ID: 1162385913

View in Genome Browser
Species Human (GRCh38)
Location 19:10360613-10360635
Sequence CAGAGTAGTCAGAGGGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162385913 Original CRISPR CAGAGTAGTCAGAGGGATGT GGG Intronic
901798786 1:11695152-11695174 CTGAGGAGTCAGATGGCTGTGGG + Intronic
902364112 1:15959596-15959618 GAGAGTAGACAGAGGGAAGGAGG + Intronic
903614136 1:24639978-24640000 GAGAATAGTCAGGGAGATGTGGG + Intronic
904603104 1:31684294-31684316 CAGAGTGTTCAGAGGGGTGCAGG - Intronic
905015669 1:34776975-34776997 CAGATCAGGCAGAGGGATGGGGG - Intronic
905033396 1:34902408-34902430 CAGAGTGGACAGAGGGATCCTGG + Intronic
905248574 1:36631428-36631450 CAGAGAAAGCAAAGGGATGTAGG - Intergenic
905498997 1:38420925-38420947 CAGAGCAGCGGGAGGGATGTGGG + Intergenic
905514999 1:38556146-38556168 CAGATTCCTCAGAGGGAAGTCGG + Intergenic
906818994 1:48909420-48909442 CAGATTAGAGAGAGAGATGTTGG + Intronic
907279755 1:53339850-53339872 CAGAGTGGCCAGAAGGATCTGGG - Intergenic
907390802 1:54157040-54157062 CAGAGAAGTGAGAGAGATGTCGG - Intronic
909564097 1:77035536-77035558 CAGAGAAGTCAGCTGAATGTTGG + Intronic
912863536 1:113236611-113236633 GAGAGAGGCCAGAGGGATGTGGG - Intergenic
914019488 1:143852902-143852924 CAGATTAATCCGAGAGATGTAGG - Intergenic
914658038 1:149761119-149761141 CAGATTAATCCGAGAGATGTAGG - Intergenic
918593516 1:186266196-186266218 CAGAGAAGTCAGAGTGACGTGGG - Intergenic
919613987 1:199782145-199782167 CAGAGTGGTATGATGGATGTTGG + Intergenic
924063502 1:240200537-240200559 CAGAGTAGCCAAATGTATGTAGG - Intronic
1063639163 10:7813872-7813894 GAGAGCAATCAGAGGGGTGTGGG + Intergenic
1065960532 10:30730941-30730963 CAGGGAAGCCAGAGGGGTGTGGG + Intergenic
1066597792 10:37071081-37071103 CAGAGTAGTATAAGGGATATTGG - Intergenic
1067155557 10:43778793-43778815 CAGAGTAGGAAGTGGGCTGTGGG - Intergenic
1069622674 10:69847493-69847515 CAGAGTAGGGAGAGAGATGAGGG - Intronic
1070643221 10:78183827-78183849 CAGGGGTGTCAGAGAGATGTTGG + Intergenic
1071018169 10:81021958-81021980 CAGTGTAGTCATAGTGATGGTGG + Intergenic
1072272123 10:93786962-93786984 GAAAGTAGGCAGAGGGATTTGGG - Intronic
1073004466 10:100312106-100312128 GAGAGTAGGCAGAGGAAAGTAGG + Intronic
1073708822 10:106016433-106016455 CAGAGCAGTGGGGGGGATGTTGG + Intergenic
1074684712 10:115949837-115949859 CAAAGTAGGTAGAGGGCTGTTGG + Intergenic
1076437904 10:130459256-130459278 CAGGGAAGTCAGAGGGGTGGAGG + Intergenic
1076709060 10:132321103-132321125 CTGACTGGTCAAAGGGATGTTGG + Intronic
1078628126 11:12977017-12977039 CAGAGTAGGCAGAGATTTGTGGG - Intergenic
1079893886 11:26094211-26094233 CAGAGTAGTTAGGGGGATTTTGG - Intergenic
1081363924 11:42212522-42212544 CTCAGAAGTCAGAGAGATGTGGG + Intergenic
1083330688 11:61897090-61897112 CTTAGTATTCAGAGGGCTGTGGG - Intergenic
1083812923 11:65115689-65115711 GAGAGTAGTCAGAGAGCTGGGGG + Intronic
1086114239 11:83230387-83230409 TAGGGGAGTCAGAGGGAGGTAGG - Intronic
1087779094 11:102284467-102284489 CAAATTAATCAGAAGGATGTAGG - Intergenic
1087831140 11:102820880-102820902 CAGAGAAGGCAGAGGGATGGGGG - Intergenic
1088830300 11:113531156-113531178 CAGAGGAGAGAAAGGGATGTTGG - Intergenic
1090158871 11:124470516-124470538 CAGTGTTGTCAGTGGGATGTAGG + Intergenic
1090213016 11:124936114-124936136 CTGTGTATTCAGAGGGAAGTTGG - Exonic
1090399928 11:126442693-126442715 CAGAGCAGGCAGAGGGAGGGGGG - Intronic
1090593781 11:128298721-128298743 CAGAGTGGTCAGGGAGATGATGG - Intergenic
1091169399 11:133506969-133506991 CAGAGCAGTCAGATGCCTGTTGG - Intronic
1091204528 11:133810627-133810649 CTGAGAAGGCAGAGGGATTTAGG - Intergenic
1091403382 12:194453-194475 CAGTGGAGTCAGAGGGACCTGGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096800127 12:54105055-54105077 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1096872493 12:54602215-54602237 CAGAGAGGTCAGAGTGCTGTGGG + Intergenic
1096877912 12:54644883-54644905 CACAGAAGTCAGAGGGATGGAGG + Intronic
1098202218 12:68068356-68068378 CTGAGGAGTGAGAGGGAGGTGGG - Intergenic
1098519532 12:71420287-71420309 CAGAGCAGTGAGAGGTGTGTGGG + Intronic
1098546370 12:71716334-71716356 CAGAGGAGTCAGAGAGATGCTGG + Intergenic
1102856819 12:116301396-116301418 CTTTGTAGTCAGAGGGATCTGGG + Intergenic
1105400997 13:20096008-20096030 AAGAGTAGTCAGTGGGATTTGGG - Intergenic
1106346666 13:28886130-28886152 GAGTGAGGTCAGAGGGATGTAGG + Intronic
1106402886 13:29446289-29446311 CAGAGAAGTCATAGGGTTTTAGG + Intronic
1107019974 13:35741336-35741358 CAGAGCAGTCCGAGGGCTGCTGG + Intergenic
1107939653 13:45372498-45372520 CAGAGAGGTCTGAGGGATGGGGG + Intergenic
1112323685 13:98429362-98429384 CAGAGAGGTCAGAGGGATCCCGG + Intronic
1112380261 13:98882295-98882317 GAGAGGAGTCAGAGGGAGCTGGG + Intronic
1112382820 13:98909081-98909103 CAGAGTAGTCAGTGGGCTTTGGG - Intronic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1114691118 14:24582537-24582559 CAGAGTAGTTAGAGGGAAACAGG + Intergenic
1117352048 14:54890899-54890921 CTGTGTAGTCAGAGGGAAGCTGG - Intronic
1117666205 14:58058984-58059006 CAGAATAGAAAGAGAGATGTTGG + Intronic
1121298095 14:92846546-92846568 CATAGTGGTCAGAGAGATGAGGG - Intergenic
1122112679 14:99513271-99513293 CAGAGTAGCCCAAGGGCTGTGGG - Exonic
1124661790 15:31555732-31555754 CGGAGGAGTCAGATGGATGGTGG + Intronic
1128084451 15:64876194-64876216 CAGAGCAGTAAGAGGGAAGGAGG - Intronic
1129532314 15:76278299-76278321 CAGTGGGGTCAGAGGAATGTTGG - Intronic
1130090883 15:80820245-80820267 CAGACTGGTCAGAGGAAAGTGGG + Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130426864 15:83810178-83810200 CCGAGTCCTCAGAGGGATTTTGG + Intronic
1131422670 15:92320295-92320317 GAGAGTTGTCAGAGGGGTGTGGG - Intergenic
1133970889 16:10567387-10567409 CAGAGGAGTCAGAGAGCTGGAGG - Intronic
1135461330 16:22645981-22646003 CATAGTAGCCAGAGGGATCCCGG + Intergenic
1137669394 16:50270702-50270724 ATGATTAGTCCGAGGGATGTAGG - Intronic
1139111625 16:63898501-63898523 CCCAGTAGTATGAGGGATGTGGG + Intergenic
1141998625 16:87650368-87650390 CAGAGGAGAGAGAGGGATGGGGG - Intronic
1143899247 17:10161310-10161332 CACTGTAGTGAGAGGGATTTAGG + Intronic
1145251240 17:21298069-21298091 CTGACTAGTCAATGGGATGTGGG - Intronic
1146793312 17:35765011-35765033 CAGGTTTGTCAGAGGGATGAGGG - Exonic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1148761100 17:50001031-50001053 GAGAGGGGTCAGAGGGAGGTGGG + Intergenic
1150431342 17:65120224-65120246 CAGGGTGGTCAGTGGGATGGAGG + Intergenic
1152149223 17:78588711-78588733 CCCAGTAGACAGAGGGAGGTGGG - Intergenic
1155719742 18:28996212-28996234 CAGAGTAGAAAGATGGATGCTGG + Intergenic
1156464779 18:37341908-37341930 CAGATGAGTCAGAGAGTTGTGGG - Intronic
1157241597 18:46015032-46015054 CAAGGGAGTCAGAGGGATGCAGG + Intronic
1160713286 19:563377-563399 CAATGTAGTCAGAGGCCTGTGGG - Intergenic
1162385913 19:10360613-10360635 CAGAGTAGTCAGAGGGATGTGGG + Intronic
1163458708 19:17423879-17423901 CAGAGTTGGGAGAGGGAAGTAGG - Intronic
1165333670 19:35154918-35154940 GAGAGGAGGCAGAGAGATGTGGG - Exonic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1166030995 19:40127864-40127886 AGGAGTAGGCAGAGGGATCTAGG + Intergenic
1166872412 19:45878930-45878952 CAGAGTAGACAGAGAGACGGTGG - Intergenic
925184381 2:1836969-1836991 GAGAGTAGACAGAGGTGTGTGGG + Intronic
925284965 2:2709785-2709807 CAGAGCAGGCAGCTGGATGTGGG + Intergenic
926355142 2:12034656-12034678 CAGAGATGAGAGAGGGATGTTGG - Intergenic
926448220 2:12970496-12970518 AAGAGAGGTCAGAGCGATGTGGG + Intergenic
928222566 2:29416732-29416754 TACAGTAGTCAGAGGGATATGGG + Intronic
933326075 2:80839116-80839138 AAGGGTAGTGAGAGGGTTGTTGG - Intergenic
934157237 2:89214786-89214808 CAGAGTAGTCACAGGGATAGAGG - Intergenic
934210077 2:89967958-89967980 CAGAGTAGTCACAGGGATAGAGG + Intergenic
937218656 2:120328754-120328776 CAGAGGAGTCAGAGGCCTTTGGG - Intergenic
937929705 2:127194542-127194564 CAGAAAAGCCGGAGGGATGTGGG - Intronic
941082167 2:161074276-161074298 TAAAGTATACAGAGGGATGTAGG - Intergenic
941641389 2:167992438-167992460 CAGAGCAGAAAGAAGGATGTGGG + Intronic
941988281 2:171529589-171529611 CAGTCTACTCAGAAGGATGTAGG + Intronic
942433496 2:175943400-175943422 CAGAGTTATCAGAGTTATGTCGG - Intronic
942550542 2:177111709-177111731 CAGAGTCTTCAGATGGATGGAGG - Intergenic
943417471 2:187626592-187626614 CAGAATAGTCTGAGGAATGTAGG - Intergenic
945253566 2:207785049-207785071 CAGAGTAGGCTGAGGAATGATGG - Intergenic
947816850 2:233043182-233043204 CAGAGTAGTCAGGGTGGTCTTGG - Intergenic
948797952 2:240414286-240414308 AAGAGGAGTCAGAGATATGTGGG + Intergenic
1169308273 20:4513591-4513613 CAGAGTGGTCAGAGGAAGTTGGG - Intergenic
1170327970 20:15177092-15177114 CAGAGAAGTGAGAGGTGTGTGGG - Intronic
1171851916 20:30314881-30314903 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1171893789 20:30742220-30742242 CAAAGCAGTCAGAGGAAGGTGGG - Intergenic
1173406871 20:42773952-42773974 GAGAGGAGTCAGAGGCATGCTGG - Intronic
1174885098 20:54325140-54325162 GAGAGTGGGCAGAGGGAGGTAGG + Intergenic
1175224923 20:57439326-57439348 CAGAGGGGTCAGGGGGATGGGGG - Intergenic
1175361658 20:58415943-58415965 CAGAGTAGGGAGAGGAAGGTTGG + Intronic
1175391228 20:58628640-58628662 CCTAGAAGTCAGAGGGATGCAGG - Intergenic
1177244249 21:18502219-18502241 CAGAGGAGATAGAGGGATGGAGG + Intergenic
1177754800 21:25333548-25333570 CAGAGTAGAGAGGGGAATGTAGG - Intergenic
1177824592 21:26068331-26068353 CAGAGTAGTCAGAGAACTGGAGG - Intronic
1178007243 21:28235179-28235201 CAGGGTGGTCACAGGGGTGTAGG + Intergenic
1178251118 21:31004269-31004291 CAAAGCAGGCAGAGGAATGTCGG - Intergenic
1179272273 21:39860719-39860741 CAGAGGCATCAGAGGGATCTGGG + Intergenic
1179409665 21:41153048-41153070 CAGAGTGGCCAGCAGGATGTGGG + Intergenic
1181159020 22:20945700-20945722 CAGAGTAGCCAGAGAGATAGAGG - Intronic
1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG + Intronic
1184654968 22:45936493-45936515 CAGAGTCCTCAGAGACATGTGGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
953870169 3:46619385-46619407 AAGAGAAGTAAGAGGGATGCTGG + Intronic
954710016 3:52501025-52501047 CAGAGTAAGCAGAGGGTTCTGGG - Intronic
956019666 3:64920775-64920797 CAGGGTACTCACAGGCATGTGGG + Intergenic
956325879 3:68052380-68052402 CAGAGTAGTCACAGGAACCTGGG - Intronic
957181944 3:76889960-76889982 GAGAGAAGTGAGAGCGATGTAGG + Intronic
957983415 3:87541939-87541961 CAGAGTAGTCTGAGGAATGTGGG + Intergenic
957994510 3:87672130-87672152 CAGAGTAATCAGGGAGGTGTTGG + Intergenic
958078457 3:88713411-88713433 CAGTGTAGTCATAGTGGTGTTGG + Intergenic
963312827 3:143727502-143727524 AAGAGTAGTCAGAGAAATTTTGG - Intronic
963698305 3:148590896-148590918 TAGAGTAGTAAGAGGTATATAGG - Intergenic
964210584 3:154222634-154222656 CAGAGTAGTTAAATAGATGTGGG + Intronic
965250925 3:166342938-166342960 CAGGGCAGTCATAGCGATGTTGG + Intergenic
965433988 3:168624455-168624477 CACAGTACTCTGAAGGATGTAGG + Intergenic
966852906 3:184175479-184175501 CAGAGTAATGAGAGGGTGGTAGG - Intronic
969213052 4:5702240-5702262 CAGAGTGGTCTGAGAGATGAGGG - Intronic
974399490 4:61385256-61385278 AAAAGTATTCAGGGGGATGTTGG - Intronic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
975451329 4:74530398-74530420 CAGAAAAGTCACAGGGGTGTGGG - Intergenic
977641637 4:99364061-99364083 AAGGGTAGTGAGAGGGATGGAGG - Intergenic
978233740 4:106432076-106432098 CACAGTAGTGACAGTGATGTTGG - Intergenic
982964007 4:161879149-161879171 CAGATGAGACAGAGAGATGTTGG - Intronic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
987954676 5:24723090-24723112 CAGAGTAGTCATAGGGAAGAAGG - Intergenic
988526976 5:31995742-31995764 GAGAGGAGGCAGAGGGATGGGGG - Intronic
988777716 5:34492042-34492064 CAGACTAGTCAAAGGGAAATTGG + Intergenic
989470944 5:41817826-41817848 CAGAGAAGTCAGAGGAAACTAGG + Intronic
989550000 5:42723479-42723501 CAGTCTACTCAGAGGGATGTAGG - Intergenic
993090512 5:83420644-83420666 CAGAGGAAGCAGAGGGCTGTGGG + Intergenic
995247014 5:109946066-109946088 CAGAGTAGACAGGGTGATGGAGG + Intergenic
996192910 5:120567434-120567456 CAGAGTACACAGAGGGTGGTAGG + Intronic
997439168 5:133897175-133897197 CAGCGTAGCCACAGGGCTGTGGG - Intergenic
998035428 5:138911248-138911270 CACAGAAGTCAGAGAGATCTTGG - Intronic
999747503 5:154603516-154603538 CAAAATAGTCTGAGAGATGTTGG - Intergenic
1000443047 5:161285679-161285701 CAGAATGGTCAGAGAGATGCTGG - Intergenic
1001553388 5:172620275-172620297 CAGAGGAAGCAGAGGGATATTGG - Intergenic
1001855982 5:175011270-175011292 CAGAGTGTGCACAGGGATGTTGG + Intergenic
1002214951 5:177624544-177624566 CAGGGGAGGGAGAGGGATGTTGG + Intergenic
1003034634 6:2632277-2632299 CAGAAAAATCAGAGGGAGGTGGG + Intronic
1003848557 6:10198881-10198903 TAGAGTAGCCTGAGGGATTTGGG - Intronic
1003939056 6:11006041-11006063 CAGAGCAGTCAGAGGAAAGAAGG + Intronic
1005017345 6:21386745-21386767 GAAAGTAGCCAGAGGGATCTAGG + Intergenic
1005368129 6:25100233-25100255 CAGAGAAGTCAGATAGATGGTGG + Intergenic
1006893647 6:37451631-37451653 GAGAATAGCCAGAGGGATTTAGG + Intronic
1007708538 6:43806411-43806433 GAGAGGAGTCAGAGGGAGGAAGG + Intergenic
1011509831 6:88088318-88088340 CAGGGTGGTGAGAGGGCTGTGGG - Intergenic
1011593884 6:88997548-88997570 CAGAGTAGGCAAACTGATGTTGG + Intergenic
1013652961 6:112214684-112214706 CAAAGTAGTTGGAGGAATGTTGG + Intronic
1013868729 6:114729330-114729352 CAGAGTAATCAATGGAATGTTGG + Intergenic
1017647751 6:156554866-156554888 CAGAGAAGTTAGAGAGATCTGGG - Intergenic
1020340216 7:7101893-7101915 CTGAGTAGGCAGAGGGAGGTTGG - Intergenic
1021492973 7:21239939-21239961 CAGGTTAGTGAGAGGGAGGTTGG - Intergenic
1022202492 7:28130556-28130578 CACAGTAGTCACATGAATGTAGG + Intronic
1022538584 7:31114373-31114395 CAGAGTAGTGATGGGGGTGTTGG + Intergenic
1024899665 7:54304316-54304338 TAGAGAAGTTAGAGGGATATGGG + Intergenic
1026490333 7:70857596-70857618 CAGAGGAGTCAGAGGGTGGTTGG + Intergenic
1026844619 7:73691410-73691432 GTGAGGAGTCAGAAGGATGTGGG - Intronic
1028647577 7:93115506-93115528 CATAGAAGTCAGACTGATGTTGG + Intronic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1031312209 7:120212532-120212554 CAGAATGGTCAGATGGTTGTAGG - Intergenic
1031948824 7:127869825-127869847 AACAGTTGTCAGAGGGATGATGG - Intronic
1037463215 8:19134322-19134344 CAGAGTTGTCAGTTGTATGTAGG - Intergenic
1038092757 8:24272359-24272381 CAGTGTAGTCAGAAGGAAGGTGG - Intergenic
1039038443 8:33384485-33384507 TAGAGTAGGCAGAGGTATGGGGG - Intronic
1042226602 8:66519629-66519651 CTGAGAAGTCTGAGGGGTGTGGG - Intergenic
1043823657 8:84899032-84899054 GTGAGTAGACTGAGGGATGTTGG + Intronic
1044489317 8:92793311-92793333 CTGAAGAGTCAGAGGGAAGTAGG + Intergenic
1045481964 8:102600134-102600156 CAGGGAAGGCAGAGGGAAGTAGG - Intergenic
1048880784 8:138870985-138871007 CAGGCCAGGCAGAGGGATGTGGG + Intronic
1048933843 8:139339108-139339130 CCAAGCAGTCAGAGGGATGCCGG + Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049700189 8:144007359-144007381 CAGACTAATCAAAGGGATATTGG + Intronic
1051087850 9:13371647-13371669 CAAAGCACTCAGAGTGATGTAGG + Intergenic
1052975736 9:34408632-34408654 CAGAGGAGGCAAAGGGTTGTGGG - Intronic
1053316740 9:37058599-37058621 CAGAGCAGTCTGAGTGAAGTGGG - Intergenic
1053789702 9:41678135-41678157 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1054155442 9:61636618-61636640 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1054178040 9:61889825-61889847 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1054475227 9:65567728-65567750 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1054659489 9:67690999-67691021 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1056954533 9:91071761-91071783 CAGAAAAGGCAGAGGGATGTGGG + Intergenic
1057065660 9:92048259-92048281 CTGAGTGGTCAGAAAGATGTAGG - Intronic
1057368016 9:94442367-94442389 TAGAAGAGTCAGAGGGAAGTGGG - Intronic
1057697316 9:97333684-97333706 CATAGTAGTCTGATGGCTGTTGG + Intronic
1057791422 9:98127459-98127481 CAGAGTGGGCAGAGGGACCTGGG + Intronic
1059368629 9:113807173-113807195 TAGACTGGTCAGAGGGAAGTGGG - Intergenic
1060310286 9:122453429-122453451 CAGAGTACTAAGAGGGACTTAGG - Intergenic
1061664618 9:132153267-132153289 CAGAGTGCTCAGAGGGGTGTAGG - Intergenic
1187741832 X:22364430-22364452 CAAAATAGACAGAGAGATGTTGG - Intergenic
1187802546 X:23080175-23080197 CAGAGTAGTCAAAGGAATTGGGG + Intergenic
1193831690 X:86295785-86295807 CAGAGGAGCCAGGGGGATTTGGG + Intronic
1196002067 X:110796327-110796349 CAGGGGAGTCAGAGGGTAGTCGG - Intergenic
1197703861 X:129619637-129619659 TAGAGTAGTTAAAGGTATGTGGG - Intergenic
1197703977 X:129620588-129620610 CAGAGGAGCCAGAGAGGTGTGGG - Intergenic
1198690523 X:139279117-139279139 AAGGGTAGTGAGAGGGAGGTGGG + Intergenic