ID: 1162391165

View in Genome Browser
Species Human (GRCh38)
Location 19:10391015-10391037
Sequence CCTTTGCCCACCAGCCATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162391165 Original CRISPR CCTTTGCCCACCAGCCATCG TGG (reversed) Intergenic
900657615 1:3767505-3767527 CCTCTGCCCACCGCCCACCGAGG + Intronic
901001874 1:6152946-6152968 CCTTTTCCCACCTGCCAGCCAGG + Intronic
903364267 1:22796273-22796295 CCCTGGCCCCCCAGCCATGGGGG - Intronic
904676507 1:32202017-32202039 CCTGTGCCTACCAGCCACAGCGG + Exonic
905395395 1:37663393-37663415 CGCTTGCCCACCAGCCACCATGG - Intergenic
916165701 1:161965284-161965306 CCTTTGCCCTCCTGCCACCAGGG - Intergenic
918325896 1:183410518-183410540 CCTTTGCCCATCACCTTTCGAGG + Intronic
922536146 1:226382355-226382377 CCTGCGCCCACCAGTCATCCGGG - Intronic
922659383 1:227416426-227416448 ACTTTGACCACCAGGCATCCTGG - Intergenic
923868390 1:237964325-237964347 CCATTGCTTGCCAGCCATCGGGG - Intergenic
1063138881 10:3239456-3239478 ACTTTCCCCAGCACCCATCGTGG - Intergenic
1074536175 10:114329937-114329959 CATCCGCCCACCACCCATCGAGG - Intronic
1075352980 10:121742581-121742603 CCTTTGCCCACCTGTCAAGGTGG - Exonic
1075787626 10:125060871-125060893 CCTTAGCACACCAGCCCCCGCGG - Intronic
1076432508 10:130415758-130415780 CCTATTCCCACCAGCCAGAGTGG - Intergenic
1076473603 10:130737043-130737065 CCATTTCCCACCAGCCAAGGAGG - Intergenic
1077699827 11:4431276-4431298 TCTTTGCCCCTCAGCCCTCGGGG - Intergenic
1079138156 11:17788192-17788214 CCTTTCCCCAGATGCCATCGAGG - Exonic
1081695305 11:45105469-45105491 CCTCTGCACACCAGGCCTCGAGG + Intronic
1085309730 11:75509081-75509103 CCTATGCCCACCAGCCACCCAGG + Intronic
1088367762 11:109056947-109056969 CCTCAGCCCACCAGGCATTGTGG - Intergenic
1098076321 12:66735904-66735926 TCTTTGCCCACTAGTCATGGGGG - Intronic
1099185713 12:79513726-79513748 CATCTGCCCACCAGACATAGTGG - Intergenic
1100729204 12:97445296-97445318 CATTTTCCCAACAGCCATGGGGG + Intergenic
1102220639 12:111192037-111192059 CCTGTGACCACCAGCAATAGAGG + Intronic
1103924161 12:124414520-124414542 CCATCCCCCACCAGCCATCAAGG + Intronic
1104706542 12:130951691-130951713 CCCTCCCCCATCAGCCATCGGGG + Intergenic
1105327476 13:19383183-19383205 CCTCTGAGGACCAGCCATCGTGG - Intergenic
1117343115 14:54808318-54808340 GCTCTGCCCACCAGCCTTGGGGG + Intergenic
1121650114 14:95552008-95552030 CCCTTACCCACAAGCCATCAGGG - Intergenic
1123203839 14:106692793-106692815 CCTCTGTCCCCCAGCCATCTGGG + Intergenic
1123771178 15:23530981-23531003 GCTTTGCCCACCAGCCATGGGGG - Intergenic
1125260977 15:37824295-37824317 CCTCAGCCCAGCAGGCATCGGGG - Intergenic
1131965769 15:97840746-97840768 CCTTTGCCCACCAGTTGCCGGGG - Intergenic
1135937099 16:26790911-26790933 CCTGTTCCCACCAGCCAGAGTGG - Intergenic
1136136377 16:28259090-28259112 CGTCTGCCCACCAGCCACCTCGG + Intergenic
1138187403 16:54987110-54987132 CCCATGCCCACCAGCCACGGCGG - Intergenic
1141213669 16:82004389-82004411 AGTTTGCACACCAGCCATGGCGG - Intronic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1141520642 16:84576659-84576681 CCTTTCCCCACCAGTCATCCAGG + Intronic
1141999466 16:87655931-87655953 CCTTTGCCCACATGCCCTCCTGG + Intronic
1143870177 17:9952355-9952377 CCTTTGCCCACTTGCCATGTAGG - Intronic
1144671727 17:17136568-17136590 CCTTTGTCCATCAGCCCTGGGGG + Intronic
1147649226 17:42052523-42052545 CCTTTGCCTCCCAGCCAGCATGG - Intronic
1147690109 17:42309547-42309569 CCTTTGCCCGCCAGCCCTCCAGG - Intronic
1148779298 17:50112551-50112573 CCATTGCCCTCAGGCCATCGTGG - Intronic
1149268097 17:54949602-54949624 CCTTTGCCCAGCAATCATCCAGG + Exonic
1150012393 17:61516946-61516968 CCTTTGCACTCCAGCCAGCCTGG + Intergenic
1150814122 17:68379068-68379090 CCTTTGGCCACCAGGCTTGGTGG + Intronic
1151566611 17:74902116-74902138 CCCTTGGCCCCCAGCCCTCGAGG - Intergenic
1152351396 17:79785764-79785786 CCATAGCCCACAAGCCAGCGTGG + Exonic
1152474675 17:80510269-80510291 GCTCTGCCCACCAGGCATGGAGG - Intergenic
1153128400 18:1825132-1825154 CCTTTGCCCACCTAACATCTGGG - Intergenic
1153773332 18:8432799-8432821 CCCTTGCCCGCAAGCCATCGGGG - Intergenic
1155073067 18:22333077-22333099 CCTTTGGCCAACAGCCAGCAAGG + Intergenic
1162391165 19:10391015-10391037 CCTTTGCCCACCAGCCATCGTGG - Intergenic
1164051246 19:21586982-21587004 CCACTGCCCACCAGCCACTGCGG - Intergenic
1164725573 19:30463669-30463691 ACTTTGCCCAGCAGCCAACTGGG + Intronic
1165422083 19:35727336-35727358 CCTTAGCCCACCAGTCCTCTTGG - Intronic
1165681439 19:37779639-37779661 ACTTTTCCCACAAGCCACCGCGG - Intronic
1167100116 19:47399403-47399425 CCTTCCCCCACCTGCCATCAAGG + Intergenic
1167265426 19:48480682-48480704 CCATTTCCCACCAGCCCCCGGGG - Intronic
1202683486 1_KI270712v1_random:30049-30071 TTTTTGCCCCCCAGCCACCGCGG + Intergenic
925467503 2:4120996-4121018 CCTTTGTCCAACAGCCCTAGAGG + Intergenic
925926830 2:8676949-8676971 CCTCTGCCCACCAGCGTCCGTGG - Intergenic
926977497 2:18529949-18529971 CCTCTGCCCAACAGCCAGCAAGG + Intergenic
934248265 2:90324976-90324998 TTTTTGCCCCCCAGCCACCGCGG - Intergenic
934248506 2:90325796-90325818 TTTTTGCCCCCCAGCCACCGCGG - Intergenic
935057057 2:99576934-99576956 CCTTTGCCAAGCAGCCAGGGAGG - Intronic
937286502 2:120757483-120757505 CCTATGCCCACCAGCCAGACTGG - Intronic
940417919 2:153443475-153443497 GCTTTGCTCTCCAGCCATCTTGG + Intergenic
943265799 2:185730375-185730397 CCTTTGTCCAGCAGCCTTTGAGG - Intergenic
945112209 2:206370722-206370744 CAATTGCCCACCATCCATCAGGG - Intergenic
945176061 2:207044744-207044766 GCTTCACTCACCAGCCATCGTGG + Intergenic
946404991 2:219487621-219487643 CCTCTTCCCACCTGCCATCGGGG - Intronic
946536915 2:220640272-220640294 CCTGTTCCCACCAGCCATGCTGG + Intergenic
948681424 2:239637682-239637704 CTTTTCCCCACCAGGCATCCAGG - Intergenic
1171375645 20:24692506-24692528 CCTTTGCACACCAGCCTGGGTGG + Intergenic
1175386456 20:58598544-58598566 TCTCTGGCCACCAGCCAGCGAGG + Intergenic
1175678193 20:60965241-60965263 CCTGTGCCCACCCTCCATGGTGG + Intergenic
1175976009 20:62710865-62710887 CCTTAGCCCACCAGAAATGGAGG - Intronic
1175989852 20:62783033-62783055 CCTTTGGCCAACAGCCAGCAAGG + Intergenic
1176586778 21:8595342-8595364 CTTTTGCCCACCCACCACCGCGG + Intergenic
1177191645 21:17858265-17858287 CCTTTACCCACCAGCTAACAGGG - Intergenic
1179418452 21:41216868-41216890 CCTGTGCCCACTGTCCATCGTGG - Intronic
1179437228 21:41370106-41370128 CCTTTACCCACCCGCCATGGTGG - Intronic
1181154164 22:20907756-20907778 TCTTTGCCCACAAGCCATAAAGG - Intergenic
1181536421 22:23548650-23548672 CCCTTGCCCACCTGGCATCCTGG - Intergenic
1183056983 22:35313026-35313048 CCTTTCCACACCAGCCTTCTGGG - Intronic
1185285072 22:49996454-49996476 CCTTTGCCCACCAGCCACTGAGG - Exonic
950725123 3:14912252-14912274 CCTGAGGCCACCAGCCATCGGGG - Intronic
950749967 3:15120656-15120678 ATTTTGCCCACCAGCAAACGAGG - Intergenic
951041041 3:17989108-17989130 CCTTTCCCCACTAACCACCGAGG + Intronic
951534688 3:23729902-23729924 CCTTGGATCACCAGCCATGGAGG - Intergenic
952097625 3:29972476-29972498 CATTTGCTCACCACCCATCTTGG + Intronic
954611265 3:51945691-51945713 CCTCTGCCCACCTGCCCTCGAGG + Intronic
954682138 3:52351521-52351543 CCTTTGCCCAGCTGACATAGGGG - Intronic
960964080 3:123092463-123092485 CCTCTGCCCAGCAGCCACCATGG - Intronic
966865843 3:184258878-184258900 CCTCTGCACACCAGCCAGCCTGG + Intronic
966911651 3:184563043-184563065 CCTTTTCCCACCAGCTACTGAGG - Intronic
967323498 3:188216809-188216831 CCTTTGCCCAAGAGCTATAGCGG - Intronic
969697964 4:8745960-8745982 CCTTTCCCCTCCTGCCCTCGTGG - Intergenic
975495472 4:75031335-75031357 CCTTTGCCCAGCTGCCCTCAAGG + Intronic
982969953 4:161972535-161972557 CCTTTGGCCAACAGCCAGCAAGG + Intronic
988609698 5:32712705-32712727 CCTTTGACGACCGCCCATCGCGG + Intronic
992077063 5:73201817-73201839 CCTTTGCCCATCAGACCTGGTGG + Intergenic
992910215 5:81389163-81389185 CCTCTGCCCTCCAGCCTTCCTGG - Intronic
997305950 5:132836576-132836598 CCTTTGCCCACCAGTCTCTGTGG + Intergenic
998189568 5:140011618-140011640 CCTCTGGCCAACAGCCATCGAGG + Intronic
1001234981 5:170021909-170021931 ACTTTGCACACCAGCCCTCCTGG - Intronic
1003418190 6:5931951-5931973 CCTTGTCCCTCCTGCCATCGTGG + Intergenic
1003824366 6:9936665-9936687 TCTGTGCCCACCAGCCTTGGAGG - Intronic
1004205872 6:13591688-13591710 CCTTTGCCCACAACCCGTCCCGG + Exonic
1004704537 6:18112003-18112025 CATGTGCCCACCAGGCATAGAGG - Intergenic
1006304933 6:33213226-33213248 CCTTTGCCCGCCGGGCAGCGGGG + Intergenic
1008634621 6:53397349-53397371 CCTCTGTCCACCAGTCATTGTGG - Intergenic
1010744988 6:79550745-79550767 CCTTTGCACAGCAGCCTTGGTGG + Intergenic
1010792592 6:80081628-80081650 CCTTTTGCCAACAGCCATCTTGG + Intergenic
1013294812 6:108749573-108749595 CTTTCCCCCACCAGCCATGGGGG + Intergenic
1013602236 6:111715645-111715667 CCTCTGGCCAACAGCCAGCGAGG + Intronic
1014295654 6:119614161-119614183 CCTATACCCCCCAGCCATGGAGG - Intergenic
1015218939 6:130782148-130782170 CCTGTGCCCAGCAGCCATCTTGG - Intergenic
1019153505 6:170023991-170024013 CCTCTGCCCACCGGCCACCCTGG + Intergenic
1019567567 7:1692029-1692051 CCCCCGCCCACCAGCCATCGTGG - Intronic
1020213539 7:6172172-6172194 ACTGATCCCACCAGCCATCGGGG + Intronic
1022648192 7:32251201-32251223 CATTTGCTCACCTGCCACCGGGG + Intronic
1023889688 7:44383244-44383266 CCTTTGCCCACCAGGCTCCAAGG - Exonic
1025191568 7:56899522-56899544 GCTCGGCCCACCAGCCATGGCGG + Intergenic
1025680379 7:63677412-63677434 GCTCGGCCCACCAGCCATGGCGG - Intergenic
1026163556 7:67890462-67890484 CCTCTGCCCACCCACCATCTGGG + Intergenic
1026274018 7:68861144-68861166 CCTGTGCGCACCAACCATCGTGG - Intergenic
1026585507 7:71652970-71652992 CCCTTCCCTACCAGCCATCAGGG - Intronic
1026848014 7:73708478-73708500 CCTAAGCCCACCAGCCATGAAGG + Intronic
1028802839 7:94986913-94986935 CCATTGCTCACCAGCCATATAGG + Intronic
1029606174 7:101600766-101600788 CCTATGCCCACCTGCCAGTGAGG - Intergenic
1030416334 7:109248298-109248320 CCTTTGCCCACCAGACAGCATGG + Intergenic
1030971103 7:116056530-116056552 CCATTTCCCACCAGCCATACTGG + Intronic
1032785537 7:135196882-135196904 CCTAGGCCCACCAGCCCTCCTGG + Intronic
1033508055 7:142025541-142025563 CCTATGCCCACCATCAATCCTGG - Intronic
1033528919 7:142243997-142244019 CCTTTGCTCACAGGTCATCGTGG - Intergenic
1037768809 8:21787380-21787402 CCTCTTCCCACCAGCCACGGGGG + Intronic
1038316999 8:26493362-26493384 CCTGTTCCCACCAGCCAGAGTGG + Intronic
1039118116 8:34115058-34115080 CCTTTGGCCACCAACCTTCTGGG - Intergenic
1049300718 8:141868006-141868028 ACTGGCCCCACCAGCCATCGGGG + Intergenic
1049543745 8:143220102-143220124 CCTCTGCCCGCCAGCCATTCGGG + Intergenic
1049639615 8:143708924-143708946 CCTATGTCCTCCAGCCATCCGGG - Intronic
1057852473 9:98576088-98576110 CTTGTGCCCACCACCCCTCGTGG + Intronic
1061154116 9:128846804-128846826 CCACGGCCCACCAGCCATCTGGG - Intronic
1062385546 9:136309571-136309593 CCTGAGGCCACCAGGCATCGAGG + Intergenic
1062541640 9:137044225-137044247 CCTGTGCCCACCTGCCACTGCGG - Intronic
1190212474 X:48459453-48459475 CCTTTCACCTCCAGCCATCCTGG + Intronic
1198526651 X:137508223-137508245 CCTTTTCCCACTTGCCATCCAGG - Intergenic
1202604354 Y:26626426-26626448 CCTCTGAGGACCAGCCATCGTGG + Intergenic