ID: 1162386301

View in Genome Browser
Species Human (GRCh38)
Location 19:10362251-10362273
Sequence CAACCAGGAGGTACGATGAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 52}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162386301_1162386308 18 Left 1162386301 19:10362251-10362273 CCTATCATCGTACCTCCTGGTTG 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1162386308 19:10362292-10362314 CAGAGAGAAGCAGTCATCCCCGG 0: 1
1: 0
2: 2
3: 36
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162386301 Original CRISPR CAACCAGGAGGTACGATGAT AGG (reversed) Exonic
900551120 1:3256107-3256129 TAACCAGGAGGGACGAGGAGAGG + Intronic
911180199 1:94853698-94853720 GAAACAGGAGGTAAGATCATGGG + Intronic
912445546 1:109733369-109733391 GTACCAGGAGGTAGGATCATGGG - Intronic
922998485 1:229985606-229985628 CGCACAGGAGGTAGGATGATAGG - Intergenic
1071343803 10:84672358-84672380 CAACCAGGAATTAAGATAATTGG - Intergenic
1071626806 10:87180185-87180207 CAACCAGTATATACGATGTTGGG - Exonic
1077053444 11:578120-578142 CAACCAGGAGGTCCTAAGCTAGG + Intronic
1094586765 12:31784190-31784212 CTACCAGGAGGAAGGATCATTGG - Intergenic
1097227162 12:57484393-57484415 TAACTAGGAGGTACGATGGCAGG + Intronic
1106223966 13:27771328-27771350 CAACCAGGTGGCACCAAGATCGG - Intergenic
1106436019 13:29723317-29723339 AAACCAGGAGTTACCATAATTGG - Intergenic
1110780210 13:79456496-79456518 AAACCAGGAGCTACAAAGATGGG + Intergenic
1118438829 14:65794549-65794571 CAACCCAGAGGGACGATGATGGG - Intergenic
1118738927 14:68724178-68724200 CAACCAGGAGGGAGGATGGGAGG - Intronic
1129178332 15:73855959-73855981 CAGCCAGCAGGTACCATGGTGGG - Intergenic
1130346440 15:83051108-83051130 GAAAAAGGAGGTATGATGATAGG + Intronic
1132418002 15:101638143-101638165 CAAACAGGAGGGACTCTGATGGG - Intronic
1141702429 16:85648644-85648666 CCCCCAGGGGGGACGATGATAGG - Exonic
1143178220 17:4968570-4968592 CGACCAGGAGGGACGAGGAGAGG + Exonic
1143633604 17:8152123-8152145 CAAGCTGGAGGTAAGATGAGTGG + Intronic
1155398719 18:25415453-25415475 CAAGAAGGAGGTACCAAGATGGG - Intergenic
1158395113 18:57073206-57073228 CATCCAGGAGGTAAGAGGACAGG - Intergenic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
926239068 2:11071009-11071031 ACAGCAGGAGGTACAATGATCGG + Intergenic
929088742 2:38194093-38194115 CAACCAGGGGGAGCAATGATGGG - Intergenic
930630819 2:53753059-53753081 CAACCAGGAGGTAAAAGGAAGGG + Intronic
932212348 2:69943164-69943186 AAACCAGTAGGTGGGATGATGGG - Intergenic
1170091508 20:12594140-12594162 CAAACGGGAGGTTGGATGATGGG - Intergenic
1172774969 20:37402030-37402052 CGACCAGGAGTGACGAGGATTGG + Intronic
1172792105 20:37512835-37512857 CAACCAGCAGGTACTATGCCAGG + Intronic
1173289074 20:41698636-41698658 AAACCAGGAGGCAGGATCATTGG - Intergenic
1173932845 20:46836048-46836070 CAAAGAGGAGGTGAGATGATGGG - Intergenic
1182241679 22:28921025-28921047 CAAACAGGAGGGAAGATGAAAGG + Intronic
951670039 3:25170921-25170943 CAGACAGGAGGTAGCATGATTGG - Intergenic
955820337 3:62889768-62889790 CAAGCAGGTGGTATCATGATAGG - Intergenic
956697874 3:71934011-71934033 CAACCAGGAGCTAGGAAGAGAGG + Intergenic
959685279 3:109139327-109139349 CAACCAGGAGTTAAGAAGCTGGG + Intergenic
964429440 3:156589368-156589390 CAACCAGATGGTAAGATGCTAGG + Intergenic
971257551 4:25029119-25029141 CAACCAGGAGGCAAGATGCTTGG + Intronic
983689833 4:170454887-170454909 AAACCATGAGGAAAGATGATCGG - Intergenic
1008078435 6:47170054-47170076 CAAACAGGAGGAGCCATGATAGG + Intergenic
1017293843 6:152771871-152771893 GAAACAGGAGATACTATGATGGG + Intergenic
1023381685 7:39614425-39614447 CAGCCATGAGGTATGAGGATTGG + Intergenic
1032465892 7:132144778-132144800 CACCCAGGAGGTACTTGGATGGG + Intronic
1037699755 8:21263674-21263696 CACCCAGGAGTTACTCTGATGGG - Intergenic
1048818256 8:138354480-138354502 CACCCAGGAGGTATCAGGATGGG - Intronic
1053325392 9:37142292-37142314 CAACCATGAGGTACAATCAAAGG - Intronic
1057768498 9:97944808-97944830 CAACCAGAAGTTATGAAGATAGG - Intronic
1057878858 9:98778144-98778166 AACCCAGGAGGTAGGATGAAGGG + Intronic
1061390313 9:130314134-130314156 CAACCAGGAGCTTCCAGGATGGG - Intronic
1061471763 9:130832496-130832518 CAGCCAGGAGGTAGGAAGGTAGG - Intronic
1193689025 X:84616813-84616835 CAACTAGGAGTTATGATGAATGG - Intergenic
1198937753 X:141916679-141916701 ATACCAGGAGGTAAAATGATAGG + Intergenic
1199579102 X:149343833-149343855 CAACCAGGAGCTCCGAAGTTAGG - Intergenic
1199658360 X:150021481-150021503 CAACCAGCAGGTACTGAGATAGG + Intergenic