ID: 1162393957

View in Genome Browser
Species Human (GRCh38)
Location 19:10405313-10405335
Sequence GGAGCCTCAGCTTCCAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 314}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162393952_1162393957 3 Left 1162393952 19:10405287-10405309 CCCAGCTTCAGCAAAACAGGGTT No data
Right 1162393957 19:10405313-10405335 GGAGCCTCAGCTTCCAGAACTGG 0: 1
1: 0
2: 3
3: 35
4: 314
1162393953_1162393957 2 Left 1162393953 19:10405288-10405310 CCAGCTTCAGCAAAACAGGGTTC No data
Right 1162393957 19:10405313-10405335 GGAGCCTCAGCTTCCAGAACTGG 0: 1
1: 0
2: 3
3: 35
4: 314
1162393949_1162393957 26 Left 1162393949 19:10405264-10405286 CCTGGCTCTGGAGACTGGAGCTG 0: 1
1: 0
2: 2
3: 60
4: 366
Right 1162393957 19:10405313-10405335 GGAGCCTCAGCTTCCAGAACTGG 0: 1
1: 0
2: 3
3: 35
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162393957 Original CRISPR GGAGCCTCAGCTTCCAGAAC TGG Intronic
900526760 1:3133186-3133208 GGAGACTCAGGTTCCAGGGCAGG + Intronic
900977484 1:6026505-6026527 GCAGCCTCAGCTCCCTGAGCAGG + Intronic
901199855 1:7460572-7460594 GCAGTCACAGCCTCCAGAACGGG - Intronic
901230235 1:7637682-7637704 AGAGCCCCAGCTTCCAGCTCAGG + Intronic
902183174 1:14705064-14705086 GGACCTTCAGCCTCCGGAACTGG - Intronic
902332827 1:15738968-15738990 TGAGCCTCAGCTTCCTCATCAGG - Intronic
903280999 1:22249947-22249969 TGAGCCTCAGTTTCCACATCTGG + Intergenic
903351216 1:22717554-22717576 TGAGCCTCAGCTTCCTCATCTGG + Intronic
903391229 1:22964835-22964857 GGAGCCTCTCCTTCCTGAACGGG - Intronic
903474733 1:23611788-23611810 TGAGACTCAGTTTCCACAACTGG - Intronic
903943236 1:26945948-26945970 GGTGCCTCAGCTTCCAGCCTCGG + Intronic
904311958 1:29634843-29634865 AGAGCCTCAGTTTCCACACCTGG - Intergenic
904349141 1:29893684-29893706 AGAGCCTCAGTTTCCATACCTGG - Intergenic
905363272 1:37434746-37434768 GCAGCCCCAGCTGCCAGGACTGG - Intergenic
905369580 1:37475859-37475881 GGAGCCTCCACTCCCAGAAGAGG + Exonic
905515651 1:38559975-38559997 GGGATCTCAGCTTCCAGTACTGG + Intergenic
905731431 1:40301626-40301648 AGAGGCCCAGCTTCCAGAGCTGG + Intronic
906259914 1:44379042-44379064 GCAGCCACAGCTAGCAGAACAGG - Intergenic
906319894 1:44809293-44809315 GAAGCCTCAGTTCCCAGAACAGG - Intronic
907625853 1:56028598-56028620 GGAGCCTCAACTTCCTCATCTGG - Intergenic
907884905 1:58584087-58584109 TAAGCCTCAGCTTCCTGATCAGG - Intergenic
910859784 1:91732186-91732208 AGAGCCTCAGTTTCCACAGCAGG - Intronic
910937393 1:92495799-92495821 GGTACCTCAGCTTTCACAACAGG - Intergenic
913160407 1:116140008-116140030 GGACCACCAGCCTCCAGAACTGG + Intergenic
914881372 1:151549399-151549421 GGCACCTCATCCTCCAGAACTGG - Intronic
915812142 1:158924474-158924496 GGAACCCCAGCCTCCAGAACTGG + Intergenic
916671270 1:167023171-167023193 GCTGCCTCAGCTTCCCAAACTGG - Intergenic
917132682 1:171758635-171758657 GGAGACTTAGCTTTCAAAACAGG + Intergenic
918588496 1:186214896-186214918 GAAGCCTAGGCTTCCAGCACTGG - Intergenic
923681156 1:236119769-236119791 GCAGCCTGGGCTTCCAGCACTGG - Intergenic
923798164 1:237180191-237180213 GGAGCCTCGCCTTCCTGACCTGG - Intronic
923964092 1:239116921-239116943 CCAGCATCAGCTTCCAAAACTGG + Intergenic
1063460483 10:6212293-6212315 GGGCCCTCGGCTCCCAGAACAGG + Intronic
1063519047 10:6724366-6724388 GAACACTCAGCTTCCAGTACGGG - Intergenic
1064998789 10:21318794-21318816 GGAGACTCAGCTTCCCAGACCGG - Intergenic
1067295841 10:44974820-44974842 GGCGCCTCAGCCTCCAGAGATGG - Intronic
1069908500 10:71746230-71746252 GGAGCCACATCTTTCAAAACAGG - Intronic
1070470881 10:76778151-76778173 GGACTTTCAGCCTCCAGAACTGG + Intergenic
1071457635 10:85863056-85863078 GGAGCCTCAGAGCCCAGAGCCGG - Intronic
1072326829 10:94307083-94307105 CCAGCCCCAGCTTCCAAAACTGG - Intronic
1072734164 10:97867816-97867838 GGATACTCAGCTGCCTGAACTGG + Exonic
1072816661 10:98516297-98516319 GCAGCCTCAGCACCCAGCACAGG + Intronic
1073845073 10:107545133-107545155 GGAGGCTGAGCTTCCAGTTCTGG + Intergenic
1074284185 10:112082441-112082463 GGTGCCTCAGAGTCCAGACCTGG + Intergenic
1075022188 10:118960113-118960135 TGGGCCTCAGCTTCCATATCTGG + Intergenic
1075568580 10:123521893-123521915 AGAGCCTCAGTTTCCAGCTCAGG - Intergenic
1075610148 10:123847144-123847166 ATAGCCTCATCTTCCAGAATAGG + Intronic
1076196064 10:128519263-128519285 GGAGGGTCAACTACCAGAACAGG + Intergenic
1076624476 10:131812995-131813017 GGAGCCCCAGTTGCCAGCACTGG + Intergenic
1077134773 11:993047-993069 GGAGCTGCAGCATCCACAACAGG - Intronic
1077145186 11:1041417-1041439 GTAGCCTCATGTTCCAGAAAGGG + Intergenic
1077815225 11:5680200-5680222 GGAACCTCAGCAGCCAGGACAGG - Exonic
1078850518 11:15158940-15158962 GTAGCCTCAGCTCCTAGAACAGG + Intronic
1078850703 11:15160402-15160424 TGAGCCTCAGTTTCCTGATCTGG - Intronic
1079545454 11:21627527-21627549 GCAGCCCCAGCTTCCACAAGGGG + Intergenic
1079607191 11:22384760-22384782 TGAGCCTCAGCTTCCCCATCTGG + Intergenic
1080872758 11:36251554-36251576 AAAGCCTCAGCTCCCAGCACTGG - Intergenic
1082167341 11:48964222-48964244 GGAGCCTCAGGTCTCAGAAGTGG + Intergenic
1083896003 11:65620117-65620139 AGAGGCTCAGCTTACAGTACAGG + Intronic
1085105296 11:73837274-73837296 GCAGACTCAGCTTCCAGTTCTGG + Intronic
1085259756 11:75197763-75197785 GAGTCCTCAGCTCCCAGAACAGG - Intronic
1085278852 11:75317254-75317276 GGGGCCTCATCTTCCTGATCTGG - Intronic
1085463416 11:76708724-76708746 TGAGCCTCAGCTTCCTCACCTGG + Intergenic
1088811163 11:113393637-113393659 GGAACCTGAGCTTCCAGCAGAGG - Exonic
1089499337 11:118923330-118923352 GGGGTCTCAACTTCCAGACCAGG - Intronic
1089789429 11:120932025-120932047 TGAGACTCAGCTGCCTGAACAGG - Intronic
1090358556 11:126157087-126157109 TGAGCCTCAGTTTCCATATCTGG - Intergenic
1090735477 11:129609199-129609221 AGATCCTCAGCCTCCACAACAGG + Intergenic
1091236884 11:134028104-134028126 GGACCCTCTGCTGCCAAAACAGG + Intergenic
1091435100 12:465948-465970 GGGACCTCAACTCCCAGAACAGG - Intronic
1091649859 12:2301834-2301856 GGAGCCTCAGATCCCAGGTCTGG + Intronic
1091765195 12:3115542-3115564 GGACCCCCAGCCTCCAGAACTGG - Intronic
1091798337 12:3309738-3309760 GGAGCCGCAGGTTCCACAAAGGG + Intergenic
1092050325 12:5465072-5465094 TGAGCCTCAGCCTCCACATCTGG - Intronic
1092111422 12:5967597-5967619 GGTGCCTCTGCTTCCAGCCCGGG - Exonic
1092128836 12:6094180-6094202 GGACCTCCAGCCTCCAGAACTGG + Intronic
1095854415 12:46844495-46844517 GGGGCCTCAGCTTCCTAAAGTGG - Intergenic
1096254656 12:50055769-50055791 GGAGAATCAGCTTCCAGACCTGG - Intergenic
1096407427 12:51354129-51354151 GGAGCCTCTATTTCTAGAACAGG + Exonic
1096510440 12:52125033-52125055 GGAGCCTCAGCTGGGAGCACTGG - Intergenic
1096769835 12:53928087-53928109 CGAACCTCAGCTCCCAGACCGGG - Intergenic
1097206076 12:57322102-57322124 GCTGCCTCAGCCTCCCGAACAGG - Intronic
1099869058 12:88323043-88323065 GGACTCTCAATTTCCAGAACTGG + Intergenic
1100348620 12:93756584-93756606 GCATCCTCAGCATCCAGAACTGG + Intronic
1100457073 12:94763071-94763093 GCAGCCTCAGCTGCCGGGACAGG - Intergenic
1101750471 12:107579200-107579222 GGAGGCTCAGCTGCATGAACAGG + Intronic
1101838977 12:108314289-108314311 GGAACCCCAGCTTCCTGAAAGGG + Intronic
1102466336 12:113132915-113132937 GGAGCCTCAGTTTCCCCATCTGG + Intronic
1102619005 12:114178785-114178807 GGAGCCTCAGGTTCCAGGTCCGG - Intergenic
1104310926 12:127653768-127653790 GGAGCCACAGCTATGAGAACAGG - Intergenic
1105269487 13:18857921-18857943 AGAGTCTCTGCTTCTAGAACTGG + Intergenic
1106235582 13:27857729-27857751 GGAGCCTCAGCTTCTATAACTGG + Intergenic
1106754939 13:32813288-32813310 GGAGCTGCATCTTCCAGAACAGG + Intergenic
1112213955 13:97410947-97410969 GTATACTCAGCTTCCAGGACAGG - Intergenic
1114478830 14:23018235-23018257 GGACCTACAGCCTCCAGAACTGG + Intronic
1114660677 14:24341838-24341860 GGACCCTCAGCTTCCAGCAAGGG + Intergenic
1116313653 14:43359559-43359581 GCAGCCCCAGTTTCCAGCACAGG + Intergenic
1118201116 14:63674230-63674252 GTAGCCTCAGCTACCAGGAAGGG + Intergenic
1118362577 14:65068934-65068956 GGGCCCTCAGCTACCAGACCAGG + Intronic
1119092691 14:71799435-71799457 TGAGCCTCAGCTTCCTTATCTGG + Intergenic
1119145566 14:72310631-72310653 AGAGCCTCTGCTTTCAGAAAGGG - Intronic
1119331805 14:73800519-73800541 GGATGCTCAGCTTCGAGAAACGG - Intergenic
1119687706 14:76645725-76645747 GGAACAGCAGCTCCCAGAACTGG - Intergenic
1120517938 14:85491996-85492018 GGAGCCCCAGTTTCCAGATGTGG + Intergenic
1121732283 14:96195026-96195048 GGAGCCTCAGTTTCCTCATCAGG + Intergenic
1122832371 14:104405543-104405565 GGATCCTCAGCTTCCAGCCATGG - Intergenic
1202829846 14_GL000009v2_random:16080-16102 AGAGTCTCTGCTTCTAGAACTGG - Intergenic
1123429612 15:20203836-20203858 GGCTCCTCACCTTCCAGAAGGGG + Intergenic
1126841768 15:52724337-52724359 GTAGCATCAGCTTCCAGAAATGG - Intergenic
1128353952 15:66911421-66911443 AGAGCCTCAGCCTCCAGGCCTGG + Intergenic
1128533297 15:68470060-68470082 GTATCCTTAGCATCCAGAACAGG - Intergenic
1128605788 15:69035789-69035811 TGAGCAGCAGCTCCCAGAACTGG - Exonic
1130014559 15:80176554-80176576 TGAGCCTCAGCTTCCTGACCTGG - Intronic
1130048474 15:80464268-80464290 GGAGCCTCAGCTTCCTCCTCTGG + Intronic
1130638924 15:85652659-85652681 GGATCTCCAGCCTCCAGAACTGG - Intronic
1131137301 15:89947511-89947533 GGAGCCTTAGGTTAGAGAACAGG - Intergenic
1132041606 15:98529334-98529356 GAAGCCTGAGCTTCCTGCACGGG - Intergenic
1132621803 16:871300-871322 GGAACCTCAGCTTCCTGAACTGG - Exonic
1133388707 16:5391565-5391587 AGAGCCTTGGCTTCCAGAACTGG - Intergenic
1133421174 16:5648263-5648285 GGAGCCTCAGTTTTCACATCTGG + Intergenic
1133496208 16:6320307-6320329 GAAGCCTGAGCTTCAAGGACAGG - Intronic
1136403250 16:30029758-30029780 GGAGACTCAGTTTCCACAAATGG - Intronic
1136550742 16:30981057-30981079 GGAGCTTCTTCTTCCGGAACTGG - Exonic
1137331919 16:47505919-47505941 TGTGCCTCAGCTTCCTGAGCAGG - Intronic
1139470329 16:67174788-67174810 GAGGCCTCAGCTTCCAGCTCTGG - Exonic
1141361234 16:83396926-83396948 AGAGCCTCAGCTTCCTCAACTGG - Intronic
1141744198 16:85914744-85914766 GGAGCCTCGACTTCCACACCAGG - Intronic
1142867312 17:2798684-2798706 GGAGCCTTGGCTTCCTGAAAGGG + Intronic
1143164433 17:4890887-4890909 GGACCCTCAGTTTTGAGAACAGG + Intronic
1143769378 17:9158307-9158329 GGAGGCTGAGCTCCCAGAAGGGG + Intronic
1144058825 17:11563268-11563290 GGAGCCTCAGTGTCCAGACTTGG - Exonic
1144806854 17:17973462-17973484 GGAGCCTCAGGTTCCCTAGCTGG + Intronic
1144823401 17:18091051-18091073 GGATCCCCAGCCTCCAGCACAGG - Intronic
1146958264 17:36949709-36949731 TGAACATCAGCTTACAGAACAGG - Intronic
1147120648 17:38333379-38333401 GAGCCCCCAGCTTCCAGAACTGG + Exonic
1147424089 17:40337465-40337487 GTATCCACAGCTTCCAGGACAGG - Intronic
1147558135 17:41492557-41492579 TGAGCCTCAGCTTTCACAATAGG + Intergenic
1147601096 17:41746068-41746090 AGAACCTCACCTTCCAGGACAGG + Intergenic
1148799004 17:50211267-50211289 TGAGCCTCAGTTTCCTCAACTGG + Intergenic
1149455039 17:56780829-56780851 GGGGCCTCAGTTTCCAAATCTGG - Intergenic
1151465869 17:74284928-74284950 GGCGCCTCAGCATCCAGCCCTGG + Intronic
1152101668 17:78305149-78305171 GGAGCCTCAGTTTCCTCATCTGG + Intergenic
1152177198 17:78795555-78795577 CCAGCCTCAACTTCCAGGACAGG + Intronic
1152224126 17:79084888-79084910 GGAGCCTCAGCTGCCCGACGAGG - Intronic
1152573978 17:81132225-81132247 TGAGCCTCAGCTTCCCCACCAGG - Intronic
1152666721 17:81574644-81574666 GGCGCCACTGCTTCCAGAAGTGG - Intronic
1152930108 17:83104999-83105021 GGGGGCTCACCTTCCAGACCCGG + Intergenic
1153535951 18:6101399-6101421 GGGACCTCTGCTTCCAGAAAAGG - Intronic
1153617395 18:6947445-6947467 TGAGCCTCGGCTTCCACATCTGG + Intronic
1154418552 18:14202061-14202083 AGAGTCTCTGCTTCTAGAACTGG - Intergenic
1154477180 18:14773109-14773131 AGAGTCTCTGCTTCCAGAACTGG - Intronic
1154481614 18:14832356-14832378 AGAGTCTCTGCTTCCAGAACTGG - Intronic
1158383913 18:56967254-56967276 GGAGACTCAGCTACCACCACAGG - Intronic
1159575576 18:70172051-70172073 TGTGCTTCTGCTTCCAGAACAGG + Intronic
1161479090 19:4501795-4501817 CGAGCCTCAGGTGCCACAACGGG + Intronic
1161508326 19:4656417-4656439 GGAGCCTCAGAGTCAAGAGCTGG + Intronic
1161816057 19:6500930-6500952 GGATCTCCAGCTTCTAGAACAGG + Intronic
1162393957 19:10405313-10405335 GGAGCCTCAGCTTCCAGAACTGG + Intronic
1162562665 19:11426545-11426567 AGAGCCTCAACTTGGAGAACCGG - Exonic
1163831320 19:19548410-19548432 GGAGCCTCAGTTTCCTCATCTGG - Intergenic
1163958488 19:20665416-20665438 GGAGCCTCAGATTCCAACCCCGG - Intronic
1166341023 19:42136951-42136973 GGGTCCTCAGCTCCCAGCACAGG - Intronic
1167693472 19:51001215-51001237 GGAGCCTGAGCTCCCAGTTCTGG + Intronic
1202642842 1_KI270706v1_random:111706-111728 AGAGTCTCTGCTTCTAGAACTGG + Intergenic
925552735 2:5093857-5093879 GGAGACACAGCTTCCTGAGCGGG + Intergenic
925688933 2:6500233-6500255 TGAGCCTCAGTTTCCTCAACTGG + Intergenic
926052863 2:9755872-9755894 GGACTTCCAGCTTCCAGAACTGG + Intergenic
926129716 2:10295156-10295178 GGAGCTCTAGCTCCCAGAACAGG + Intergenic
926424321 2:12727502-12727524 TGAGCCTCAGGTTCCAGACCAGG - Intronic
927182661 2:20458067-20458089 GCAGCCTCAGCATCTAGATCAGG + Intergenic
928183656 2:29090162-29090184 GGACTTCCAGCTTCCAGAACTGG - Intergenic
928336944 2:30406323-30406345 GGAGACTCAGATTCCAAAAATGG - Intergenic
929173799 2:38957779-38957801 GGAGAGACAGCTTCCATAACAGG - Intronic
929749225 2:44692562-44692584 GTATCCTCAGCTTCTAGAACAGG + Intronic
930330982 2:49983265-49983287 GGAACATCAGCTTCTAGCACAGG + Intronic
931808314 2:65829564-65829586 GAAGGCTCACCTTCCACAACAGG + Intergenic
932319188 2:70808690-70808712 GTAGCCTCAGCACCCAGCACAGG - Exonic
934498704 2:94835187-94835209 AGAGTCTCTGCTTCTAGAACTGG + Intergenic
934685813 2:96321169-96321191 TGAGCCTCAGCTTCCTAATCTGG - Intergenic
935634419 2:105238723-105238745 GGAGTCTCAGCTTCCAGTCTCGG + Intergenic
935832924 2:107019215-107019237 TGATCCCGAGCTTCCAGAACTGG - Intergenic
937100208 2:119262853-119262875 TGTGCCTCAGCTTCCACAACAGG - Intronic
943727108 2:191263191-191263213 GCAGCCTCAGCTTCCATACAGGG - Intronic
945783258 2:214203554-214203576 GGAACCTCAAGTTCCAGATCAGG + Intronic
946120284 2:217505759-217505781 TGCGCCTCAGCTGCCATAACAGG - Intronic
946132245 2:217615677-217615699 GGAGCCTGTGCTTCCAGAACTGG - Intronic
946448989 2:219763709-219763731 GGAACTCCAGCCTCCAGAACTGG - Intergenic
948140800 2:235670551-235670573 GGAGCCTGAGCTTCAGGCACTGG + Intronic
948261231 2:236605902-236605924 GGACTCCCAGCATCCAGAACTGG - Intergenic
948288004 2:236802225-236802247 GGACTCCCAGCCTCCAGAACTGG - Intergenic
948524535 2:238562714-238562736 GGCCTCCCAGCTTCCAGAACTGG + Intergenic
948873540 2:240815808-240815830 GGAGCCTCAGTCTCCATACCTGG + Intronic
948897676 2:240934865-240934887 GGACCTTCAGCTTCCAGGGCAGG - Intronic
949074016 2:242043915-242043937 AGAGCCTCTGCTAGCAGAACTGG + Intergenic
1168961130 20:1870729-1870751 TGAGCCTCAACTTCCAAAACTGG + Intergenic
1169002700 20:2179380-2179402 GGAGCCTCAGCTTCCACAGAGGG + Intergenic
1169342955 20:4810161-4810183 GGAGCCTAGGCTGCCGGAACGGG + Intronic
1169998109 20:11582307-11582329 GGAGCCTCAGTTTCCTTACCAGG - Intergenic
1170847014 20:19970892-19970914 GGAGGCTCAGCTTGAAGAACTGG + Exonic
1171889959 20:30701913-30701935 AGAGTCTCTGCTTCTAGAACTGG + Intergenic
1173667344 20:44772398-44772420 GAAGCCTCAGCACCAAGAACAGG + Intronic
1174532343 20:51224149-51224171 GGGTCCTCAGCCTCCAAAACAGG + Intergenic
1175382041 20:58570064-58570086 GGGACCTCAGCTTGCAGATCAGG + Intergenic
1175407870 20:58746433-58746455 GGAGTCTCAGTTTCCACATCTGG + Intergenic
1175688970 20:61052129-61052151 GGAGCCACAGATTCCATCACAGG + Intergenic
1176609034 21:8860920-8860942 AGAGTCTCTGCTTCTAGAACTGG - Intergenic
1176798992 21:13404256-13404278 AGAGTCTCTGCTTCCAGAACTGG + Intergenic
1176854745 21:13957233-13957255 AGAGTCTCTGCTTCTAGAACTGG + Intergenic
1177919249 21:27129814-27129836 GGAGATTCTGCTCCCAGAACAGG + Intergenic
1179905549 21:44420926-44420948 GGTGGCTCAGCTTCCACCACTGG + Intronic
1179928949 21:44554316-44554338 GGACTTCCAGCTTCCAGAACTGG + Intronic
1180359126 22:11870752-11870774 AGAGTCTCTGCTTCTAGAACTGG - Intergenic
1181899212 22:26138917-26138939 TGAGCCTCAGTTTCCACATCTGG + Intergenic
1181905791 22:26194927-26194949 GTTCCCTCAGCTTCCAGAACTGG + Intronic
1182093121 22:27609443-27609465 TGAGCCTCAGTTTCCACACCTGG - Intergenic
1182413881 22:30208729-30208751 GGGGCCTGAGCTTCCGGAAGAGG - Intergenic
1182439269 22:30352708-30352730 GGAGCCTCTGCTTCTAAAACTGG - Intronic
1183103428 22:35598135-35598157 GCAGCCTCAGATGCAAGAACTGG + Intergenic
1183280127 22:36927569-36927591 GGAGCATCAGCTTCAAGGGCTGG + Intronic
1183352649 22:37342759-37342781 GGAGGCTCAGCTTCAAGAGCTGG + Intergenic
1183616495 22:38948859-38948881 TGAGCCTCAGCATCCACATCTGG + Intergenic
1183953680 22:41367053-41367075 GGAGCCTCAGGTCCCAGCCCGGG + Intergenic
1184636433 22:45835672-45835694 GCAGCCTCAGCTTTCAGTGCAGG + Intronic
1184694719 22:46133025-46133047 GGAGGCTCGGCTTCCAGCCCTGG - Intergenic
1184749613 22:46477844-46477866 CGGGCTTCAGCTTCCAGGACAGG + Intronic
1185044526 22:48522520-48522542 GCAGCCTCAGTTTCCAGAAGCGG - Intronic
1185162505 22:49238350-49238372 GGAGCCTCAGTTTCCTCACCTGG - Intergenic
950168180 3:10816849-10816871 GGAGCCTCAGCTTTCCTAACTGG + Intronic
952144951 3:30522252-30522274 TGAGCCTCAGCTTCTCTAACTGG - Intergenic
952379068 3:32790292-32790314 CCTGCCTCAGCTTCCAGAATAGG - Intergenic
952904627 3:38131681-38131703 GGCTCCACTGCTTCCAGAACAGG - Intronic
953056149 3:39388776-39388798 GGAGCTGCAGCTTCCAGCACTGG - Intronic
954326850 3:49868672-49868694 TGAGCCTCAGTTTCCTCAACTGG - Intronic
954459482 3:50618170-50618192 GGGGTCTCAGCTTCCAGCAAAGG - Intronic
959581580 3:107988263-107988285 GCAGCCTCAGCTGCTAGAAGAGG - Intergenic
959806882 3:110564984-110565006 GGAGCTACAGCTTACAGATCAGG - Intergenic
960956143 3:123032682-123032704 ATAGCCCCAGCTTACAGAACAGG + Intergenic
961457101 3:127029683-127029705 GGAGGCGCAGCCTCCAGAGCTGG - Intronic
961818098 3:129561559-129561581 GGAGCCTCAGCTTCCCCACTGGG + Intronic
962921710 3:139956113-139956135 TGAGACTCAGTTTCCATAACTGG - Intronic
963654565 3:148029308-148029330 GGATTTTGAGCTTCCAGAACTGG - Intergenic
964405512 3:156344372-156344394 GCAGCAGCAGCTTTCAGAACAGG - Intronic
966673332 3:182554984-182555006 GCTGCCTCAGCCTCCTGAACTGG + Intergenic
967853620 3:194100252-194100274 GGCCCCTCAGTTTCCAGGACTGG - Intergenic
968726595 4:2250761-2250783 AGAGCTTCTGCTTCCAGAAAAGG - Intronic
969058468 4:4416516-4416538 GCAGCCACAGCTGCCAAAACAGG + Intronic
969185675 4:5472451-5472473 GGAGCATCTGCTTCCAGGGCTGG + Intronic
969318597 4:6396696-6396718 GGAGCCTCAGGTTCCTTATCTGG - Intronic
975471739 4:74777210-74777232 TGAGCCTCAGTTTACAGAAGAGG - Intronic
976620397 4:87121108-87121130 GGTGCCTCACCTTCCACAAAGGG - Intronic
976854253 4:89583821-89583843 GGACTTCCAGCTTCCAGAACTGG + Intergenic
981100894 4:140828204-140828226 GGACCTCCAGCCTCCAGAACTGG - Intergenic
984559451 4:181251475-181251497 GTATCCTCAACTTCCAGCACAGG + Intergenic
985151280 4:186949287-186949309 GGAGCCTCAGCTCCCATCACAGG - Intergenic
1202770212 4_GL000008v2_random:197600-197622 AGAGTCTCTGCTTCTAGAACTGG + Intergenic
985588242 5:751701-751723 GGAGCCTGAGCTTCCAGGCATGG - Intronic
985602913 5:844156-844178 GGAGCCTGAGCTTCCAGGCGCGG - Intronic
985659252 5:1147841-1147863 GGAGCCTCAGCTTCCCAAGCAGG + Intergenic
985716796 5:1467484-1467506 GGAGCCGCCGCTTCCACACCTGG - Intronic
985875501 5:2591194-2591216 GGGGCCTCAGCTCCCAGCACGGG - Intergenic
988543567 5:32135599-32135621 GGAAACTCAGCCTCCAGAAACGG - Exonic
990103355 5:52221257-52221279 AGAGCCCCAGCTTCGAGAAGTGG - Intergenic
990852448 5:60222290-60222312 GGAGGCTCTGCTTCCAATACAGG - Intronic
990977748 5:61574089-61574111 GGAGTCTCAGCATCCAGATTAGG - Intergenic
990989954 5:61674943-61674965 GGGGACTCAGCCTCCAGGACTGG + Intronic
992393122 5:76347554-76347576 GGTGCCTCAGCCTCCCGAGCTGG + Intronic
993077965 5:83258651-83258673 GGAGAATCAGCTTCAAGAAAAGG + Exonic
993349158 5:86825226-86825248 GGAGCTTCTGCTCCCATAACTGG - Intergenic
993711142 5:91226435-91226457 TCATCCTCAGCTTCCAGAAATGG + Intergenic
994527556 5:100925798-100925820 AAATCCTCAGCCTCCAGAACTGG + Intergenic
995297998 5:110542082-110542104 GGAGCTTCAGGTTCCAGGTCCGG - Intronic
996322327 5:122232742-122232764 GGGGGCTCTGTTTCCAGAACAGG + Intergenic
1001515547 5:172353097-172353119 GACTCCTCAGCTCCCAGAACAGG + Intronic
1001525332 5:172424765-172424787 GGAGCCTCAGCTTTCTTATCTGG + Intronic
1001594756 5:172891050-172891072 TGAGCCTCAGTTTCCTGATCTGG + Intronic
1001679134 5:173543555-173543577 TGAGCCTCAGCTTCCTCACCAGG - Intergenic
1001773471 5:174312237-174312259 GAAGCCCCGGCTTCCAGAGCGGG + Intergenic
1001932207 5:175681227-175681249 GGAGGTTCAGCTGCCAGGACTGG + Intronic
1002151684 5:177238342-177238364 GGAGCCTCCCTTTCAAGAACTGG - Exonic
1002270242 5:178067106-178067128 GCAGCGTAAGCTTCCAGAAGAGG + Intergenic
1002710645 5:181192614-181192636 GGACCCTCAGCATCCAGAATGGG - Intergenic
1003274552 6:4638286-4638308 CGAACTTCAGCCTCCAGAACTGG - Intergenic
1006417392 6:33912845-33912867 TGTGCCCCAGCTTCTAGAACAGG + Intergenic
1006598502 6:35210845-35210867 TGAGCCTCAGCTTCCTCACCTGG - Intergenic
1007090749 6:39183372-39183394 TGAGCCTCAGCTTCCAAACTGGG + Intergenic
1007225503 6:40310955-40310977 TGAGCCTCAGCTTCCCCATCTGG - Intergenic
1007567609 6:42864445-42864467 GGAGCCCCAGCTTCAAGATGGGG - Intronic
1007633680 6:43285856-43285878 GCAGCCTCAAATTCCAGAAGTGG + Exonic
1007702257 6:43772014-43772036 GGAGCCTCGGCTGCCCGAATGGG + Intronic
1011745901 6:90407497-90407519 GTAGCCTCAGCTCCTAGAAAGGG + Intergenic
1012534034 6:100274337-100274359 GGATCTTCAGCTTCAAGACCAGG - Intergenic
1013611140 6:111796674-111796696 GGATCCCCAGCTCTCAGAACAGG - Intronic
1015852174 6:137585422-137585444 AGAGTTTCAGCCTCCAGAACCGG + Intergenic
1016741931 6:147537793-147537815 GGAGACTCAGCTTTCCAAACAGG + Intronic
1017411565 6:154172890-154172912 GGAGCCTCACCTCCCAGTAGGGG + Intronic
1017725219 6:157272407-157272429 GAAGACTCAGCTTCAAGAAATGG - Intergenic
1017878486 6:158543401-158543423 AGAGCCCCAGCTTCCATATCTGG - Intronic
1018064384 6:160115384-160115406 GGACTCCCAGCCTCCAGAACTGG - Intergenic
1019790480 7:3009356-3009378 GAAGCCTCAGATTCTAGAAAAGG + Intronic
1019930946 7:4222742-4222764 GGACCCTCTGTTTCCACAACAGG - Intronic
1020106727 7:5425673-5425695 GGAGCTACAGCTTCCAAAAGAGG - Intergenic
1020776020 7:12454888-12454910 GGACCCTAAGCTGACAGAACAGG - Intergenic
1022051876 7:26682941-26682963 AGAGCACCGGCTTCCAGAACTGG - Intronic
1022795032 7:33725140-33725162 TGAGCCTCAGCTTCCTTATCTGG - Intergenic
1026468487 7:70674672-70674694 GGAGCTTCAGCTTCAAGGAGAGG - Intronic
1026820289 7:73543036-73543058 TGAGCCTCAGTTTCCTTAACTGG + Intronic
1034490919 7:151392644-151392666 GGAGCCTCAGCTTCTGGTAGTGG - Intronic
1034860179 7:154588090-154588112 GCAGCCTCTGCTGCCAGCACAGG + Intronic
1035170327 7:157013792-157013814 GGAGCTTCAGATTCCTGAAATGG - Intergenic
1036093636 8:5697888-5697910 GGCCCCTCAGCTTCTAGAAAAGG + Intergenic
1036685106 8:10904358-10904380 GGGGTCTCAGGTTCCAGAAATGG + Intronic
1037173723 8:15923598-15923620 GCAGCCTGAGCCTCCTGAACGGG + Intergenic
1038511365 8:28139036-28139058 GGAGCCACAGGGTCCAGAGCAGG + Intronic
1039469420 8:37804007-37804029 GGAGACTCAGCATCCAGGATGGG + Intronic
1039504918 8:38044833-38044855 GGAGCTTCACCTTGCAGAAGAGG - Intronic
1039981138 8:42410870-42410892 TGAGCCTCAGCTTCTAGCGCAGG + Intergenic
1040423539 8:47261458-47261480 GCTGCCTCGGGTTCCAGAACGGG + Intronic
1041006328 8:53499896-53499918 CCAGCCTCAGCTTCCAAAAATGG + Intergenic
1041260967 8:56020220-56020242 GGGCCCTCATCTTCCAGGACTGG - Intergenic
1041362720 8:57069739-57069761 GGAGCCTCTTCTTCCTTAACAGG + Intergenic
1048266329 8:132990739-132990761 TGAGCCTTAGCTTCCAAATCTGG - Intronic
1049275198 8:141716865-141716887 GGTGGCTCAGGTTCCAGAGCAGG - Intergenic
1049585562 8:143431017-143431039 GGGGCCTCAGCTCCCACACCCGG + Intergenic
1049612021 8:143560285-143560307 GGGGCCTCCGCTGCCAGGACTGG + Intronic
1051139265 9:13961141-13961163 TGAGCCTCAGCTTCCTCAACTGG - Intergenic
1051971137 9:22889166-22889188 TGAGCCACTGCTTCCAGACCTGG + Intergenic
1052444610 9:28544298-28544320 GAAGTCTCAGATTACAGAACTGG - Intronic
1052916805 9:33929361-33929383 TGGCCCTCATCTTCCAGAACTGG + Intronic
1053658454 9:40245367-40245389 AGAGTCTCTGCTTCTAGAACTGG - Intronic
1053908829 9:42874640-42874662 AGAGTCTCTGCTTCTAGAACTGG - Intergenic
1054370575 9:64391636-64391658 AGAGTCTCTGCTTCTAGAACTGG - Intronic
1054526144 9:66130855-66130877 AGAGTCTCTGCTTCTAGAACTGG + Intronic
1054678205 9:67881395-67881417 AGAGTCTCTGCTTCTAGAACTGG - Intronic
1055758900 9:79585468-79585490 GGAGCCTCAGATTCTAGTTCTGG + Intronic
1055953522 9:81753057-81753079 GCATCTTCAGCTTCCACAACAGG - Intergenic
1057267939 9:93631139-93631161 CCAGCCTCAGCTCACAGAACAGG - Intronic
1061185311 9:129049511-129049533 GGTGCCTCAGCTTCGAGGGCAGG + Intronic
1061923818 9:133796419-133796441 AGAGCCTCACCTTCAAGAGCAGG + Exonic
1062712694 9:137985406-137985428 GGAGCCTAAGATGCCAGACCTGG - Intronic
1203704430 Un_KI270742v1:26145-26167 AGAGTCTCTGCTTCTAGAACTGG - Intergenic
1203559569 Un_KI270744v1:39677-39699 AGAGTCTCTGCTTCTAGAACTGG + Intergenic
1185922998 X:4114735-4114757 GGAGTTTCAGCCTCCAGAACTGG - Intergenic
1186496064 X:10014259-10014281 GGAGCTTCAGCTTCCCCAGCTGG + Intergenic
1187194600 X:17071049-17071071 GTAGCATCACCTTCCAGAGCTGG - Intronic
1188052784 X:25508176-25508198 GGAGCCTCAGCTCCCAGCCAAGG + Intergenic
1189368925 X:40412429-40412451 GGAGCCTCAGTTTCCAGGTTGGG + Intergenic
1190489400 X:50966272-50966294 GTATCCTCAATTTCCAGAACAGG + Intergenic
1191062974 X:56318772-56318794 ACAGCCTCAGCCTCCAGACCAGG + Intergenic
1191886643 X:65895114-65895136 TGAGCCTCAGCTTCCTCACCTGG - Intergenic
1192036275 X:67566250-67566272 GTAGCCTCAGAATCCAGCACAGG - Intronic
1192890833 X:75389225-75389247 AGAGCCTCAGCTTGCAGTAGCGG - Intronic
1195061007 X:101194448-101194470 CGTGCCTCAGCCTCCAGAGCAGG - Intergenic
1197655005 X:129107341-129107363 TGAGCCTCAGCTTCCTCATCAGG - Intergenic