ID: 1162382679

View in Genome Browser
Species Human (GRCh38)
Location 19:10340724-10340746
Sequence GGTCACTGCATTCCAAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162382666_1162382679 11 Left 1162382666 19:10340690-10340712 CCTGTTGTCCCCTTGCCCACCCT No data
Right 1162382679 19:10340724-10340746 GGTCACTGCATTCCAAGGGAAGG No data
1162382673_1162382679 -5 Left 1162382673 19:10340706-10340728 CCACCCTTCCAGGCAGCTGGTCA No data
Right 1162382679 19:10340724-10340746 GGTCACTGCATTCCAAGGGAAGG No data
1162382664_1162382679 16 Left 1162382664 19:10340685-10340707 CCCATCCTGTTGTCCCCTTGCCC No data
Right 1162382679 19:10340724-10340746 GGTCACTGCATTCCAAGGGAAGG No data
1162382663_1162382679 17 Left 1162382663 19:10340684-10340706 CCCCATCCTGTTGTCCCCTTGCC No data
Right 1162382679 19:10340724-10340746 GGTCACTGCATTCCAAGGGAAGG No data
1162382672_1162382679 -4 Left 1162382672 19:10340705-10340727 CCCACCCTTCCAGGCAGCTGGTC No data
Right 1162382679 19:10340724-10340746 GGTCACTGCATTCCAAGGGAAGG No data
1162382675_1162382679 -9 Left 1162382675 19:10340710-10340732 CCTTCCAGGCAGCTGGTCACTGC No data
Right 1162382679 19:10340724-10340746 GGTCACTGCATTCCAAGGGAAGG No data
1162382674_1162382679 -8 Left 1162382674 19:10340709-10340731 CCCTTCCAGGCAGCTGGTCACTG No data
Right 1162382679 19:10340724-10340746 GGTCACTGCATTCCAAGGGAAGG No data
1162382665_1162382679 15 Left 1162382665 19:10340686-10340708 CCATCCTGTTGTCCCCTTGCCCA No data
Right 1162382679 19:10340724-10340746 GGTCACTGCATTCCAAGGGAAGG No data
1162382662_1162382679 23 Left 1162382662 19:10340678-10340700 CCTTTACCCCATCCTGTTGTCCC No data
Right 1162382679 19:10340724-10340746 GGTCACTGCATTCCAAGGGAAGG No data
1162382670_1162382679 1 Left 1162382670 19:10340700-10340722 CCTTGCCCACCCTTCCAGGCAGC No data
Right 1162382679 19:10340724-10340746 GGTCACTGCATTCCAAGGGAAGG No data
1162382668_1162382679 3 Left 1162382668 19:10340698-10340720 CCCCTTGCCCACCCTTCCAGGCA No data
Right 1162382679 19:10340724-10340746 GGTCACTGCATTCCAAGGGAAGG No data
1162382669_1162382679 2 Left 1162382669 19:10340699-10340721 CCCTTGCCCACCCTTCCAGGCAG No data
Right 1162382679 19:10340724-10340746 GGTCACTGCATTCCAAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162382679 Original CRISPR GGTCACTGCATTCCAAGGGA AGG Intergenic
No off target data available for this crispr