ID: 1162386308

View in Genome Browser
Species Human (GRCh38)
Location 19:10362292-10362314
Sequence CAGAGAGAAGCAGTCATCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 338}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162386300_1162386308 19 Left 1162386300 19:10362250-10362272 CCCTATCATCGTACCTCCTGGTT 0: 1
1: 0
2: 0
3: 1
4: 89
Right 1162386308 19:10362292-10362314 CAGAGAGAAGCAGTCATCCCCGG 0: 1
1: 0
2: 2
3: 36
4: 338
1162386299_1162386308 20 Left 1162386299 19:10362249-10362271 CCCCTATCATCGTACCTCCTGGT 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1162386308 19:10362292-10362314 CAGAGAGAAGCAGTCATCCCCGG 0: 1
1: 0
2: 2
3: 36
4: 338
1162386297_1162386308 21 Left 1162386297 19:10362248-10362270 CCCCCTATCATCGTACCTCCTGG 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1162386308 19:10362292-10362314 CAGAGAGAAGCAGTCATCCCCGG 0: 1
1: 0
2: 2
3: 36
4: 338
1162386295_1162386308 30 Left 1162386295 19:10362239-10362261 CCCAGAGGTCCCCCTATCATCGT 0: 1
1: 0
2: 0
3: 4
4: 35
Right 1162386308 19:10362292-10362314 CAGAGAGAAGCAGTCATCCCCGG 0: 1
1: 0
2: 2
3: 36
4: 338
1162386296_1162386308 29 Left 1162386296 19:10362240-10362262 CCAGAGGTCCCCCTATCATCGTA 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1162386308 19:10362292-10362314 CAGAGAGAAGCAGTCATCCCCGG 0: 1
1: 0
2: 2
3: 36
4: 338
1162386301_1162386308 18 Left 1162386301 19:10362251-10362273 CCTATCATCGTACCTCCTGGTTG 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1162386308 19:10362292-10362314 CAGAGAGAAGCAGTCATCCCCGG 0: 1
1: 0
2: 2
3: 36
4: 338
1162386306_1162386308 6 Left 1162386306 19:10362263-10362285 CCTCCTGGTTGGGGCAGGCAACA 0: 1
1: 0
2: 0
3: 23
4: 163
Right 1162386308 19:10362292-10362314 CAGAGAGAAGCAGTCATCCCCGG 0: 1
1: 0
2: 2
3: 36
4: 338
1162386307_1162386308 3 Left 1162386307 19:10362266-10362288 CCTGGTTGGGGCAGGCAACAGCG 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1162386308 19:10362292-10362314 CAGAGAGAAGCAGTCATCCCCGG 0: 1
1: 0
2: 2
3: 36
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162386308 Original CRISPR CAGAGAGAAGCAGTCATCCC CGG Exonic
900080151 1:850589-850611 CAAAGAGACACAGTCATTCCTGG - Intergenic
900980758 1:6044902-6044924 CAGAGAGGAGCAGTGGACCCAGG + Intronic
902979568 1:20113298-20113320 CAGGGAGAAGGAGTCAGCCTGGG + Exonic
903337998 1:22637628-22637650 CACAGAGCACCAGCCATCCCCGG - Exonic
904323361 1:29710963-29710985 CAGAGGGAAGAAGTGATCTCTGG - Intergenic
904340325 1:29830045-29830067 CTGAGAAATGCAGCCATCCCTGG + Intergenic
905017694 1:34788855-34788877 AAGATGGAAGCAGTCATCCCGGG - Intronic
905817665 1:40964610-40964632 CAGAGACACGCCCTCATCCCGGG - Intergenic
906157901 1:43624847-43624869 CAGAGGGATGCAGGGATCCCTGG + Intergenic
907523784 1:55041693-55041715 CAGAGAGAGGAGGTCACCCCAGG + Intronic
907667980 1:56450009-56450031 CAGAGAAATGAAGTCATCCTGGG + Intergenic
908068290 1:60431791-60431813 CAGAGAGGAGATGTCATCACTGG - Intergenic
908331371 1:63074214-63074236 CAGAGAGCAGCAGAGATCTCGGG - Intergenic
909863569 1:80637687-80637709 AAGAGGGGAGCAGGCATCCCTGG - Intergenic
911585781 1:99689077-99689099 CAGAGAGAAACGGTGACCCCTGG + Exonic
911687488 1:100793640-100793662 CAGAAAGAAACAGTCCTTCCTGG + Intergenic
912864861 1:113247957-113247979 CACAGAGAAACAATCACCCCTGG + Intergenic
912995710 1:114530742-114530764 CTGGGAGAAGCAGTCAACCAAGG + Intergenic
913502418 1:119483352-119483374 CTGAGAAAAGGAGTCATGCCTGG + Intergenic
913517729 1:119618624-119618646 CTGAGAAAAGGAGTCATGCCTGG + Intergenic
913652995 1:120935929-120935951 CAGAGGGAAGCAATCTTCCCTGG - Intergenic
914168109 1:145193111-145193133 CAGAGGGAAGCAATCTTACCTGG + Intergenic
914518686 1:148396002-148396024 AAGAGGGAAGCAATCTTCCCTGG - Intergenic
914643176 1:149630072-149630094 AAGAGGGAAGCAATCTTCCCTGG - Intergenic
915656532 1:157365472-157365494 AAGAGGGGAGCAGACATCCCTGG + Intergenic
915672754 1:157504099-157504121 AAGAGGGGAGCAGACATCCCTGG - Intergenic
915752712 1:158227122-158227144 CAGAGAGAAGCAGTCTCTCCTGG - Intergenic
915824097 1:159057018-159057040 AAGAGGGGAGCAGGCATCCCTGG + Intergenic
916510546 1:165469107-165469129 CAGCCAGAAGCAGTCCTCCCTGG + Intergenic
916748419 1:167702341-167702363 CTGAAAGAAGGAGTCATCCTGGG + Intronic
918434889 1:184501050-184501072 CAGAGAGAGGCAGAAAGCCCTGG + Intronic
920559944 1:206931856-206931878 CAGAGAGAAGCAGCCCAGCCTGG - Intronic
922678254 1:227566611-227566633 CAGGGAGAAGCAGTACTACCTGG - Intronic
923064055 1:230501892-230501914 AAGAGGGAAGGAGTCTTCCCTGG + Intergenic
923225135 1:231932135-231932157 CAGAGAGAAGTAGCCCTACCAGG + Intronic
924811868 1:247410007-247410029 CCCAGAGGAGCAGTCACCCCTGG + Intergenic
1063232780 10:4081938-4081960 CAGAGAGCAGCAGTGATCTGAGG - Intergenic
1063950564 10:11218711-11218733 CAGAGAGAAGCAGTGAAACTGGG - Intronic
1064240298 10:13621403-13621425 CAGAGGGATGCAGTCACCCTAGG - Intronic
1066030528 10:31418626-31418648 CAGAGAGAAGCAAGCAACCAAGG - Intronic
1067575109 10:47403998-47404020 CAGAGAGCAGCAGCCAGCACAGG - Intergenic
1068321232 10:55419536-55419558 CAGATAGTAGCAGTTATCCATGG + Intronic
1070490087 10:76967864-76967886 CTGAGGGAGGCAGTCATCCTGGG - Intronic
1071926494 10:90415610-90415632 AAGAGGGGAGCAGGCATCCCTGG - Intergenic
1072662269 10:97370337-97370359 CAGAGAGGAGCAGCCTGCCCAGG + Intronic
1073287508 10:102397623-102397645 CAGGGAGAAGGAGCCATCACTGG - Exonic
1075048069 10:119161802-119161824 CAGAGCCAAGCTGTCAGCCCAGG + Intronic
1076017053 10:127036078-127036100 CAAATGGCAGCAGTCATCCCAGG - Intronic
1076567462 10:131408553-131408575 CAGAGAGATGCAGACAGCCAAGG - Intergenic
1077047528 11:553004-553026 CAGAAAGAAGGAGCCACCCCAGG + Intronic
1078542659 11:12224189-12224211 CAGACGGAAGAAGTCATTCCAGG - Intronic
1081645618 11:44788169-44788191 CAGGGAGCAGCCCTCATCCCAGG + Intronic
1081865543 11:46357718-46357740 CTGAAAGAAGCAGGCCTCCCAGG + Intronic
1082695050 11:56353273-56353295 CAGAGAGAAGGAGATATACCAGG + Intergenic
1084518414 11:69648622-69648644 AAGAAAGACACAGTCATCCCAGG - Intronic
1084685394 11:70691400-70691422 CAGAGAAGAGCAGTACTCCCTGG + Intronic
1085332940 11:75668150-75668172 CATAGAGACGCAGCCAGCCCAGG - Exonic
1086208509 11:84289703-84289725 CAGAGTGAGACAGTCATGCCTGG - Intronic
1086589697 11:88498345-88498367 CAGATATAAGCAGTTTTCCCAGG + Intergenic
1087486576 11:98764652-98764674 AAGAGAGGAGCAGACATCCCTGG - Intergenic
1088365470 11:109035880-109035902 CAGAGAGATGCAATGATCACAGG - Intergenic
1089104029 11:115987282-115987304 CAGAGAAGATCAGTCATCCTTGG + Intergenic
1090352012 11:126113840-126113862 CAGAGAGCAGCAGGCAGGCCAGG + Intergenic
1092898976 12:13040841-13040863 GAGAGAAAGGCAGTCTTCCCTGG + Intergenic
1093374605 12:18409608-18409630 CAGAGAATGGCAGTCATCCTCGG + Intronic
1093800434 12:23365673-23365695 AAGAGAGAAGAAGTCTTCTCTGG + Intergenic
1095377510 12:41547870-41547892 CAGTGAGAAGCAGCCAACCTGGG + Intronic
1095939120 12:47714504-47714526 GAGAGAGAAGCAGTAGGCCCAGG + Intronic
1096772127 12:53942198-53942220 GAGAGAGAAGCAGAAATTCCAGG + Intronic
1098805556 12:75016789-75016811 AAGAGGGGAGCAGACATCCCTGG + Intergenic
1100135307 12:91545927-91545949 CACAGAGAGGAAGGCATCCCTGG + Intergenic
1101806977 12:108072569-108072591 CAGGGACAAGCATTCATCCCAGG - Intergenic
1102540535 12:113616122-113616144 CAGAGAGCAGCACTGATACCTGG + Intergenic
1103827170 12:123748881-123748903 GAGACAGAAGCAGCCTTCCCAGG - Intronic
1105583982 13:21726861-21726883 CAGAGAGCAGGAGTCCTTCCAGG - Intergenic
1105709253 13:22990321-22990343 CTGGGAGAAGCAGTGATCCTAGG + Intergenic
1106562101 13:30855743-30855765 CACAGAGAGGCAGGCAGCCCAGG - Intergenic
1106700988 13:32228472-32228494 GAGAGAGGACCAGTCATCCCCGG + Exonic
1107443680 13:40450739-40450761 CACTGAGAAGTAGTCATCACTGG + Intergenic
1107726890 13:43308017-43308039 GAGAGGGAAGCAGGCATGCCTGG - Intronic
1108328698 13:49361800-49361822 CAGAGAGGGGCACTCATCCCAGG - Intronic
1109012977 13:56974337-56974359 AAGAGGGAAGCAGGCATCCGTGG - Intergenic
1109085341 13:57964285-57964307 CAAAGAGAAACAATCATCTCTGG - Intergenic
1109293609 13:60504155-60504177 CTGAGATAATCACTCATCCCTGG + Intronic
1109388817 13:61667387-61667409 AAGAGATAAGCAGGCGTCCCTGG + Intergenic
1109745387 13:66617322-66617344 AAGAGAGTAGCAGGCATCCGTGG - Intronic
1110404797 13:75138102-75138124 CAGAAATAAGCAATCATCACTGG + Intergenic
1113783183 13:112988199-112988221 CAGAGAGCATCATGCATCCCGGG - Intronic
1114773043 14:25450777-25450799 AAGAGAGAAGCAAGCATACCTGG + Intergenic
1115301986 14:31894834-31894856 TAGAGGGATGCAGTCAGCCCTGG - Intergenic
1117795484 14:59388982-59389004 CAGAGGGAAGGAGTCTCCCCTGG + Intergenic
1118096864 14:62546766-62546788 CAGAGGGAAGGAGTCTTTCCTGG - Intergenic
1118698956 14:68414146-68414168 CTGAGGGAAGGAGTCCTCCCTGG + Intronic
1118921965 14:70157613-70157635 TAGAGAGAAGCAGAGATGCCAGG + Intronic
1119397487 14:74337841-74337863 CAGGGAAAAGCAGGCAGCCCAGG - Intronic
1119458919 14:74781769-74781791 GAGAGAGAAGGAGGCATCCCTGG - Exonic
1119526283 14:75325008-75325030 CAGATAGAAGCAGTCAGGTCTGG - Intergenic
1119847238 14:77839614-77839636 CAGAGAGCAGCAGTGATGGCAGG + Intronic
1119894255 14:78206488-78206510 GAGAGAGAAGCATTCTTCTCAGG - Intergenic
1120634046 14:86929302-86929324 TAAAGAAAAGGAGTCATCCCCGG + Intergenic
1121622117 14:95357435-95357457 CAGAGAACAGCAGTGATCCAGGG - Intergenic
1122115746 14:99526484-99526506 CACAGATAAGCCATCATCCCAGG + Intronic
1122438636 14:101715542-101715564 CAGAGGGAGGCAGGCAGCCCAGG + Intergenic
1122889709 14:104726615-104726637 AAGAAAGACGCAGTCTTCCCTGG - Intronic
1124034115 15:26038449-26038471 CAGACATAAGCCGCCATCCCTGG + Intergenic
1124551378 15:30683876-30683898 CTGTGAGGAGCAGGCATCCCTGG + Intronic
1124679869 15:31721789-31721811 CTGTGAGGAGCAGGCATCCCTGG - Intronic
1125324074 15:38518186-38518208 AAGAGAGCAGCAGTCACCGCTGG + Intronic
1125518034 15:40333837-40333859 CAGAGAGCAGCAGCCATGGCAGG + Exonic
1125518537 15:40336025-40336047 CAGAGAGGAGCAGCCATGGCAGG + Intronic
1126149051 15:45505900-45505922 CAGAGATAAGCCATCATGCCTGG - Intronic
1128526392 15:68415098-68415120 GAGAGACAAGCAGTCCACCCAGG - Intronic
1128715484 15:69904721-69904743 CAAGGAGCAGCAGTAATCCCCGG - Intergenic
1128868774 15:71136597-71136619 CAAACAAAAGCACTCATCCCTGG - Intronic
1129109390 15:73328858-73328880 CAGAGACTAGGAGCCATCCCTGG - Intronic
1129261307 15:74369353-74369375 CAAAGAAAAGCAGTCTTCCAAGG + Intergenic
1129296288 15:74602121-74602143 CAGAGAGAAGAAGGCAGACCAGG + Intronic
1129659662 15:77545979-77546001 CAGGGAGAAGCAGGCTTCCAGGG + Intergenic
1129944531 15:79527442-79527464 GAGGGAACAGCAGTCATCCCAGG - Intergenic
1131973068 15:97911855-97911877 CAGAGAGAAGATGCCCTCCCTGG - Intergenic
1132333206 15:101026621-101026643 CAGTGACAGGCAGTCAGCCCAGG - Intronic
1133421941 16:5653568-5653590 CAGGGAGAGGCAATCACCCCAGG - Intergenic
1133635615 16:7662137-7662159 CGGAGAGAAGAATTGATCCCAGG - Intronic
1134629684 16:15747951-15747973 CACAGAGCAGAAGTCACCCCGGG + Intronic
1135610896 16:23866185-23866207 CAGAAAGAAACAGTCAACCAAGG - Intronic
1138517136 16:57542397-57542419 CACAGAGGAGCAGCCACCCCAGG + Intergenic
1138553763 16:57760649-57760671 CAGTGAGACCCAGTCACCCCAGG - Intronic
1139232436 16:65296865-65296887 CAGAGAGCATCAGGCAGCCCAGG - Intergenic
1139295806 16:65899585-65899607 CAGAGAGAAGGTGTCAGCACAGG + Intergenic
1139683396 16:68582799-68582821 CAGGGAGAAGCAGCCTTCCCAGG - Intergenic
1140165298 16:72544111-72544133 AAGAGAGCAGCAGACCTCCCAGG + Intergenic
1141081405 16:81056397-81056419 CAGAGAAAAGCAGACTTCGCAGG + Intronic
1141228953 16:82146464-82146486 CAGAAGAAAACAGTCATCCCTGG + Intergenic
1142168891 16:88609952-88609974 CAGGGAGACGCAGGCACCCCTGG - Intronic
1143220145 17:5254887-5254909 CAGAAAGAAGCAGACATAGCAGG - Intergenic
1143241828 17:5450155-5450177 CAGAGACAAGCAGCTATCGCTGG + Intronic
1144767247 17:17739532-17739554 CAGTAAGCAGCAGGCATCCCAGG - Intronic
1145306381 17:21677586-21677608 CAGAGAGAAGCAATCATTACAGG + Intergenic
1146039149 17:29434421-29434443 AAGAGGGAAGCAGGCCTCCCTGG + Intronic
1147664685 17:42139065-42139087 CAGAGAGGAGCAGTCAGGGCTGG + Intronic
1148732660 17:49846949-49846971 CAGAAAGAAGCAGGCATCAGTGG + Intronic
1149375864 17:56043277-56043299 CAGAGAAGAGCAGTCATGCAAGG + Intergenic
1150361040 17:64534360-64534382 CAGAGGGCAGCAGTGATCCTGGG - Intronic
1151868466 17:76820537-76820559 GAGAGAGACGCTGTCATCCAAGG - Intergenic
1155611089 18:27668430-27668452 CAGAGGGAAACAATCACCCCTGG + Intergenic
1155697995 18:28706895-28706917 TATAGAGAATCAGTCATCCCTGG - Intergenic
1156698501 18:39796096-39796118 AAGAGGGGAGCAGGCATCCCTGG + Intergenic
1157604481 18:48917282-48917304 CAGAGTGATGCTGTCATCCAGGG + Intergenic
1157905882 18:51569736-51569758 CAGTGAGAAGCACGCACCCCAGG - Intergenic
1158151893 18:54383042-54383064 AAGAGGGGAGCAGGCATCCCTGG + Intronic
1158334441 18:56400333-56400355 CAGAGAGAAGAAATCATACATGG + Intergenic
1158641350 18:59206690-59206712 AAGAGGGAAGCAGGTATCCCTGG - Intergenic
1159757651 18:72385744-72385766 CAGAGTGAAGCATCCATCCCAGG - Intergenic
1162386308 19:10362292-10362314 CAGAGAGAAGCAGTCATCCCCGG + Exonic
1163015483 19:14451630-14451652 ATGAGAGAAGCAGTCCTTCCAGG - Intronic
1163580257 19:18134737-18134759 GAGAGAGGAGGAGGCATCCCGGG - Intronic
1164554718 19:29242789-29242811 TTGAGAGAAGCAGACATCCACGG + Intergenic
1164902266 19:31938338-31938360 AAGAGAGAAGAAGTCGTCCCCGG + Intergenic
1165083519 19:33326239-33326261 CTGGGAGTTGCAGTCATCCCAGG - Intergenic
1165476931 19:36036051-36036073 CAGAGAGAGGCAGTCAGCTCAGG + Intronic
1166667875 19:44692148-44692170 CAGAGGGAAGCAGTGTGCCCTGG - Intergenic
1168046883 19:53800517-53800539 CAGAGAGCAGAAGGCATGCCAGG + Intronic
1168330856 19:55567342-55567364 CAGGGAGAATCTGTCATACCAGG + Intergenic
925046247 2:774633-774655 CAGCAGGAAGCAGTGATCCCTGG + Intergenic
926268727 2:11348417-11348439 TAGAAAGGAGCAGTCAACCCTGG - Intergenic
927219553 2:20694664-20694686 CAGAGAGAAGCAGGGTTCACGGG - Intronic
927637776 2:24828570-24828592 CAGAGACTAGCTGTCATCACGGG - Intronic
927944047 2:27123983-27124005 CAGAGAGAAGGTGTCTGCCCAGG - Exonic
928131988 2:28658599-28658621 CAGAGGGAAGTAGTAAGCCCAGG + Intergenic
929063074 2:37943085-37943107 CTGAGAGAAGCATTTCTCCCTGG + Intronic
929465859 2:42143162-42143184 CAGAGAGGAGCAGCCATGGCGGG - Intergenic
929687074 2:44044404-44044426 TAGAGGGAAGCAGCCAGCCCTGG + Intergenic
929727439 2:44445363-44445385 AAGAGGGGAGCAGGCATCCCTGG - Intronic
930353762 2:50291513-50291535 TCTAGAGAAGCATTCATCCCTGG + Intronic
930979702 2:57508758-57508780 CACAGAGAAGCTCTAATCCCTGG + Intergenic
931059923 2:58516109-58516131 CAGTGAGAAGCAGTCATATTTGG - Intergenic
932355922 2:71068498-71068520 CTGAGGGACGCAGCCATCCCCGG + Exonic
933068621 2:77831486-77831508 CAGAGAAAAGAAGTCATCTGAGG - Intergenic
933130979 2:78673725-78673747 AAGAGGGAAGCAGGCATCCCTGG + Intergenic
933539551 2:83620934-83620956 CACTGAGAAGCAGTCCTCCAGGG + Intergenic
935066520 2:99652974-99652996 GAGAGGGAAGCACCCATCCCTGG - Intronic
936522364 2:113219321-113219343 CAGACAGAAGCAGTGATCCAAGG - Intronic
937049716 2:118878588-118878610 TAGAGAGGAGCAGTCAGCTCAGG + Intergenic
937338535 2:121076513-121076535 CAGAGAGGAGCATTCAATCCAGG + Intergenic
937885236 2:126895007-126895029 GAGAGAGGAGCAGACGTCCCAGG + Intergenic
938538952 2:132269819-132269841 CAGAGAGAAGCAGACAGACAGGG + Intergenic
939497701 2:142943725-142943747 CTCAGAGAAGCAATAATCCCTGG + Intronic
940657115 2:156501223-156501245 CAGAAAGAGGCAGTCTTCTCTGG - Intronic
941249825 2:163147980-163148002 AAGAGGGGAGCAGCCATCCCTGG - Intergenic
942191869 2:173478336-173478358 GAGAGAGAAGCAGACGTCCAAGG + Intergenic
943906272 2:193503480-193503502 AAGAGGGGAGCAGGCATCCCTGG + Intergenic
944215877 2:197255194-197255216 CAGAGAGAAGCAGACACCAGAGG + Intronic
946297250 2:218794865-218794887 AAGAGAGGAGCAGACATCTCTGG + Intronic
946432759 2:219634366-219634388 CAAAGAGAAGCAGTCAAGGCAGG - Intronic
947365566 2:229391083-229391105 CAGAGAACAACAGTCATCCTTGG - Intronic
948567114 2:238894306-238894328 TAGAGAGGAGGAGTCATCTCGGG - Intronic
948624455 2:239260608-239260630 CACAGAGAAGCGGTACTCCCAGG - Intronic
1169145571 20:3250103-3250125 CAGGGACAGGCAGTCCTCCCGGG - Exonic
1169948150 20:11011527-11011549 CTGAGAGAAGCAGTGACCTCTGG + Intergenic
1170302650 20:14902914-14902936 CACAGAGAAGCAGTAATACAAGG + Intronic
1170955898 20:20979096-20979118 CAGAGGGAAGCATTTATCCACGG + Intergenic
1171267341 20:23782562-23782584 CAGAGGGAAGCACTCACCCATGG + Intergenic
1171280199 20:23889884-23889906 CAGAGGGAAGCATTCACCCACGG + Intergenic
1171285823 20:23937502-23937524 CAGAGGGAAGCATTCACCCACGG + Intergenic
1171867864 20:30501754-30501776 CAGAGAGAAGCAGACAGACAGGG + Intergenic
1172044736 20:32072244-32072266 AAAAGAGAAGCAGTCATGCTAGG + Intronic
1172115419 20:32570681-32570703 CAGAGGTAAGAAGTCAGCCCAGG - Intronic
1172418878 20:34797204-34797226 CAGAGGGAAGGAGTCTTTCCCGG - Intronic
1173198919 20:40939384-40939406 CAGAGAAAATCAGTCTGCCCAGG - Intergenic
1173604792 20:44324347-44324369 CAGTGGGAAGCAGTCATTCCAGG + Intergenic
1175875339 20:62226870-62226892 ACGAGAGAAGGAGTGATCCCGGG + Intergenic
1176698634 21:10013934-10013956 CAGAGAGAATCAGTCTTTCCCGG - Intergenic
1178294227 21:31395369-31395391 CAGAGAGAAGCAGTCCACTGGGG + Intronic
1178619585 21:34161942-34161964 AAGAGAGGAGCAGGTATCCCTGG + Intergenic
1179171152 21:38973829-38973851 CAGAGAGGACCAGTCACCCGGGG - Intergenic
1180917376 22:19498675-19498697 CAGAGAGATGAAGTGATACCAGG + Intronic
1184100512 22:42339711-42339733 CAGTGAGATTCAATCATCCCAGG + Intronic
1184196885 22:42935802-42935824 CAGAGAGTCCCAGGCATCCCAGG + Intronic
1184667505 22:45996609-45996631 CAGAGTCAAGCAGCCCTCCCTGG - Intergenic
949828497 3:8187792-8187814 CAGAGAGAAGCAGAGATGCCTGG - Intergenic
950694053 3:14683911-14683933 CAAAGTGAAGGTGTCATCCCAGG + Intronic
951958752 3:28290732-28290754 CAGAGATAACCAATCATCCTTGG + Intronic
952193327 3:31046766-31046788 AAGAGTGGAGCAGGCATCCCTGG - Intergenic
952195956 3:31075603-31075625 CAGAGATAAGCAGTCTTTTCAGG + Intergenic
952792450 3:37210974-37210996 CAGAGAGATGCAGTAATGCAAGG + Intergenic
953606412 3:44415789-44415811 CAGAGAGTTCCAGCCATCCCGGG - Intergenic
954511080 3:51126371-51126393 CAGAGAGAAGTAATCATGCTTGG - Intronic
954930128 3:54273908-54273930 CATAGAGACCCAGTAATCCCTGG + Intronic
954974437 3:54679573-54679595 CAGAGATAAGGGGTCATCTCAGG - Intronic
958744282 3:98113918-98113940 AAGAGGGGAGCAGGCATCCCTGG - Intergenic
959431610 3:106260886-106260908 AAGAGGGAAACAGGCATCCCTGG - Intergenic
960389241 3:117056598-117056620 AAAAGAGAAGCAGTCCTTCCTGG + Intronic
961794348 3:129398918-129398940 CAGAGTGAAGCAGGCAGCCGGGG - Intergenic
961938208 3:130608899-130608921 CAGGGAACAGCAGGCATCCCAGG + Exonic
962627464 3:137240106-137240128 CAAAGAGAAGAAATCATCTCAGG - Intergenic
963734027 3:148999513-148999535 CAGAGAGAAGCAGCCTCCCAAGG - Intronic
965009147 3:163063331-163063353 CAGGGAGATGCAGTCCTTCCTGG - Intergenic
965352310 3:167628825-167628847 CTGAGAGAAAAAGTCATGCCTGG + Intronic
965519873 3:169661632-169661654 CCGCGAGATGCTGTCATCCCAGG - Intronic
966196906 3:177322893-177322915 CTAAGAGAAGCATTCTTCCCCGG - Intergenic
966236174 3:177704245-177704267 CAGGCAGCAGCAGTCATCCTGGG - Intergenic
967531140 3:190549937-190549959 AAGAGGGGAGCAGGCATCCCTGG + Intronic
968381470 4:100364-100386 AAGAGGGGAGCAGGCATCCCTGG - Intergenic
968926543 4:3551421-3551443 CAGAAAGAAGGAGGCCTCCCCGG - Intergenic
971237421 4:24855262-24855284 CATAGAAAATCATTCATCCCTGG + Intronic
973680857 4:53317765-53317787 CAGAGAGAAGAAGCCCTCCTAGG - Intronic
974823101 4:67092952-67092974 GGGAGAGCATCAGTCATCCCTGG - Intergenic
975322410 4:73023709-73023731 GAGAGAGAAGCAGTGTTCCTAGG + Intergenic
979837796 4:125394853-125394875 CAAACAGAAGCAGTCATCCCTGG - Intronic
980272923 4:130610473-130610495 AAGAGGGAAGGAGTCTTCCCTGG + Intergenic
980315368 4:131192576-131192598 CAGAGAAAAGCAATCTTCACAGG - Intergenic
980979441 4:139641628-139641650 CTGATAGAAGCAGTCCTTCCTGG + Intergenic
982560479 4:156923306-156923328 GAGAAAGAAGCAGCCATGCCAGG - Intronic
982639109 4:157934340-157934362 AAGAGAGAAGCAATCATTCTGGG - Intergenic
984150152 4:176119863-176119885 CTAAGAGAAGCAGGGATCCCTGG - Exonic
984755103 4:183318793-183318815 CACAGAGAGGCAGCCGTCCCAGG + Exonic
986213733 5:5698696-5698718 AAGAGGGGAGCAGTCATCCCTGG - Intergenic
988329608 5:29818421-29818443 CAGAGAGATGGAGGCAACCCAGG - Intergenic
988899655 5:35718444-35718466 AAGAGGGGAGCAGGCATCCCTGG + Intronic
989653008 5:43714484-43714506 CACAGAGCAGCAGTCATGCCTGG - Intergenic
989692158 5:44157756-44157778 AAGAGGGAAGTAGGCATCCCTGG - Intergenic
990281363 5:54254146-54254168 CACAGAGAATCAGTGATCCACGG - Intronic
991038993 5:62157291-62157313 CAGAGGGAAGCAGTAATTTCTGG + Intergenic
992806167 5:80339917-80339939 CAGTGAGCTGCAGTCATGCCTGG + Intergenic
993154988 5:84211316-84211338 CAGAGAGGAGCAGACATTACAGG - Intronic
993190954 5:84680032-84680054 AAGAAAGAAGCAGATATCCCAGG + Intergenic
995830000 5:116344782-116344804 AAGAGGGAAGCAGGCGTCCCTGG + Intronic
996575383 5:124972406-124972428 AAGAGGGAAGCAGGGATCCCTGG - Intergenic
997361625 5:133298939-133298961 CAGGGAGTAGCCCTCATCCCAGG - Intronic
997392627 5:133529410-133529432 CAGACACAAACAGTCAGCCCAGG + Intronic
998325576 5:141277172-141277194 CAGACAGAGGCAGTATTCCCAGG - Intergenic
1001387602 5:171352912-171352934 CAGAGAGAAGCCGTTAACCAGGG + Intergenic
1003106077 6:3217070-3217092 CAGAGATAAGCAGTCTTCAGGGG - Intergenic
1003510630 6:6776962-6776984 CAGGGTGAAGCAGTCCTCCCAGG + Intergenic
1004144210 6:13049617-13049639 CTGGTAGAAGCACTCATCCCGGG - Intronic
1004578952 6:16928761-16928783 CAGAGAGAAACAGACATAGCAGG + Intergenic
1005143179 6:22657736-22657758 CTGAGAGAAGCTGCCATCCTTGG + Intergenic
1006243045 6:32703501-32703523 CAGAAAGATGCAGTCTTACCAGG - Intergenic
1006914878 6:37587803-37587825 CAGAGATAAACAGGCATCCTTGG + Intergenic
1007193844 6:40042083-40042105 CAGAGAAAGCCAGACATCCCTGG - Intergenic
1007203648 6:40131864-40131886 CAGAGACAAGGAGTTAACCCGGG + Intergenic
1007211751 6:40197929-40197951 CAGAGAGATGCAGAAAGCCCTGG + Intergenic
1007717274 6:43864591-43864613 CAGAGAGGAGAAGTCTGCCCAGG - Intergenic
1009843539 6:69107622-69107644 CAAAGACAAGCAGTCAACCTAGG + Intronic
1010541654 6:77099293-77099315 AAGAGAGGAGCAGGCCTCCCTGG - Intergenic
1011417396 6:87137064-87137086 CAGAAAGAAGAAGTCATCCCTGG - Intergenic
1011774098 6:90708825-90708847 CAGAGAGATGGAGTCAACCTTGG + Intergenic
1012583795 6:100898699-100898721 AAGAGGGGAGCAGGCATCCCTGG - Intergenic
1012917209 6:105183145-105183167 AAGAGAGAAGGGGTCTTCCCTGG + Intergenic
1013630986 6:111985821-111985843 CACAGAGAAGCAATGCTCCCGGG + Intergenic
1016130144 6:140457945-140457967 AAGAAGGAAGCAGTCTTCCCTGG + Intergenic
1018596068 6:165481961-165481983 CACAGGGCAGCAGTCTTCCCAGG - Intronic
1019188878 6:170238549-170238571 CATGGAGATGCAGTCAGCCCGGG + Intergenic
1020246468 7:6433102-6433124 CATAGAGAAGCACTCCTGCCAGG - Intronic
1020677220 7:11196866-11196888 AAGAGGGGAGCAGGCATCCCTGG - Intergenic
1021214670 7:17901236-17901258 CAGAGAGAAGGAGTCTTTCCCGG + Intronic
1021577688 7:22119169-22119191 CAGGGATAAGAAGTCATCACTGG + Exonic
1022456318 7:30561465-30561487 CTGTTAGAAGCAGTCATGCCAGG + Intergenic
1023256904 7:38321536-38321558 CAGGGTGATGCAGTCCTCCCTGG - Intergenic
1025284321 7:57649996-57650018 GAGAGAGAAACAGTCATAACAGG + Intergenic
1027362214 7:77421353-77421375 CAGGGAGAAGAGGTTATCCCTGG + Intergenic
1027578245 7:79958543-79958565 CAGAGAGAAGCCATAAACCCTGG + Intergenic
1029591408 7:101509567-101509589 CAGCAAGAACCAGTGATCCCTGG - Intronic
1029731603 7:102442086-102442108 CACAGAGAACCAGTGATCCAAGG + Intronic
1030328810 7:108251074-108251096 CACAGAGAGGCAGTCATTCTAGG - Intronic
1031353534 7:120763498-120763520 AAGAGAGAAGGAGTCAGTCCTGG + Intergenic
1032205053 7:129856264-129856286 CAACAAGAAGCAGCCATCCCTGG + Intronic
1032329524 7:130964880-130964902 CAGAGTGAAGCAGCTATCCTGGG + Intergenic
1033108729 7:138556377-138556399 AAGAGAGAAGCAGTTGACCCAGG + Intronic
1033252681 7:139774918-139774940 CAAAGAGAATCAGTCTTCCAGGG - Intronic
1033922613 7:146412873-146412895 AAAAGGGAAGCAGTCATCCCAGG - Intronic
1035474622 7:159133629-159133651 CAGACAGAAGCAGAGATTCCTGG - Intronic
1035525360 8:308328-308350 CAAAGAGACACAGTCATTCCTGG + Intergenic
1037446676 8:18972397-18972419 CAAAGAGCAGCAGTTATCACAGG + Intronic
1039778991 8:40765133-40765155 CCCAGAACAGCAGTCATCCCTGG + Intronic
1039834620 8:41246614-41246636 AGGGGTGAAGCAGTCATCCCTGG - Intergenic
1040064944 8:43138182-43138204 AAGAGGGGAGCAGGCATCCCTGG - Intergenic
1040322908 8:46327494-46327516 CCGAGAGAAACAGTCACCCTGGG + Intergenic
1040758398 8:50808486-50808508 TAGAAAGACGCAGGCATCCCTGG - Intergenic
1041414670 8:57594689-57594711 CAGAGAGAGGCAGATATCCAGGG - Intergenic
1041555533 8:59150361-59150383 CAGAGAGGAGCAGGTATCACAGG - Intergenic
1042415092 8:68509702-68509724 AAGAGGGGAGCAGGCATCCCTGG + Intronic
1043375156 8:79640682-79640704 CAGAGTGATGTTGTCATCCCTGG + Intronic
1044120132 8:88384143-88384165 CACAGACAAGAAATCATCCCTGG - Intergenic
1044740967 8:95326173-95326195 CAAAGAGAAACAGTCATCAGTGG - Intergenic
1044814453 8:96097165-96097187 CAGAGAGAAGCACACATTCCTGG - Intergenic
1044999111 8:97865006-97865028 AAGAGAGAAGCAGCTGTCCCAGG - Intergenic
1047245821 8:123143555-123143577 CAGAGAGAAGCAATTAAGCCAGG - Intronic
1048859871 8:138716270-138716292 CAGGGAGAAGCAGGCCTCCCAGG - Exonic
1049111103 8:140644009-140644031 CAGGGAGAAGCTGTCATCTGTGG + Intergenic
1049963337 9:756886-756908 CACAGAGAAGCAGCCATGCATGG - Intergenic
1050508678 9:6372057-6372079 AAGAGGGAAGCAGGTATCCCTGG + Intergenic
1050828066 9:9974609-9974631 CAGAGAGAAACACTCAGCCTAGG - Intronic
1053286028 9:36850078-36850100 CAGAGAGAGGCGGGCATTCCAGG + Intronic
1053635751 9:40000281-40000303 CAGAGAGAATCAGTCTTTCCTGG - Intergenic
1053770231 9:41464344-41464366 CAGAGAGAATCAGTTTTTCCTGG + Intergenic
1054208135 9:62250418-62250440 CAGAGAGAATCAGTCTTTCCTGG + Intergenic
1054316630 9:63597393-63597415 CAGAGAGAATCAGTCTTTCCCGG - Intergenic
1054548906 9:66375847-66375869 CAGAGAGAATCAGTCTTTCCTGG + Intergenic
1055407457 9:75989552-75989574 CAGAGGAAAGCCATCATCCCTGG - Intronic
1056325295 9:85473366-85473388 CAGAGAAAAACAGTAATACCAGG + Intergenic
1056500337 9:87202674-87202696 CAGAGAAAAGCAGTCATTGGAGG + Intergenic
1056841598 9:90002380-90002402 CAGAGACAGGCAGGGATCCCAGG - Intergenic
1058643170 9:107106649-107106671 TAGAGAGCAGCTGTCATTCCAGG - Intergenic
1059202919 9:112434719-112434741 CCCAGAGAAGGAGTCATCACAGG + Intronic
1059203157 9:112437625-112437647 CCCAGAGAAGGAGTCATCACAGG + Intronic
1059563623 9:115360143-115360165 AATAGAAGAGCAGTCATCCCAGG + Intronic
1059923297 9:119181332-119181354 CAGTGAGAAGCGGTGATCACAGG + Intronic
1060492114 9:124092683-124092705 CAGAGAGGTCCAGACATCCCAGG - Intergenic
1060908616 9:127330762-127330784 GGGAGAGAGCCAGTCATCCCCGG + Intronic
1061027480 9:128059497-128059519 TCCAGAGAAGCAGTCATCCTTGG + Intergenic
1061153777 9:128844991-128845013 AAGTGAGAAAGAGTCATCCCTGG + Intronic
1061587013 9:131575975-131575997 CAGAGAGATGCAGAGATCCTGGG + Intergenic
1061902279 9:133679031-133679053 CAGACAGAAGCAGCAAACCCGGG + Intronic
1185518199 X:716564-716586 CAGAGAGGAGCAGTCACGTCGGG - Intergenic
1187767724 X:22661754-22661776 CAGAGAAAAGGAGCCAGCCCAGG - Intergenic
1188763228 X:34057626-34057648 AAGAGGGGAGCAGGCATCCCTGG - Intergenic
1189006308 X:36999049-36999071 AAGAGGGGAGCAGGCATCCCTGG - Intergenic
1189042286 X:37554756-37554778 AAGAGGGGAGCAGGCATCCCTGG + Intronic
1189350185 X:40270132-40270154 CAGAGACAGGCAGCGATCCCAGG + Intergenic
1190894004 X:54597727-54597749 CAGAGGGAATCAATGATCCCAGG - Intergenic
1191128416 X:56982686-56982708 CACAGAGAAGCTGTCATTCTGGG + Intronic
1191845887 X:65547763-65547785 CAGAGAGAGAAATTCATCCCAGG - Intergenic
1191926198 X:66312743-66312765 CAGAGATGAGCGATCATCCCTGG - Intergenic
1192139240 X:68633472-68633494 CAGAAAGAAGTAATCATCTCAGG - Intergenic
1193269721 X:79515172-79515194 AAGAGGGGAGCAATCATCCCTGG - Intergenic
1194402722 X:93458477-93458499 AAGAGGGGAGCAGGCATCCCTGG + Intergenic
1196444318 X:115737457-115737479 CCGAGAGAAGCAGTCGCCGCGGG - Intergenic
1198040115 X:132842554-132842576 CAGAGAGAAACAGTGCTTCCAGG + Intronic
1199234184 X:145471774-145471796 AAGAGGGGAGCAGGCATCCCTGG - Intergenic
1199575072 X:149306215-149306237 CAGAGAGAAGGAGGCATTCCAGG + Intergenic
1202092950 Y:21213158-21213180 AAGAGGGAATCAGGCATCCCTGG - Intergenic
1202270384 Y:23066554-23066576 AAGAGAGAAGCAGTTGTCCCTGG + Intergenic
1202295643 Y:23354128-23354150 AAGAGAGAAGCAGTTGTCCCTGG - Intergenic
1202423378 Y:24700299-24700321 AAGAGAGAAGCAGTTGTCCCTGG + Intergenic
1202447411 Y:24969787-24969809 AAGAGAGAAGCAGTTGTCCCTGG - Intergenic
1202603952 Y:26622938-26622960 CACAGAGAAGCTGCCAACCCAGG + Intergenic