ID: 1162393953

View in Genome Browser
Species Human (GRCh38)
Location 19:10405288-10405310
Sequence GAACCCTGTTTTGCTGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162393953_1162393959 4 Left 1162393953 19:10405288-10405310 CCAGCTTCAGCAAAACAGGGTTC No data
Right 1162393959 19:10405315-10405337 AGCCTCAGCTTCCAGAACTGGGG 0: 1
1: 0
2: 5
3: 69
4: 662
1162393953_1162393962 16 Left 1162393953 19:10405288-10405310 CCAGCTTCAGCAAAACAGGGTTC No data
Right 1162393962 19:10405327-10405349 CAGAACTGGGGATAGAGCGCCGG 0: 1
1: 0
2: 1
3: 19
4: 217
1162393953_1162393958 3 Left 1162393953 19:10405288-10405310 CCAGCTTCAGCAAAACAGGGTTC No data
Right 1162393958 19:10405314-10405336 GAGCCTCAGCTTCCAGAACTGGG 0: 1
1: 0
2: 2
3: 26
4: 322
1162393953_1162393957 2 Left 1162393953 19:10405288-10405310 CCAGCTTCAGCAAAACAGGGTTC No data
Right 1162393957 19:10405313-10405335 GGAGCCTCAGCTTCCAGAACTGG 0: 1
1: 0
2: 3
3: 35
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162393953 Original CRISPR GAACCCTGTTTTGCTGAAGC TGG (reversed) Intronic
No off target data available for this crispr