCTCTGCAGCAGGAGAGGGG + Intergenic
1192098493 X:68238934-68238956 CTGCCTTATCACAAGGAGAGAGG + Intronic
1195580619 X:106497001-106497023 CTGGCTGGGGACAAGGAGAATGG - Intergenic