ID: 1162385320

View in Genome Browser
Species Human (GRCh38)
Location 19:10357501-10357523
Sequence CAGAGTGACCAGGGCAGCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 270}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162385320_1162385324 22 Left 1162385320 19:10357501-10357523 CCATCGCTGCCCTGGTCACTCTG 0: 1
1: 0
2: 4
3: 26
4: 270
Right 1162385324 19:10357546-10357568 TTACTTGCCTTCTGTGTGCCAGG 0: 1
1: 2
2: 8
3: 90
4: 723

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162385320 Original CRISPR CAGAGTGACCAGGGCAGCGA TGG (reversed) Intronic
900623045 1:3596161-3596183 CAGTGTGGCCAGGGCAGCCTTGG + Intronic
900648885 1:3721434-3721456 CAGAGTCACCAGGGCTGCTGAGG + Intronic
901057349 1:6454857-6454879 CAGAGCGGCCCGGGCAGCCAGGG - Intronic
901204285 1:7485018-7485040 CAGAGTCACCAGGGCAGGCATGG - Intronic
901436825 1:9251597-9251619 CCGAGGGACCAGGGCATCCAGGG + Intronic
901787923 1:11637088-11637110 CAGAGTGAGCAGTGCATCTATGG + Intergenic
902369865 1:15999259-15999281 CAGAGGGTCCTGGGCAGAGAAGG + Intergenic
902490053 1:16775061-16775083 GTGAGTGACCAGGACAGGGAGGG + Intronic
902862863 1:19258404-19258426 CAACATGACCAGGGCAGAGAGGG + Intronic
903015630 1:20359924-20359946 CAGAGTTACCAGTGGGGCGAGGG - Intergenic
903384653 1:22918448-22918470 TAGGGTGACCAGGGCAGGGATGG - Intergenic
904366694 1:30015585-30015607 CAGAGTCACCTGGGAAGAGAAGG + Intergenic
904921414 1:34011084-34011106 CACAGTGACCAAGGCTGTGAAGG - Intronic
905019076 1:34796037-34796059 CAGTGTGGCCAGGGCGACGATGG - Intronic
906108437 1:43308204-43308226 CAGACTGAGCAGGTCAGAGAAGG + Intronic
906660013 1:47575266-47575288 CTGAGTGACCTGGGCAGAGAAGG + Intergenic
907412487 1:54292473-54292495 CACAGTGGCCAGGGCAGCTGGGG - Intronic
908511513 1:64853338-64853360 CAGTGTGACCTGGGCAGGGTGGG + Intronic
913963232 1:143354721-143354743 CAGAGAGACCAAGGCAGAAAAGG - Intergenic
914057588 1:144180307-144180329 CAGAGAGACCAAGGCAGAAAAGG - Intergenic
914121558 1:144786059-144786081 CAGAGAGACCAAGGCAGAAAAGG + Intergenic
921155488 1:212434962-212434984 CAGAGAGAGGAGGGGAGCGAGGG + Intronic
923530384 1:234807469-234807491 GTGAGTGACCAGGACAGGGAGGG - Intergenic
923575718 1:235157272-235157294 CAGACTGACCAGAGCAGGGAAGG + Intronic
1062911145 10:1213232-1213254 CAGAGAGACAAGGACAGAGATGG + Intronic
1065590305 10:27256569-27256591 TGGAGTGCCCAGGGCAGTGAGGG + Intergenic
1067449946 10:46376048-46376070 TAGAGTGCCCACGGCAGGGATGG + Intronic
1067587298 10:47483715-47483737 TAGAGTGCCCACGGCAGGGATGG - Intronic
1067634356 10:47991482-47991504 TAGAGTGCCCACGGCAGGGATGG - Intergenic
1069745589 10:70713016-70713038 GAGAGTGCCCAGGGCAGTGGCGG + Intronic
1075834738 10:125443955-125443977 AAGAGACACCAGGGCAGCAATGG - Intergenic
1078579382 11:12526829-12526851 CAGAGGGACAAGAGCAGAGAGGG + Intronic
1079351115 11:19692934-19692956 CCGAGGGAACAGGGCAGCCAAGG + Intronic
1083652672 11:64212194-64212216 AAGAGTGAACAGGGCACAGAGGG - Intronic
1083892132 11:65600781-65600803 CAGAGGGACAAGGCCAGGGAGGG - Intronic
1084114342 11:67033145-67033167 CAGAGTGGCCGGGGGAGGGAGGG - Intronic
1084362504 11:68677898-68677920 CACAGAGCCCAGGGCAGTGAAGG + Intergenic
1084464217 11:69312944-69312966 CACAGTGACCAGGGCACAGAAGG - Intronic
1084978884 11:72818018-72818040 CAGAGTGCCCTGGGCAGCCCAGG + Intronic
1086132242 11:83412873-83412895 CAGAGTGACTACGGCTGGGATGG + Intergenic
1086767611 11:90717710-90717732 CAGAGTTTCCAGGGCAAGGATGG + Intergenic
1090416343 11:126543199-126543221 CAGAGAGACTAGGGCAGTAATGG - Intronic
1091588420 12:1828897-1828919 CAAAGGGACCAGGTCAGCAAGGG + Intronic
1092043750 12:5409592-5409614 CAGATTGACTAGGGCAGGAAAGG - Intergenic
1096650597 12:53060277-53060299 CGGAGTGCCCAGGGCAGAGGAGG + Intronic
1097817857 12:64095488-64095510 AAGAGTGGCCAGGGCAGCCCTGG + Intronic
1098979709 12:76943046-76943068 CAGAGTGTCCAGAGCACTGAGGG - Intergenic
1100000721 12:89831904-89831926 AAGAGTAACCTGGGTAGCGAAGG - Intergenic
1100397669 12:94199020-94199042 CAGAGTAAACAGGGCTGTGAAGG + Intronic
1100889678 12:99110997-99111019 CAGTGTGATAAGGGCAGTGATGG - Intronic
1101094857 12:101327656-101327678 CAGAGTGTCCAGGGCACAGGAGG - Intronic
1101692306 12:107093528-107093550 CAGAGTCACCCGGGCAGCCTCGG - Exonic
1101837308 12:108304474-108304496 CAGAGAGACCAGGGCAGAAAAGG - Intronic
1102001642 12:109561257-109561279 CAGAGTGGGCAGGGCTGGGAGGG + Intronic
1102574142 12:113845215-113845237 CAGAGTCACCAGGGCAGTGAAGG - Intronic
1102606721 12:114073478-114073500 CACAGTGACAAGTGCTGCGATGG - Intergenic
1103764037 12:123269492-123269514 CACAGGGACCACGTCAGCGAAGG + Intronic
1104841286 12:131827336-131827358 CAGAGTACCCAGGGAAGCGGGGG + Intergenic
1105913704 13:24893955-24893977 GAGAGTGGCCAGGGCAGGTAAGG + Intronic
1105954657 13:25269059-25269081 CAGAGGGGCCAAGGCAGCTAGGG - Intronic
1106102835 13:26709325-26709347 CAGAGTCGCCAGGGCAGCCTCGG - Intergenic
1107893271 13:44932810-44932832 CAGAGTGGCAAGGGCAGGGTAGG - Intergenic
1107960805 13:45556267-45556289 CAGAGTGCCTAGGGCACCGTAGG + Intronic
1110585379 13:77184808-77184830 CATAGTGACCAGGGGAGAGCAGG - Intronic
1113310300 13:109125226-109125248 CTGAATGACCAGGGCATCGTAGG - Exonic
1113355479 13:109576071-109576093 AGGAGGGACCAGGGCAGTGATGG - Intergenic
1113672074 13:112182368-112182390 CAGACTGCCCAGGGCTGTGAGGG + Intergenic
1113680409 13:112239644-112239666 CAGGCTGACCAAGCCAGCGACGG + Intergenic
1117730266 14:58715122-58715144 CACAGAGACCAGGCCAGGGAGGG - Intergenic
1117800576 14:59440333-59440355 CATAGTGAGCAGGGCTTCGATGG - Intronic
1117978588 14:61321311-61321333 TAGACTGACCTGGGGAGCGATGG - Intronic
1121345160 14:93130140-93130162 CAGAGTGACCAGTGAACCCAAGG - Intergenic
1121716783 14:96081977-96081999 CAGGGTGACCTGGGGGGCGAGGG - Intronic
1121954917 14:98204968-98204990 CAGAGAGACCAAGGCAGGCAAGG - Intergenic
1122116345 14:99529269-99529291 CAGAGGGACCTGGGAAGGGAGGG - Intronic
1122126080 14:99579485-99579507 CAGAAGGACCAGGGCTGGGAGGG - Intronic
1122801339 14:104231151-104231173 CAGAGGGGCAAGGGCAGCAAAGG + Intergenic
1122911126 14:104827989-104828011 CAGAGTGCTCAGGGCAGGGGCGG + Intergenic
1202856228 14_GL000225v1_random:53542-53564 CAGAGGAGCCAGGGCAGCGTAGG - Intergenic
1125521896 15:40352722-40352744 CAGTGTGCCCAGTGCAGGGACGG - Intronic
1126124548 15:45283658-45283680 CAGAGTGACCAGTGAACCCAAGG + Intergenic
1126232725 15:46345712-46345734 CAGGATGACCAGGCCAGGGAGGG - Intergenic
1127304059 15:57684663-57684685 CAGAGTGAGCAGGTAAGAGAGGG + Exonic
1127907611 15:63387885-63387907 GAAACTGAGCAGGGCAGCGAGGG - Intergenic
1127914559 15:63444794-63444816 CAGGGTGAAAAGGGCAGCCATGG - Intergenic
1128997542 15:72307742-72307764 CAGAGGGACCAGGGCCTCGGGGG + Intronic
1129181951 15:73883209-73883231 CAGAGTGACCCGGGGTGGGACGG + Intronic
1129361549 15:75027745-75027767 CAGAATGCCGTGGGCAGCGAGGG - Intronic
1130877173 15:88024559-88024581 CAGAGCTACCAGGTCAGCCAGGG + Intronic
1131956327 15:97740127-97740149 CAGTGTGACCAGAGCAGCCATGG + Intergenic
1132636438 16:952128-952150 CAGTGTCACCAGGGCAGGGCAGG - Intronic
1132682413 16:1148483-1148505 CAGCCTGTCCAGGGCAGGGAAGG + Intergenic
1132867993 16:2103324-2103346 CAGGGTGACCACAGCACCGACGG + Exonic
1132956455 16:2596862-2596884 CAGAGGGGCCAGGGGAGCCATGG + Intronic
1134523778 16:14929790-14929812 CAGGGTGACCACAGCACCGACGG - Intronic
1134549124 16:15131145-15131167 CAGGGTGACCACAGCACCGACGG + Intronic
1134711369 16:16328275-16328297 CAGGGTGACCACAGCACCGACGG - Intergenic
1134719219 16:16371578-16371600 CAGGGTGACCACAGCACCGACGG - Intergenic
1134948207 16:18340307-18340329 CAGGGTGACCACAGCACCGACGG + Intergenic
1134955460 16:18380418-18380440 CAGGGTGACCACAGCACCGACGG + Intergenic
1136475995 16:30513745-30513767 CGGAGAGAGAAGGGCAGCGATGG - Intronic
1136543125 16:30939848-30939870 CAGAGTCATGAGGGCAGGGAGGG + Intronic
1138339684 16:56280567-56280589 CAGAGTGGACAGGGCAGGGAGGG + Intronic
1138442322 16:57042476-57042498 CAGGGTGCCCAGGGCTGCCAAGG + Intronic
1138452585 16:57102498-57102520 CAGAGAGACCATGGTAGTGACGG - Intronic
1138551823 16:57752690-57752712 CAGAGGGCCCAGGGCAGGGAGGG - Intronic
1138650568 16:58458685-58458707 CAGAGTTACCAGGATAGCAAGGG + Intergenic
1139545560 16:67648110-67648132 CACAGTGTCCAGGGCAGTGTCGG - Exonic
1139607890 16:68032940-68032962 CAGGGTGGCCAGGGCCGAGAGGG + Intronic
1141180895 16:81752751-81752773 CAGGGTGCCCAGGGAAGTGAGGG + Intronic
1142149478 16:88506268-88506290 CAGGGAGACCAGGGCAGGGGTGG + Intronic
1142237568 16:88929452-88929474 CAGAGTTACCAGGTGAGCCAGGG + Intronic
1142303641 16:89273857-89273879 CAGAGTGCCCAGGGCTGGGGTGG + Intronic
1142472807 17:172600-172622 CAGCGTGCCCAGGGCAGCTGCGG + Exonic
1143771676 17:9173132-9173154 CAGAGAGACCAGGGGAGGGGAGG - Intronic
1144955992 17:19019164-19019186 CAGAGACCCCAGGGCAGGGAAGG + Intronic
1144967852 17:19089241-19089263 CAGAGAGTCCAGGGCAGCGCAGG + Intergenic
1144980065 17:19162822-19162844 CAGAGAGTCCAGGGCAGCGCAGG - Intergenic
1144988157 17:19215410-19215432 CAGAGAGTCCAGGGCAGCGCAGG + Intergenic
1145924118 17:28633185-28633207 GTGAGTGACCAGGGCACTGAGGG - Intronic
1147745191 17:42690596-42690618 CAGAGTGCCCAGGGCAGAGGTGG + Intronic
1148562863 17:48616132-48616154 CAGAGAGGGCAGGGCAGAGAAGG - Intronic
1149317708 17:55454074-55454096 CAGTGTCAGCTGGGCAGCGATGG + Intergenic
1149454465 17:56776801-56776823 CCGAGTGAGCAGGGCAGTGCTGG - Intergenic
1152071787 17:78137784-78137806 CAGGGTGACCAGGAAGGCGAAGG - Exonic
1152680612 17:81666097-81666119 TAGATAGAGCAGGGCAGCGACGG - Intronic
1152748257 17:82051145-82051167 CCGCGTGACCTGGGCAGCGTCGG + Intronic
1152820951 17:82437387-82437409 CAGAGGGTCCAGGGCAGCTCTGG + Intronic
1153761965 18:8340096-8340118 CACAGTGACCAGGCCAGGGAGGG + Intronic
1153763263 18:8351905-8351927 CAGGTTCACCAGGGCAGCCAGGG - Intronic
1155996467 18:32335923-32335945 CAGAGTGACCATGGGAGCAACGG + Intronic
1156268422 18:35508905-35508927 TTGAGTGACCAGGGAAGCAATGG - Intergenic
1156805442 18:41173352-41173374 CAGAGTGACCAGGTCAAACATGG - Intergenic
1157188786 18:45562866-45562888 CAGAGGGACCAGAGCAGAGCAGG - Intronic
1159021236 18:63144878-63144900 CACAGTGCCCAGGGCGGCGGGGG - Intronic
1160083237 18:75751095-75751117 CAGAGTGACAGAGGCAGAGACGG - Intergenic
1160261586 18:77299271-77299293 CAGTGTGAGCAGGGCAGAGCAGG - Intergenic
1160793584 19:933815-933837 GAGAATGGCCAGGGCAGCGGCGG + Intronic
1160847085 19:1171425-1171447 CAGAGTCCCCAGGGCAGCGCTGG + Intronic
1161055364 19:2188297-2188319 CAGGGTGGCCAGGGCAGGGCAGG + Intronic
1161422483 19:4183518-4183540 CAGAGGGCACAGGGCAGTGAGGG + Intronic
1162265742 19:9572496-9572518 CAGAGTTTCCAGGGCTGGGATGG - Intronic
1162385320 19:10357501-10357523 CAGAGTGACCAGGGCAGCGATGG - Intronic
1162793121 19:13073172-13073194 GAGGGTGGCCAGGGCAGCCAGGG - Intronic
1165095211 19:33406488-33406510 CAGAGTGCTCAGGGCAGGGCTGG + Intronic
1165152766 19:33770674-33770696 CAGAGAGACCAGTGCATCAATGG - Intronic
1165309628 19:35022463-35022485 CAGAGTGATCCGGGCTGGGATGG + Intronic
1165328945 19:35130824-35130846 CAGAGGGGTCAGGGCAGGGATGG - Intronic
1165396874 19:35569304-35569326 CAGAGTGGTCAGGGCTGTGATGG - Intergenic
1165431730 19:35776775-35776797 CAGAGTGATCAGAGCTGTGAAGG + Intronic
1165767378 19:38359887-38359909 CAGAGTGATCAGGGCTGCAATGG + Intronic
1165792425 19:38500225-38500247 CAGAGTGGTCAGGGCTGGGATGG + Intronic
1165804650 19:38572971-38572993 CAGAGGGGTCAGGGCAGGGATGG - Intronic
1165893815 19:39130038-39130060 CAGAGAGGCCAGGGCTGTGAAGG + Intronic
1165936753 19:39393926-39393948 CAGAGGGATCAGGGCTGGGATGG + Intronic
1165991565 19:39818147-39818169 GACAGTGACCAGGGCTGGGATGG - Intergenic
1165999193 19:39867804-39867826 CAGAGGGGTCAGGGCAGAGATGG + Intronic
1166007894 19:39919657-39919679 CAGAGGGGTCAGGGCAGAGATGG + Intronic
1166200139 19:41232098-41232120 CAGAGTGGCCAGGGCTGGGATGG - Intronic
1166339911 19:42131164-42131186 CAGAGGGATCAGGGCTGGGATGG - Intronic
1166645788 19:44530715-44530737 CAGAGTGGGCAGGGCTGGGATGG + Intergenic
1166658020 19:44626504-44626526 CAGAGTGGGCAGGGCTGGGATGG + Intronic
1166664348 19:44669830-44669852 CAGAGTGATCAGGGCTGGGATGG - Intronic
1166983726 19:46647934-46647956 CAGAGTGCCCTGGGAAGGGAAGG - Exonic
1167008789 19:46792638-46792660 CAGAGTGGGCAGGGCTGGGATGG + Intergenic
1167398986 19:49252416-49252438 CAGGTTGACCAGGGCTGCAATGG + Intergenic
1167560591 19:50224457-50224479 CAGAGTGAACAGTGTAGCAAGGG + Intronic
1167640740 19:50679955-50679977 CAGAGAGACAAAGGCAGAGATGG + Intronic
1202697071 1_KI270712v1_random:132980-133002 CAGAGAGACCAAGGCAGAAAAGG - Intergenic
1202698905 1_KI270712v1_random:148046-148068 CAGAGTGTCCAGAGCAATGAGGG + Intergenic
927843760 2:26461054-26461076 CAGAGTGAACAGGGCTGGGGTGG + Intronic
928234693 2:29529403-29529425 CATAGTGCTCAGAGCAGCGAGGG - Intronic
930307597 2:49694748-49694770 CAGAGTGACCAGGTCACCACTGG + Intergenic
934278232 2:91589994-91590016 CAGAGAGACCAAGGCAGAAAAGG - Intergenic
935652450 2:105393801-105393823 AGGAGGGACGAGGGCAGCGATGG - Intronic
935666323 2:105516143-105516165 CACAGTGACCATGGCAAGGAAGG - Intergenic
936582630 2:113716731-113716753 CAGGATGAGCAGGGCAGGGAAGG + Intronic
937265784 2:120613933-120613955 CAGAGAGACTGGGGCAGGGAGGG + Intergenic
937321881 2:120965887-120965909 CAGAGGGGCCAGGGCAGAGCAGG - Intronic
941006116 2:160248818-160248840 CAGGCTCACCAGGGCAGAGAGGG + Intronic
944015054 2:195026167-195026189 AAGAGCGACCAGGGCAGCAGCGG + Intergenic
945994634 2:216425655-216425677 GAGAGTGAGCAAGGCAGAGAAGG + Intronic
946525371 2:220513259-220513281 CAGAGTGAACAGAGCATCAAGGG + Intergenic
947872095 2:233444881-233444903 CAGAGTGACCAGGGCCATGAAGG - Intronic
948981637 2:241497707-241497729 CAGGGTGAGCAGGGCAGTGCAGG + Intronic
1168952188 20:1810163-1810185 CTGAGTGAGAAGGGCAGTGATGG - Intergenic
1171228304 20:23459882-23459904 CAGAGTGAACAGTGCAGGAATGG - Intergenic
1173480588 20:43395748-43395770 CAAAGGGACCAGGCCACCGATGG + Intergenic
1173737437 20:45372264-45372286 CAGCATGGCCAGGGCAGCAAGGG - Intronic
1173838737 20:46142453-46142475 CAGAGTGAGCAAGGGAGAGAGGG - Intergenic
1174181227 20:48676287-48676309 CACAGTGAGCAGGGCAGGGCGGG + Intronic
1174405158 20:50298098-50298120 CAGTGTGAGCAGTGCAGCAAAGG - Intergenic
1174517289 20:51102292-51102314 CAGAGTGATGAGGGCAGCACAGG + Intergenic
1175457862 20:59128675-59128697 CAGTGTGACCAGGTCAGAGGTGG + Intergenic
1175682573 20:61001369-61001391 TAGTGTGACCATGGCAGAGAAGG + Intergenic
1175844368 20:62050909-62050931 CCCAGTGCCCAGGGCAGCGTGGG - Intronic
1175928141 20:62480826-62480848 CAGAGACCCCAGGGCAGGGAAGG + Intergenic
1176120389 20:63451891-63451913 CAGGGCGTCCAGGGCAGGGAAGG + Intronic
1177331259 21:19666529-19666551 CAGAGTGTACAGGGAAGAGAAGG + Intergenic
1179286107 21:39978563-39978585 CAGCATGAGCAGGGCAGCCAAGG + Intergenic
1180159858 21:45994182-45994204 CAGGGTGATCAGGGAAGAGAAGG + Exonic
1180180316 21:46116006-46116028 CAGGGAGACCCGGGCATCGAAGG + Exonic
1182041206 22:27240112-27240134 CAGAGTGATCAGGGCTGCTGAGG - Intergenic
1182696937 22:32204305-32204327 CAGCGCGACCAGTGCAGCCACGG + Intergenic
1183360076 22:37378815-37378837 CAGAGAGGCCAAGGCAGAGAAGG + Intronic
1183478894 22:38052151-38052173 GACAGTGACCCGGGCAGCTAAGG - Intergenic
1183698146 22:39434779-39434801 CAGAGGGGCCAGGGCAGGGCAGG + Intronic
1183735374 22:39642114-39642136 CAAAGTGCCCAGGGCAGCAGAGG - Intronic
1183992634 22:41608586-41608608 CAGAGTGAAGGGGGCAGTGATGG + Intronic
1184042637 22:41953057-41953079 CAAAGTGACTAGTGCAGCCAGGG - Intergenic
1184092248 22:42298926-42298948 GAGAGGGCCCAGGGCAGGGAGGG + Intronic
1184503827 22:44889398-44889420 CAGTGTGACCTGGGCAGAGCTGG - Intronic
949929736 3:9069354-9069376 CAGTGTGCCCAGGGCTGGGAAGG + Intronic
950874923 3:16263176-16263198 CAGTGTGACCAGAGCAGAGCAGG - Intronic
951656617 3:25016390-25016412 CAGAGGGTACAGGCCAGCGATGG - Intergenic
952673676 3:36000796-36000818 CAGAGTGCCCAGGGGAAGGAGGG - Intergenic
953983608 3:47425553-47425575 CACTGTGACCACGGCAGCCAGGG + Exonic
954395959 3:50293437-50293459 CAATGTGACCAGGGCAGCGATGG - Exonic
954792870 3:53145863-53145885 CAGAGTGAGCAGGGCCCAGATGG - Intergenic
955506831 3:59640791-59640813 CAAAGTGACCAGTGCTGAGATGG + Intergenic
959302375 3:104619349-104619371 GAGAGTCACCAGGGCAGTGTAGG - Intergenic
959619607 3:108385837-108385859 CAGAGTGAGCAGGGGAGCTCTGG - Intronic
960534563 3:118802313-118802335 CAGAGTAATCAGGGCTGGGAGGG + Intergenic
962887608 3:139642076-139642098 CACAGTGTCCAGGGGAGGGAGGG - Intronic
966930549 3:184672878-184672900 TAGGGTGACAAGGGCAGTGATGG + Intronic
967229173 3:187321306-187321328 CAGAGTGAAAAAGGCAGGGACGG + Intergenic
968456120 4:700894-700916 CAGAGTCCACAGGGCAGGGACGG - Intergenic
968603306 4:1520531-1520553 CAGAGTGACGACGGCTGGGAAGG - Intergenic
969032518 4:4226338-4226360 CAGAGAGACCAAGGCAGAAAAGG + Intronic
969054403 4:4392613-4392635 CAGAGTGACTGGGGAAGCCAGGG + Intronic
969530352 4:7726986-7727008 CAGGGTGACCAGGACATCCATGG - Intronic
969664346 4:8548477-8548499 CAGAGGGAACAAGGCAGCGGAGG + Intergenic
979812799 4:125060676-125060698 CAGTCTTACCAGGGCAGGGAAGG - Intergenic
984864431 4:184269814-184269836 GAGAGTGGCCAAGGCAGGGAAGG - Intergenic
986108437 5:4685362-4685384 CAGAGTGACCAGCTCAGAGCAGG + Intergenic
986286038 5:6359933-6359955 CAGAGTGAGCACGGGAGCGCAGG + Intergenic
990047010 5:51445098-51445120 CAGAGTGGACAGGGCAGCTCAGG - Intergenic
992624815 5:78627366-78627388 CAAAGTGACCAGGGGAGACAGGG - Intronic
998485479 5:142498256-142498278 CAGTGAGACCAAGGCAGTGAGGG + Intergenic
999179484 5:149659051-149659073 CTGAGTGACCAGGTCAGCGATGG - Intergenic
1000345639 5:160311829-160311851 GAGAGTGACAAGGGCAGGGAGGG + Intronic
1000437501 5:161230970-161230992 CACAGTGATCAGGGCAGAGTGGG + Intergenic
1002468961 5:179423252-179423274 CAGAGTGGCCAGGTCGGTGAAGG + Intergenic
1002985768 6:2189582-2189604 CAGAGTGAGCAGAGCACAGAGGG - Intronic
1003182198 6:3801522-3801544 CAGAATGACCAGGGCAGAGAGGG + Intergenic
1003665737 6:8109615-8109637 CAGAGTGACCAGCGCTGCCTGGG - Intergenic
1005583509 6:27254501-27254523 CACAGTGATCAGGGCTGTGATGG - Intronic
1005869425 6:29963269-29963291 CAGAGTGAACAGGCCACCTATGG + Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1006334885 6:33415268-33415290 CAGAGTTACCAGGGCAGCAGCGG + Exonic
1006621918 6:35371286-35371308 AAGAGGAACCAGGGCAGCAAAGG - Intronic
1008807926 6:55454398-55454420 CAGAGGTAACAGGGCAGCAAAGG + Intronic
1012247275 6:96939656-96939678 CAGAGAGCCAAGGGCAGTGAAGG + Intronic
1017022666 6:150152775-150152797 GAGAGTCACCAGGGCTGCAAAGG - Intronic
1019701323 7:2476167-2476189 CAGGGTGACCAGGGCTGGGGTGG + Intronic
1019918624 7:4149330-4149352 CAGTGGGTCCCGGGCAGCGACGG + Exonic
1023143997 7:37130709-37130731 GGGAGTGACAAGGGCAACGAGGG + Intronic
1024612414 7:51078929-51078951 CAGAGTGAGCAAGTGAGCGAGGG + Intronic
1025187508 7:56872501-56872523 CAAAGTTACCAGGGCAGCACTGG + Intergenic
1026827405 7:73593281-73593303 CAGAGTGACCACAGCAGGGCAGG - Exonic
1028871226 7:95772994-95773016 CCGAGAGACTAGGGCAGAGAAGG + Intronic
1029306765 7:99625367-99625389 CATAGTGACCAGAACAGCAATGG - Intronic
1030799232 7:113828835-113828857 CAGTGTGACTACAGCAGCGAGGG + Intergenic
1031196869 7:118627072-118627094 GAGAGTGAGCAAGGCAGGGAAGG - Intergenic
1032498436 7:132380454-132380476 CAGAAGGACCAAGGCACCGAGGG + Intronic
1032901276 7:136311402-136311424 CTTAGTGACCAGGGCAATGAAGG - Intergenic
1032991878 7:137403012-137403034 CAGAGTGTGCAGGGTGGCGAAGG + Intronic
1034883922 7:154783218-154783240 CAGAGAGAGCAGGACAGCTATGG - Intronic
1035483606 7:159205556-159205578 GAGATTGACCATGGCAGAGAAGG + Intergenic
1035693391 8:1574351-1574373 CACAGTTACCAGAGCGGCGAGGG - Intronic
1036168840 8:6463634-6463656 CAGTGTGGCCAGGCCAGCTAGGG + Intronic
1037043248 8:14264136-14264158 CACTGGGACCAGGGCAGCTATGG - Intronic
1037808818 8:22073857-22073879 CAGAGTCACCTGGCCAGAGATGG + Intronic
1038455811 8:27671239-27671261 CAGGGTCACCAGGCCAGCGGGGG + Exonic
1038652793 8:29420908-29420930 GAGAGTGAGGAGGCCAGCGAGGG + Intergenic
1039719890 8:40151884-40151906 CAGAGTGAGCAGGGCAGAGTGGG - Intergenic
1040033143 8:42843975-42843997 CAGACTGACCTGGGCAACGTGGG - Intergenic
1042626539 8:70764222-70764244 CAGAGTAAAGAGGGCAGAGAAGG - Intronic
1047309271 8:123677899-123677921 CAGAGGGACCTGGGCAGGGCAGG + Intergenic
1048442685 8:134471518-134471540 CAGAGAGTCCATGGCAGAGATGG + Intergenic
1049215389 8:141405446-141405468 CACAGTGACCAGGGCATCTGTGG - Intronic
1049488293 8:142877653-142877675 CACTGTGCCCAGGGCAGGGAAGG - Intronic
1049507601 8:143011926-143011948 CAGGGTCACCAGGGCAGCCCAGG - Intergenic
1053196332 9:36121908-36121930 CAGAGGCACCAGGGCAGGGGAGG + Intronic
1055906858 9:81305071-81305093 GAGAGTGACTAGGGTAGAGAGGG + Intergenic
1057861404 9:98643712-98643734 CACAGGGACTAGGGCAGAGATGG + Intronic
1057901573 9:98953218-98953240 CAAAGTGCCCAGGGGAGCTAAGG + Intronic
1060063929 9:120486117-120486139 GGGAGGGACCAGGGCAGCTAGGG - Intronic
1060919084 9:127407719-127407741 CAGGGTGTCCTGGGCAGTGATGG - Exonic
1062172131 9:135140669-135140691 CAGAGAAGCCAGGGCAGAGAAGG - Intergenic
1062227743 9:135463086-135463108 CAGAGGGACCATGGCAGAGCCGG - Intergenic
1062237982 9:135521775-135521797 CAGAGTGGGCAGGGCTGGGAGGG + Intronic
1062460285 9:136660060-136660082 CAGAGCGGCCAGGGCAGGGAAGG + Intronic
1062599625 9:137314053-137314075 CAGAGTGCACAGGGCAGCCTGGG - Intronic
1187520679 X:20011273-20011295 CAGATTGAGCAGGGCTGTGATGG + Intronic
1192302084 X:69915649-69915671 CAAAGTGACCAGTGCAGAGTAGG - Intronic
1192779902 X:74283347-74283369 CAGAGGGACAAGGGCAGAAAAGG + Intergenic
1199803022 X:151270210-151270232 CAGAGTCACCATGGCTGTGATGG - Intergenic
1201770648 Y:17614354-17614376 CAGAAAGACCAGGGCAGAGAGGG - Intergenic
1201830907 Y:18291632-18291654 CAGAAAGACCAGGGCAGAGAGGG + Intergenic
1202044099 Y:20719784-20719806 CAGAGTTGCCAGGGCAGCTCGGG - Intergenic