ID: 1162391936

View in Genome Browser
Species Human (GRCh38)
Location 19:10395207-10395229
Sequence AGGTGAGTGGAGCTTTCCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162391936_1162391939 -9 Left 1162391936 19:10395207-10395229 CCCGGGGAAAGCTCCACTCACCT 0: 1
1: 0
2: 0
3: 16
4: 190
Right 1162391939 19:10395221-10395243 CACTCACCTCCTCCACCTCTAGG 0: 1
1: 0
2: 4
3: 55
4: 457
1162391936_1162391945 19 Left 1162391936 19:10395207-10395229 CCCGGGGAAAGCTCCACTCACCT 0: 1
1: 0
2: 0
3: 16
4: 190
Right 1162391945 19:10395249-10395271 GCACCAAATGACCAGGTAATTGG 0: 1
1: 0
2: 1
3: 6
4: 106
1162391936_1162391944 12 Left 1162391936 19:10395207-10395229 CCCGGGGAAAGCTCCACTCACCT 0: 1
1: 0
2: 0
3: 16
4: 190
Right 1162391944 19:10395242-10395264 GGTCAATGCACCAAATGACCAGG 0: 1
1: 0
2: 0
3: 2
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162391936 Original CRISPR AGGTGAGTGGAGCTTTCCCC GGG (reversed) Exonic
900610989 1:3544586-3544608 CGGTGTGTGGAGCACTCCCCAGG - Intronic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
901627592 1:10632741-10632763 AGGTCAGGGCAGCTGTCCCCCGG - Intergenic
902878056 1:19352894-19352916 AGGAGAGTGGCGCTCTGCCCCGG + Intronic
904345377 1:29864768-29864790 AGGGGAGTGGAGGTTGCCACAGG - Intergenic
907838935 1:58137830-58137852 AGGTGAGAGGAACGTTCCCCAGG + Intronic
908512976 1:64864139-64864161 AGGTGAGTGGAGCCAACACCAGG - Intronic
913209463 1:116570882-116570904 TGGTGAGTGAAGCCTGCCCCAGG - Exonic
915568830 1:156732794-156732816 AGGAGAGTGGACCTGACCCCAGG - Intronic
916234902 1:162577316-162577338 AAGTCAGTGCAGCTTTCACCTGG - Intronic
917642716 1:176998470-176998492 AGATAAGTAGAGCTTACCCCAGG - Intronic
918255055 1:182741258-182741280 AGGTGAGGGGAGCTTCTGCCCGG - Intergenic
919639642 1:200035899-200035921 AGTTGAGCAGAGCTGTCCCCCGG + Intronic
919740368 1:200977538-200977560 ACTAGAGTGGAGCTCTCCCCTGG - Intronic
920194049 1:204214156-204214178 AGGTGGGCGGTGCCTTCCCCGGG - Intergenic
920399007 1:205665562-205665584 GGGAGAGTGGAGCCGTCCCCAGG + Intronic
922119019 1:222644134-222644156 AAGTGACTGGCGCTTTCGCCAGG - Intronic
1064727654 10:18297723-18297745 AGGTGAGATGAGCTTTCAGCTGG + Intronic
1065963825 10:30754836-30754858 AGCTGCGTGGAGCTCACCCCAGG - Intergenic
1066189323 10:33041602-33041624 AGGTGATTGGAGCTTGCCACTGG + Intergenic
1069367356 10:67707764-67707786 AGGTGAATGTAACTTTCACCAGG - Intergenic
1073139544 10:101238321-101238343 AGGCGAGGGCAGCCTTCCCCAGG + Intergenic
1073329358 10:102660705-102660727 AGGGGAGAGGCCCTTTCCCCAGG + Intergenic
1074194191 10:111166395-111166417 AGGAGAGGGGAGCTCTCACCTGG - Intergenic
1075307376 10:121380038-121380060 AGGTGAGAGGACCTGTTCCCTGG - Intergenic
1075339412 10:121633408-121633430 AGGCTGGTGGAGCTGTCCCCAGG - Intergenic
1077212011 11:1375456-1375478 AAGAGAGTGGAGCTTTCACTTGG + Intergenic
1081645393 11:44786548-44786570 TGGTGAGTGGAAGTTGCCCCAGG + Intronic
1083860700 11:65418500-65418522 AGGTGAGGTGAGCATGCCCCAGG - Intergenic
1084570800 11:69958762-69958784 AGGACAGTGGAGCTTGCACCTGG - Intergenic
1085388999 11:76172643-76172665 AGGGGAGTCGTGCTTTCCCTGGG - Intergenic
1085763423 11:79261578-79261600 AGGTGGGAAGAGCTGTCCCCAGG - Intronic
1086922803 11:92606385-92606407 AGGAGAATGGAGACTTCCCCAGG + Intronic
1089633531 11:119797840-119797862 AGGGGAGTGGAGCTGTCCACCGG - Intergenic
1089710484 11:120311037-120311059 ATGTGGGTGGAGCTCTCCCAGGG + Intronic
1090270056 11:125379716-125379738 AGGTGTGTGCAGCTGTCCCCGGG - Intronic
1091737448 12:2934560-2934582 ATGTGAGTGCTGCTTTCCCAGGG + Exonic
1096252103 12:50040057-50040079 AGCTGGGTGGAGCTCTGCCCGGG - Intergenic
1097502161 12:60418235-60418257 AGGTGACTTGAGCTCTCTCCAGG - Intergenic
1100139803 12:91603543-91603565 ATCTGACTGCAGCTTTCCCCTGG - Intergenic
1102233765 12:111281417-111281439 AGGTGAGTCGAGATCCCCCCAGG + Intronic
1104734714 12:131129659-131129681 TTGGGAGTGGAGATTTCCCCAGG - Intronic
1106532071 13:30602353-30602375 AGGTGACTGGAAGTTTCCTCTGG - Intronic
1107658198 13:42613406-42613428 AGCTAGATGGAGCTTTCCCCAGG + Intergenic
1111139209 13:84092007-84092029 AGGTGTTTGGATCTATCCCCAGG - Intergenic
1111476026 13:88748929-88748951 AGGTGAGTGGCTTTTTCACCTGG + Intergenic
1113957184 13:114105166-114105188 GGGTGGGTGGGGCTCTCCCCAGG + Intronic
1114693328 14:24605663-24605685 AGTCCAGTGCAGCTTTCCCCAGG - Intergenic
1114888088 14:26880434-26880456 AGGAGTGAGGAGCTTTCTCCTGG + Intergenic
1118300119 14:64607686-64607708 AGGTGAGACAATCTTTCCCCTGG - Intergenic
1118357635 14:65027780-65027802 AGGTGAGTGGGGTTTTGCACAGG + Exonic
1118456287 14:65948044-65948066 AGGTGTGCTGAGCTCTCCCCAGG - Intergenic
1120247738 14:82026326-82026348 AAGTGAGTGGATATTCCCCCTGG + Intergenic
1121199450 14:92105651-92105673 GTGTGAGTGAAGCCTTCCCCAGG - Intronic
1121503480 14:94458721-94458743 AGGTCAATGGAGCTGTTCCCAGG + Intergenic
1121827930 14:97026142-97026164 AGGTGAGAGGAGCCCTCCCAGGG - Intergenic
1122147233 14:99698849-99698871 AGGTAAGTTGAGCTTTCCTCCGG + Intronic
1124019079 15:25903409-25903431 AGGTGAGTGGATTTTTCCAAGGG + Intergenic
1124412173 15:29445582-29445604 AGGGGTGTGGAGCTTTCTCTGGG - Intronic
1124665489 15:31588404-31588426 AGGTGAGTGGTCGTTTCCCAGGG + Intronic
1124859762 15:33427681-33427703 ATGTGAGGGGAGCTTTGCACAGG - Intronic
1125980657 15:43997617-43997639 AAGTGAGTGGATTTTTCCCCTGG + Intronic
1127277430 15:57459656-57459678 AGGTGAGGAGGGCTTTACCCAGG + Intronic
1132474989 16:130451-130473 AGGAGGGTGGGGCTTTGCCCAGG + Intronic
1133139979 16:3736465-3736487 AGCTGATTGAGGCTTTCCCCTGG - Intronic
1133175074 16:4008314-4008336 AGGTGGGTGGATCCTGCCCCGGG + Intronic
1134165484 16:11926148-11926170 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1134489824 16:14688299-14688321 AGGTGGGTGAAGCTCTCTCCTGG + Intronic
1134495204 16:14727416-14727438 AGGTGGGTGAAGCTCTCTCCTGG + Intronic
1134500590 16:14766536-14766558 AGGTGGGTGAAGCTCTCTCCTGG + Intronic
1134545273 16:15103199-15103221 AGGTGGGTGAAGCTCTCTCCTGG - Intronic
1134579993 16:15362514-15362536 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1134714715 16:16351682-16351704 AGGTGGGTGAAGCTCTCTCCTGG + Intergenic
1134722592 16:16395046-16395068 AGGTGGGTGAAGCTCTCTCCTGG + Intergenic
1134944836 16:18316823-18316845 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1134952100 16:18356976-18356998 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1135310444 16:21401038-21401060 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1135363389 16:21833466-21833488 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1135448403 16:22537612-22537634 AGGTGGGTGAAGCTCTCTCCTGG + Intergenic
1136150024 16:28341387-28341409 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1136166259 16:28455202-28455224 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1136196713 16:28659830-28659852 AGGTGGGTGAAGCTCTCTCCTGG + Intergenic
1136213053 16:28773955-28773977 AGGTGGGTGAAGCTCTCTCCTGG + Intergenic
1136227157 16:28866752-28866774 CGGTGAGTCCATCTTTCCCCAGG - Exonic
1136257780 16:29053868-29053890 AGGTGGGTGAAGCTCTCTCCTGG + Intergenic
1136307188 16:29380192-29380214 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1136320713 16:29482435-29482457 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1136435286 16:30221775-30221797 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1139758697 16:69166611-69166633 AAGTGACTGGAGTTCTCCCCAGG - Intronic
1139855316 16:69975188-69975210 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1139885033 16:70202303-70202325 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1140221487 16:73047731-73047753 AGGTGAGTGCAGCCTCCCTCCGG - Exonic
1140367482 16:74393210-74393232 AGGTGGGTGAAGCTCTCTCCTGG + Intergenic
1142509207 17:384116-384138 AGGGGAGCTGAGCTTTGCCCAGG + Intronic
1143031531 17:3970621-3970643 AGGTCAGTGCAGCTTTCGCTGGG + Intergenic
1143407070 17:6684706-6684728 AGCACAGTGGAGCTTTCCGCGGG + Exonic
1148772727 17:50076474-50076496 AGGTGAGTGGGGCTGGCGCCTGG + Exonic
1151158352 17:72143288-72143310 TGGTTAGTGGAGGTTTCCACTGG - Intergenic
1151321615 17:73356078-73356100 AGATGAGTGAAGCTTCCTCCAGG - Intronic
1151763859 17:76122180-76122202 AGGCGAGTGGCGCTGTCCCCAGG + Intergenic
1152700405 17:81815661-81815683 AGGTGAGGGGCAGTTTCCCCAGG - Intergenic
1153557568 18:6332078-6332100 AGGTGAGAAGAGCCTTTCCCTGG - Intronic
1159797450 18:72862242-72862264 AGGTGCCTGGGCCTTTCCCCAGG - Intronic
1160598492 18:79994440-79994462 AGATGAGGTGATCTTTCCCCTGG - Intronic
1160598505 18:79994543-79994565 AGATGAGGTGATCTTTCCCCTGG - Intronic
1160598518 18:79994645-79994667 AGATGAGGTGATCTTTCCCCTGG - Intronic
1161605047 19:5210198-5210220 AAGTGAATGGGGCTTTCCTCTGG - Intronic
1162391936 19:10395207-10395229 AGGTGAGTGGAGCTTTCCCCGGG - Exonic
1162427368 19:10604488-10604510 AGATGAAGGGAGCTTTCCCCTGG + Intronic
1163185727 19:15638158-15638180 AGATGAGTGGGGCTGTCCACAGG - Intronic
1163715422 19:18869962-18869984 CGGTGAGTGGGGCTTTCGCTGGG - Exonic
1166674556 19:44732091-44732113 AAGTGAGTGGAGCCATCCCTGGG + Intergenic
1167613185 19:50517217-50517239 GGGAGAGAGGAGCTTTCTCCAGG - Exonic
1167963117 19:53123240-53123262 ATGTGAGTAGAGCTACCCCCTGG - Intronic
1168585050 19:57584989-57585011 AGGTGAGTGGAGGGTGTCCCAGG + Exonic
1168701033 19:58439738-58439760 AGGTAAGTGGAGTGTGCCCCAGG - Exonic
925022926 2:586217-586239 AGGAGTGTGGAGCTTCACCCGGG + Intergenic
926191287 2:10729861-10729883 AGATGAGGGCAGCATTCCCCAGG + Intronic
926547118 2:14255561-14255583 GGGTGAGTGCAGCTGTGCCCAGG + Intergenic
927521938 2:23704146-23704168 AGGTGAGGTCAGCTTCCCCCAGG + Intronic
929436106 2:41929596-41929618 CTGTGAGTGGGGCTTTCTCCAGG - Intergenic
930166748 2:48210597-48210619 AGATGAATGGAGCTTTTCTCAGG - Intergenic
932303646 2:70686299-70686321 AGGTCACTGGAGCTTGCCCGGGG + Intronic
934790523 2:97055855-97055877 GTGTGAGTGGATCTTCCCCCGGG - Intergenic
934815943 2:97326676-97326698 GTGTGAGTGGATCTTCCCCCGGG + Intergenic
934821752 2:97381807-97381829 GTGTGAGTGGATCTTCCCCCGGG - Intergenic
938250377 2:129811208-129811230 AGGTGAGTGGAGCCTTGCGCTGG - Intergenic
941795723 2:169596490-169596512 AGGTGAGGTGAGCTTTCTGCTGG - Intronic
941814547 2:169785962-169785984 AGGTGAGGGGCGCTTTTGCCCGG - Intergenic
947672392 2:231946572-231946594 AGGAGAGTTGAACTTTCTCCAGG - Intergenic
1168813948 20:723933-723955 AGGTGGCTGGAGCTCTTCCCTGG + Intergenic
1168874885 20:1164597-1164619 AGGAGAGTGGAGCCTCCTCCAGG + Intronic
1169112337 20:3042288-3042310 AAGGGAGCAGAGCTTTCCCCAGG + Intergenic
1171519974 20:25768242-25768264 AGCAGAGTGCAGTTTTCCCCTGG - Intronic
1171556945 20:26088251-26088273 AGCAGAGTGCAGTTTTCCCCTGG + Intergenic
1175530737 20:59672907-59672929 AGGTGAGTGGGGCTTAGCCTAGG + Intronic
1176117286 20:63438604-63438626 AGGTGAGTCCAGGTGTCCCCCGG - Exonic
1178995610 21:37396422-37396444 AGGTGAATGGAGATTTCCAGAGG - Intronic
1179175767 21:39006852-39006874 AAGTGAGTTGAGCAGTCCCCTGG - Intergenic
1181493358 22:23274510-23274532 AGGCGAGGGGAGCTGACCCCCGG + Intronic
1182747358 22:32616078-32616100 AGGAGAGAGGGGCATTCCCCTGG + Intronic
1184799796 22:46752514-46752536 AGGTGAGAGCAGCCTTCCCGAGG - Intergenic
1185388771 22:50548096-50548118 AGGAGAGTGTGGCTCTCCCCAGG + Exonic
950329620 3:12146003-12146025 ATGTGAGAGGAGCTTCCCCTGGG + Intronic
950541166 3:13614163-13614185 AGGTGAGTGCTGCTCTTCCCTGG + Exonic
960771965 3:121203840-121203862 AGGGGAGTGGATCTCTCCCCTGG + Intronic
961474547 3:127138521-127138543 AGGCAAGGGGAGCTTTCCCTGGG - Intergenic
966443642 3:179975938-179975960 GGGTGACTGGATCTTTCCACTGG - Intronic
975855461 4:78619646-78619668 AAGTAACTGTAGCTTTCCCCAGG - Intergenic
977014876 4:91679461-91679483 AGGTTAGAGGGGCTTTCCTCAGG + Intergenic
982233749 4:153232946-153232968 AGCCGGGTGGAGCTGTCCCCTGG + Intronic
986312884 5:6567897-6567919 TGGGGGGTGGATCTTTCCCCAGG - Intergenic
987057697 5:14210353-14210375 AGGGGTGTCCAGCTTTCCCCAGG + Intronic
987697952 5:21356103-21356125 AAGTGTGTGGAACTTCCCCCCGG - Intergenic
987717885 5:21594972-21594994 AGGTGAGTTGACATTCCCCCAGG - Intergenic
991742490 5:69696280-69696302 AAGTGTGTGGAACTTCCCCCCGG + Intergenic
991755204 5:69858924-69858946 AAGTGTGTGGAACTTCCCCCCGG - Intergenic
991794064 5:70276018-70276040 AAGTGTGTGGAACTTCCCCCCGG + Intergenic
991821880 5:70571593-70571615 AAGTGTGTGGAACTTCCCCCCGG + Intergenic
991834531 5:70734072-70734094 AAGTGTGTGGAACTTCCCCCCGG - Intergenic
991886441 5:71275560-71275582 AAGTGTGTGGAACTTCCCCCCGG + Intergenic
995882696 5:116860636-116860658 AGGTAAATGGAGCTTTCCTAGGG + Intergenic
997871073 5:137505516-137505538 GGGTGAGTGGGGCTGTCTCCAGG - Intronic
1001379375 5:171293533-171293555 AGGTGAGCTGAGCTTTTGCCTGG + Intronic
1002832702 6:837381-837403 AGATGACTGGGGCTTTCCCCTGG + Intergenic
1005552899 6:26942297-26942319 AAGTGTGTGGAACTTCCCCCTGG + Intergenic
1008824699 6:55679597-55679619 AGGTGACAGGACTTTTCCCCTGG - Intergenic
1009628269 6:66164091-66164113 AGTTTGGTAGAGCTTTCCCCTGG + Intergenic
1010289988 6:74124429-74124451 AGGTGAGTCAAGCTCTCCCCAGG + Intergenic
1012360115 6:98366859-98366881 AAGTGAGTGGATTTTTCCCCTGG - Intergenic
1014063007 6:117094673-117094695 AAGTGAGACCAGCTTTCCCCAGG - Intergenic
1015382894 6:132589609-132589631 AGGTGAATGGGTCTTGCCCCAGG - Exonic
1016731593 6:147433247-147433269 AGGAGAGTGGAGATTCTCCCTGG - Intergenic
1018677486 6:166235743-166235765 AGGTGAGAGGGGCTTTCACCTGG + Intergenic
1019330884 7:460269-460291 AGGTGACTGGAGCTGTTTCCAGG + Intergenic
1022518122 7:30988516-30988538 AGGTGGCCGGAGCTTTCCGCTGG + Intronic
1023295241 7:38708112-38708134 AGAAGAGTGGAGGGTTCCCCAGG + Intergenic
1026984073 7:74544041-74544063 ATGTGACTGGAGCTTTTTCCTGG - Intronic
1029202147 7:98846328-98846350 AGGTGGGGAGAGCTGTCCCCAGG - Intergenic
1030138644 7:106284381-106284403 GAGTGAGCGGGGCTTTCCCCCGG - Intronic
1032416806 7:131741767-131741789 AGGTGAGAGGAGCTATGCCAAGG - Intergenic
1032671362 7:134085641-134085663 CTGTGAATGGAGCTTTCCCAGGG - Intergenic
1033472515 7:141662718-141662740 AGGAGACCGGAGCTTTCTCCTGG - Exonic
1035589485 8:802091-802113 AGGTGTGTGGACCATTCCCCAGG - Intergenic
1035664496 8:1370788-1370810 AGAGGAGTGGAACTTGCCCCAGG - Intergenic
1037596648 8:20359906-20359928 AGGTGAGTGCACCAGTCCCCTGG + Intergenic
1041211650 8:55558046-55558068 ATGTGACTGGGGCTTTCTCCTGG + Intergenic
1048360531 8:133693775-133693797 AGGTGAGTAGAACTTTACCAAGG - Intergenic
1049273574 8:141708695-141708717 AGGTGGGCTGGGCTTTCCCCAGG + Intergenic
1056110072 9:83386263-83386285 ATGTGAGTGTAGCTTTCACTTGG - Intronic
1057518949 9:95745760-95745782 GGATTAGTCGAGCTTTCCCCAGG + Intergenic
1059998547 9:119937437-119937459 TGGTGAATGGCGCTTTCCCAAGG + Intergenic
1060917446 9:127399423-127399445 AGGTGAGCAGAGCCATCCCCAGG - Intronic
1061186905 9:129060179-129060201 AGGAGAGAGGCGATTTCCCCGGG + Intronic
1061190347 9:129079138-129079160 AGGTGAGTTGAGAATTACCCAGG - Intergenic
1061946000 9:133908438-133908460 AGGTGAGGGGAGATTTCCAGGGG - Intronic
1062014695 9:134285191-134285213 AGGTGAGGGGAGCTTTCCGGGGG - Intergenic
1062303742 9:135890202-135890224 ATGTGTGTGGAGCATTCCACAGG - Intronic
1062398720 9:136363245-136363267 GGGTGGGTGGAGCTATCCCTCGG - Intronic
1062563068 9:137150422-137150444 ATCTGGGTGGAGCTTTCCCTGGG - Intronic
1062710422 9:137972334-137972356 GGGTGAGTGCAGCTGACCCCTGG - Intronic
1194380181 X:93181405-93181427 AGGTGGGTGCAGCTTCACCCAGG - Intergenic
1196267165 X:113663750-113663772 AACTCAGTGGAGCTATCCCCAGG - Intergenic
1196311236 X:114168320-114168342 AGCTGATTTCAGCTTTCCCCAGG + Intergenic
1200245878 X:154525016-154525038 AGTTGAGTGGAGTCTTCCCTTGG - Intergenic
1200252175 X:154559551-154559573 AGGGGAGGGGAGCTTGACCCAGG + Intronic
1200265593 X:154644865-154644887 AGGGGAGGGGAGCTTGACCCAGG - Intergenic