ID: 1162393958

View in Genome Browser
Species Human (GRCh38)
Location 19:10405314-10405336
Sequence GAGCCTCAGCTTCCAGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 322}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162393949_1162393958 27 Left 1162393949 19:10405264-10405286 CCTGGCTCTGGAGACTGGAGCTG 0: 1
1: 0
2: 2
3: 60
4: 366
Right 1162393958 19:10405314-10405336 GAGCCTCAGCTTCCAGAACTGGG 0: 1
1: 0
2: 2
3: 26
4: 322
1162393952_1162393958 4 Left 1162393952 19:10405287-10405309 CCCAGCTTCAGCAAAACAGGGTT No data
Right 1162393958 19:10405314-10405336 GAGCCTCAGCTTCCAGAACTGGG 0: 1
1: 0
2: 2
3: 26
4: 322
1162393953_1162393958 3 Left 1162393953 19:10405288-10405310 CCAGCTTCAGCAAAACAGGGTTC No data
Right 1162393958 19:10405314-10405336 GAGCCTCAGCTTCCAGAACTGGG 0: 1
1: 0
2: 2
3: 26
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162393958 Original CRISPR GAGCCTCAGCTTCCAGAACT GGG Intronic
902183173 1:14705063-14705085 GACCTTCAGCCTCCGGAACTGGG - Intronic
902389324 1:16093698-16093720 GCTCTTCAGCTTCCTGAACTCGG + Intergenic
902467666 1:16628301-16628323 GAGCCCCAGTTTCCTGAAATGGG + Intergenic
902506917 1:16944427-16944449 GAGCCCCAGTTTCCTGAAATGGG - Intronic
902619189 1:17640510-17640532 GAGCCTCAGCTTCCCCATCCAGG + Intronic
902685079 1:18071226-18071248 GAGCCTCAGTTTCCTAACCTAGG + Intergenic
905796223 1:40818116-40818138 GGTCCTCAGTCTCCAGAACTGGG - Intronic
906210219 1:44008650-44008672 GAGCCTCAGCATCCAGCAGGAGG + Intronic
906565546 1:46798619-46798641 GAGCCTCAGCTTCATTATCTGGG + Intronic
906669849 1:47646410-47646432 GGGCCTGGGCTTCCTGAACTGGG + Intergenic
906952261 1:50344518-50344540 CAACCTCAGCTAACAGAACTGGG + Intergenic
909091923 1:71236709-71236731 CAGCCTCAGCTACCAACACTGGG + Intergenic
909507587 1:76411246-76411268 AAGCATCAGCTTTCAGGACTTGG - Intronic
910769863 1:90820073-90820095 CTGCCTCAGCCTCCAGAGCTAGG - Intergenic
912580255 1:110714613-110714635 CAGCCACATCTTCCAGCACTGGG - Intergenic
913160408 1:116140009-116140031 GACCACCAGCCTCCAGAACTGGG + Intergenic
913205971 1:116539214-116539236 GAGCCTCGGCTTCCTGGAGTTGG - Intronic
913373734 1:118129075-118129097 GAGCTTCAGCTTCCCGAAGAAGG - Intronic
914916767 1:151823879-151823901 AAGCCTCAGCCTCCTGAAGTGGG + Intronic
915812143 1:158924475-158924497 GAACCCCAGCCTCCAGAACTGGG + Intergenic
916056215 1:161070268-161070290 GAGCCTCAGTTTCCAAACCTAGG + Intergenic
916581266 1:166111355-166111377 GGGCCTCTGCTTTCAGAGCTGGG + Intronic
919692042 1:200536386-200536408 GAGACACTGCTTCCAGCACTGGG - Intergenic
919893129 1:201990610-201990632 GAGCCTCAGACTTCATAACTGGG + Intronic
920389257 1:205588821-205588843 GAACCTTGTCTTCCAGAACTTGG - Intronic
920502115 1:206491986-206492008 GAGCCTCAGTTTCCTCACCTAGG - Exonic
923212192 1:231813504-231813526 GATCCTCAGCTTCCTTGACTTGG + Intronic
923615392 1:235533118-235533140 GACTTCCAGCTTCCAGAACTGGG + Intergenic
923681155 1:236119768-236119790 CAGCCTGGGCTTCCAGCACTGGG - Intergenic
923798163 1:237180190-237180212 GAGCCTCGCCTTCCTGACCTGGG - Intronic
923964093 1:239116922-239116944 CAGCATCAGCTTCCAAAACTGGG + Intergenic
924218272 1:241847868-241847890 CAACATCAGCCTCCAGAACTGGG + Intergenic
1063084121 10:2799717-2799739 GAGCCTCTGCTCCCCGGACTTGG - Intergenic
1064696790 10:17975208-17975230 GGGCCTGAGATTCCAGGACTTGG - Intronic
1066267501 10:33790621-33790643 TAGCCTCAGCGTCTAGCACTTGG - Intergenic
1069657544 10:70101164-70101186 TAGCCTGGGCTTCCAGAGCTCGG - Intronic
1069705510 10:70456825-70456847 GAGCCTCAGTTTCCACATCTAGG + Intergenic
1070470882 10:76778152-76778174 GACTTTCAGCCTCCAGAACTGGG + Intergenic
1070668293 10:78360742-78360764 CAGCCTCAGCTCTCAGAATTTGG + Intergenic
1070798283 10:79229960-79229982 GAGCCTCAGTTTCCTCACCTGGG - Intronic
1070799664 10:79237930-79237952 GAGCCTCAGCCTCCAAATCCAGG + Intronic
1071501834 10:86209893-86209915 GAGCCTCAGTTTCCCCATCTGGG + Intronic
1071567518 10:86679501-86679523 GAGCCTCACCCTGCAGAAGTAGG + Exonic
1073061251 10:100735206-100735228 GAGCCTCACGTTCCAGAAAGTGG + Intergenic
1073845074 10:107545134-107545156 GAGGCTGAGCTTCCAGTTCTGGG + Intergenic
1074284186 10:112082442-112082464 GTGCCTCAGAGTCCAGACCTGGG + Intergenic
1075518192 10:123126375-123126397 GACTTCCAGCTTCCAGAACTGGG + Intergenic
1075610149 10:123847145-123847167 TAGCCTCATCTTCCAGAATAGGG + Intronic
1076131913 10:128019252-128019274 GAGCCTCAGTTTCCCCAGCTGGG + Intronic
1076142788 10:128093048-128093070 GAGCCTCAGTTTCCCTAGCTGGG - Intergenic
1076624477 10:131812996-131813018 GAGCCCCAGTTGCCAGCACTGGG + Intergenic
1077198421 11:1293166-1293188 GGGCCTCAGCTTCCAGAGTGTGG + Intronic
1077292234 11:1803234-1803256 CAGCCTCAGCTTCCACAGCATGG + Intergenic
1077317586 11:1926233-1926255 GAGCCTCAGTTTCCCCACCTGGG + Intronic
1077489723 11:2855244-2855266 GAGCCTCCTCTTCCAGAGCCTGG - Intergenic
1078850519 11:15158941-15158963 TAGCCTCAGCTCCTAGAACAGGG + Intronic
1079008415 11:16809274-16809296 GATGCTCAGCTTCCAGAATCAGG - Intronic
1080405424 11:31974535-31974557 GAGGCTCAGAGTCCACAACTGGG + Intronic
1082773257 11:57225300-57225322 GAGCCTCAGCTTCTCAGACTGGG - Intergenic
1082818446 11:57526611-57526633 GAGCCTCAGCTTCTTCAGCTGGG + Intergenic
1082948447 11:58786147-58786169 CAGCCTCAGCTTCCCAAAGTGGG + Intergenic
1083896004 11:65620118-65620140 GAGGCTCAGCTTACAGTACAGGG + Intronic
1084150354 11:67285249-67285271 GAGCCCCAGCTGACAGAGCTGGG + Intronic
1084389218 11:68864204-68864226 AAGCCTCAGTTTCCACACCTGGG - Intergenic
1084665125 11:70572130-70572152 AGGCTTCAGCCTCCAGAACTGGG + Intronic
1085278851 11:75317253-75317275 GGGCCTCATCTTCCTGATCTGGG - Intronic
1085294463 11:75423281-75423303 GGGCCAGAGCTTCCAGGACTTGG + Intronic
1085474580 11:76781868-76781890 GAATCCCAGCTTTCAGAACTAGG - Intergenic
1088918038 11:114241946-114241968 TAGCTTTAGCTTCCAGAGCTCGG + Intronic
1089292233 11:117444289-117444311 GAGCCACAGCTGCCAGAGCGTGG - Intronic
1089400299 11:118160576-118160598 GAACCTCAGCTTTGAAAACTGGG + Intergenic
1090358555 11:126157086-126157108 GAGCCTCAGTTTCCATATCTGGG - Intergenic
1090735478 11:129609200-129609222 GATCCTCAGCCTCCACAACAGGG + Intergenic
1091129054 11:133128615-133128637 GAGCCTCAGATGCCATAGCTTGG + Intronic
1091765194 12:3115541-3115563 GACCCCCAGCCTCCAGAACTGGG - Intronic
1092128837 12:6094181-6094203 GACCTCCAGCCTCCAGAACTGGG + Intronic
1093374187 12:18404098-18404120 GTGCCTTAGCTTCCAAAATTAGG + Intronic
1095913198 12:47449503-47449525 GGGCCTCAGATTCTAGGACTTGG + Intergenic
1097315779 12:58170123-58170145 TTGCCTGAGCTACCAGAACTCGG - Intergenic
1097616092 12:61886276-61886298 GAAGCTCAATTTCCAGAACTGGG - Intronic
1098760277 12:74415857-74415879 GAGCCTCAACTTCCATAAGGTGG - Intergenic
1099869059 12:88323044-88323066 GACTCTCAATTTCCAGAACTGGG + Intergenic
1100348621 12:93756585-93756607 CATCCTCAGCATCCAGAACTGGG + Intronic
1100519733 12:95362319-95362341 GAGTCTCAGCCTCCAAAATTTGG + Intergenic
1100899059 12:99217493-99217515 GATCCTCAGCTTCCTTAAGTTGG + Intronic
1101953446 12:109194018-109194040 TAGACTTGGCTTCCAGAACTGGG - Intronic
1101964969 12:109276297-109276319 GAGCCTCAGTTTCCTCATCTGGG + Intergenic
1102235807 12:111293791-111293813 GAGCCTCAACTTCCCTACCTGGG + Intronic
1102389332 12:112536901-112536923 CAGCCTCTGCCTCCAGCACTTGG - Intergenic
1102466337 12:113132916-113132938 GAGCCTCAGTTTCCCCATCTGGG + Intronic
1102619004 12:114178784-114178806 GAGCCTCAGGTTCCAGGTCCGGG - Intergenic
1102689786 12:114751414-114751436 GAGCCTCAGTTTCCCCAATTTGG - Intergenic
1103643660 12:122373308-122373330 GTGCCTCAGCCTCCGGAGCTGGG - Intronic
1104531710 12:129578115-129578137 GGTCTTCAGATTCCAGAACTTGG + Intronic
1106135230 13:26968599-26968621 AAGCCCCAGCTGCCAGGACTGGG + Intergenic
1112306648 13:98280346-98280368 CAGCCTCAGCTTTCAGGCCTCGG + Intronic
1113026438 13:105946092-105946114 GAGCCTCTGATTCCAGATCCAGG - Intergenic
1113204976 13:107906662-107906684 CAACCTCAGCTTCCAGATCCAGG + Intergenic
1113447165 13:110378404-110378426 GGGCCTCAGTTTCCTCAACTGGG - Intronic
1114478831 14:23018236-23018258 GACCTACAGCCTCCAGAACTGGG + Intronic
1114660678 14:24341839-24341861 GACCCTCAGCTTCCAGCAAGGGG + Intergenic
1115485608 14:33908693-33908715 CAGCCTCAGCTCCCAGAGTTTGG - Intergenic
1118845303 14:69543593-69543615 GGGCCTCAGCGCCTAGAACTGGG + Intergenic
1118850152 14:69576834-69576856 GCACCTCAGCTTCCTGCACTTGG - Intergenic
1119687705 14:76645724-76645746 GAACAGCAGCTCCCAGAACTGGG - Intergenic
1120517939 14:85491997-85492019 GAGCCCCAGTTTCCAGATGTGGG + Intergenic
1121511727 14:94517606-94517628 GAGCAAAAGCTTCCAGTACTGGG - Exonic
1122832370 14:104405542-104405564 GATCCTCAGCTTCCAGCCATGGG - Intergenic
1123755550 15:23395098-23395120 TAGCCCCAGCCTCCAAAACTAGG - Intergenic
1125570448 15:40713355-40713377 CAGCCTCAGCCTCCCAAACTGGG + Intronic
1127347282 15:58113377-58113399 TAGTCTGAGCTTCCAGAACTCGG - Intronic
1128349250 15:66878075-66878097 GAGCCTCAGCTTCCTCCCCTGGG - Intergenic
1128727652 15:69999739-69999761 CCTTCTCAGCTTCCAGAACTAGG - Intergenic
1129925197 15:79357822-79357844 GAGCCTCAGCTTTCCCATCTGGG + Intronic
1130048475 15:80464269-80464291 GAGCCTCAGCTTCCTCCTCTGGG + Intronic
1130539270 15:84810318-84810340 GAGGCTCAGCTGCCTGAGCTGGG + Intergenic
1130638923 15:85652658-85652680 GATCTCCAGCCTCCAGAACTGGG - Intronic
1130725098 15:86431151-86431173 GAACCTCACTTCCCAGAACTTGG + Intronic
1131294748 15:91137103-91137125 GAGCCTCAGTTTCCTCAGCTGGG + Intronic
1132090110 15:98941152-98941174 GAGCCTCAGTTTCCTCACCTCGG + Intronic
1132581402 16:686314-686336 GAGCCTCAGCTTTCCTACCTGGG - Intronic
1132947038 16:2537680-2537702 GAGCCTCAGTTTCCCGGTCTGGG + Intergenic
1132968650 16:2673712-2673734 GAGCCTCAGTTTCCCGGTCTGGG - Intergenic
1133421175 16:5648264-5648286 GAGCCTCAGTTTTCACATCTGGG + Intergenic
1134131140 16:11651024-11651046 GAGCCTCAGTTTCCCCACCTGGG - Intergenic
1134460826 16:14427928-14427950 TAGCCCCAGCCTCCAAAACTAGG + Intergenic
1134515007 16:14879973-14879995 GAGCCTCAGCAGCCACATCTAGG - Intronic
1134702684 16:16278620-16278642 GAGCCTCAGCAGCCACATCTAGG - Intronic
1134825053 16:17277867-17277889 GAGCCTCAGTTCCCACATCTGGG - Intronic
1134964859 16:18433495-18433517 GAGCCTCAGCAGCCACATCTAGG + Intronic
1134969146 16:18516030-18516052 GAGCCTCAGCAGCCACATCTAGG + Intronic
1135156824 16:20059774-20059796 GAGCCTCAGTTTCCTCATCTGGG - Intronic
1135970597 16:27069316-27069338 GAGCCTCAGTTTCCTCATCTGGG + Intergenic
1136139942 16:28282022-28282044 GTGCCTCAGCTTCCCCATCTGGG + Intergenic
1136283219 16:29226396-29226418 GAGCCTCAGCTTCCTTTCCTTGG + Intergenic
1136403249 16:30029757-30029779 GAGACTCAGTTTCCACAAATGGG - Intronic
1136550741 16:30981056-30981078 GAGCTTCTTCTTCCGGAACTGGG - Exonic
1137222216 16:46466816-46466838 GAGTCTCAACTTCCAGAAATTGG + Intergenic
1137764152 16:50964673-50964695 GAGCCACAGCTTCCAGGAACAGG - Intergenic
1138824291 16:60300272-60300294 GACTTCCAGCTTCCAGAACTAGG - Intergenic
1139437151 16:66942863-66942885 GAGCCTCAGTTTCCTTATCTGGG - Intronic
1140158120 16:72455233-72455255 GAGTCTCTGATTCCAGGACTTGG - Intergenic
1140422243 16:74830111-74830133 CAGCCTCAACTTCCTGATCTCGG + Intergenic
1142087600 16:88192293-88192315 GAGCCTCAGCTTCCTTTCCTTGG + Intergenic
1142221157 16:88855954-88855976 GAACCTCAGCTGCCACACCTGGG - Intronic
1143369428 17:6429233-6429255 GGGCCTCAGTTTCCCCAACTAGG + Intronic
1144806855 17:17973463-17973485 GAGCCTCAGGTTCCCTAGCTGGG + Intronic
1146971462 17:37076042-37076064 CAGCCTCAGCCTCCAGGGCTTGG + Intergenic
1147236394 17:39060824-39060846 GAGCCTCAGTTTCCTCATCTGGG + Intergenic
1149207349 17:54264067-54264089 GAGATTCAGTTTCCAGAACTCGG + Intergenic
1149455038 17:56780828-56780850 GGGCCTCAGTTTCCAAATCTGGG - Intergenic
1151465870 17:74284929-74284951 GCGCCTCAGCATCCAGCCCTGGG + Intronic
1152008220 17:77695543-77695565 TCCCCTCTGCTTCCAGAACTGGG - Intergenic
1152573977 17:81132224-81132246 GAGCCTCAGCTTCCCCACCAGGG - Intronic
1203171047 17_GL000205v2_random:148133-148155 GACCCTCTCCTTCCAGAACATGG + Intergenic
1153617396 18:6947446-6947468 GAGCCTCGGCTTCCACATCTGGG + Intronic
1153622377 18:6990915-6990937 GGGCCTCAGTTTCCTCAACTGGG + Intronic
1153631282 18:7072797-7072819 CAGCCTCAGCATCCAAAGCTGGG - Intronic
1154245404 18:12692502-12692524 GGGGCTGAGCTTCCAGCACTGGG - Intronic
1155185300 18:23382393-23382415 TGGGCTCAGCCTCCAGAACTGGG - Intronic
1155219713 18:23673010-23673032 CTGCCTCAGCCTCCAGAGCTGGG - Intergenic
1155515291 18:26618401-26618423 GAGCCTTTGCTTCAGGAACTAGG + Intronic
1156044828 18:32866216-32866238 GATCCTCAGCTTTCAGTACCTGG - Intergenic
1156424162 18:36990556-36990578 CTGCCTCAGCCTCCCGAACTGGG - Intronic
1159575577 18:70172052-70172074 GTGCTTCTGCTTCCAGAACAGGG + Intronic
1160590429 18:79941482-79941504 GAGTCCCAGTTTCCAGAGCTAGG - Intronic
1161141911 19:2653287-2653309 GACCCTCAGCTCCCAAACCTGGG + Intronic
1161207980 19:3051801-3051823 CAGCCTCAGCCTCCTGAGCTGGG - Intergenic
1161421804 19:4179988-4180010 GGGCTTCAGCTTCCAGCACAAGG + Intronic
1161479091 19:4501796-4501818 GAGCCTCAGGTGCCACAACGGGG + Intronic
1162046043 19:8001077-8001099 GAGCTTCAGCTTCCTCCACTGGG + Intronic
1162196218 19:8986859-8986881 AAGCCTCAGGTCCCAGAACCAGG + Intergenic
1162393958 19:10405314-10405336 GAGCCTCAGCTTCCAGAACTGGG + Intronic
1163056268 19:14721154-14721176 GGGCCTCAGCTTCCTCATCTGGG - Exonic
1163576047 19:18111228-18111250 GAGCCTCAGTTTTCTTAACTGGG - Intronic
1163602058 19:18255182-18255204 GAGGCTCAGCTTCCAGAAAGCGG - Intronic
1164671353 19:30073866-30073888 GATCACCAGCTGCCAGAACTGGG + Intergenic
1166810245 19:45509781-45509803 GAGCCTCAGTTTCCCCAGCTGGG - Intronic
1167298964 19:48668258-48668280 GAGCCTCACCTTCCTCAGCTGGG + Intronic
1167578338 19:50328332-50328354 GCGCCTCTGCTTCCAGGACGCGG - Exonic
926365318 2:12127878-12127900 AAACATGAGCTTCCAGAACTAGG + Intergenic
927083899 2:19655602-19655624 GAACCTCAGTGACCAGAACTAGG - Intergenic
927603206 2:24462556-24462578 CCGCCTCAGCTTCCCGAGCTGGG - Intergenic
928183655 2:29090161-29090183 GACTTCCAGCTTCCAGAACTGGG - Intergenic
928336943 2:30406322-30406344 GAGACTCAGATTCCAAAAATGGG - Intergenic
930606824 2:53501685-53501707 GACTTTCAGCCTCCAGAACTGGG - Intergenic
931987820 2:67758345-67758367 GAGCCCCATATTCCAGAGCTTGG + Intergenic
932307209 2:70712652-70712674 GAACCTCAGAGGCCAGAACTAGG + Intronic
933537735 2:83597501-83597523 GAACCTCAACTCCCAGAGCTAGG - Intergenic
933615654 2:84479850-84479872 GAGCCAGAGCTTCCATAACCTGG - Intergenic
934847083 2:97668565-97668587 GACCTCCAGCCTCCAGAACTGGG + Intergenic
936594569 2:113835666-113835688 CAGCCTCAACTTCCTGCACTTGG + Intergenic
938974562 2:136463396-136463418 GAGCCTCAGCCTGCACAATTTGG + Intergenic
941303917 2:163836965-163836987 GAACTGTAGCTTCCAGAACTTGG - Intergenic
944558322 2:200909586-200909608 GTGCCTCAGCCTCCTGAGCTGGG - Exonic
945036391 2:205707449-205707471 GAGCTTCAGATTACAGAGCTTGG - Intronic
946132244 2:217615676-217615698 GAGCCTGTGCTTCCAGAACTGGG - Intronic
946448988 2:219763708-219763730 GAACTCCAGCCTCCAGAACTGGG - Intergenic
947976228 2:234368545-234368567 GGACCTCTGATTCCAGAACTGGG + Intergenic
948261230 2:236605901-236605923 GACTCCCAGCATCCAGAACTGGG - Intergenic
948288003 2:236802224-236802246 GACTCCCAGCCTCCAGAACTGGG - Intergenic
949074017 2:242043916-242043938 GAGCCTCTGCTAGCAGAACTGGG + Intergenic
1168818623 20:758347-758369 CTGCCTCAGCTTCCCGAGCTGGG + Intergenic
1170597256 20:17815427-17815449 CTGCCTCAGCTTCCCGAAGTGGG - Intergenic
1172683516 20:36735870-36735892 AAGCCTCAGCCTCCTGAGCTGGG - Intronic
1172836118 20:37874248-37874270 CAGCCTCAGCTTGCATAAATCGG - Intergenic
1173569271 20:44066234-44066256 GAGCCTCAGTTACCACATCTAGG + Intronic
1173895981 20:46550990-46551012 GAGCCACTGCTCCCAGTACTTGG - Intergenic
1174123328 20:48283733-48283755 GAGCCTCTGCTACCAGAACTTGG + Intergenic
1175389043 20:58614819-58614841 GTGCCTCAGCTTCCTCACCTCGG - Intergenic
1175530665 20:59672541-59672563 GAGCCTCAGTTTCCTCATCTGGG + Intronic
1175856617 20:62123902-62123924 GGGCCTCAGCTTCTCTAACTGGG - Intronic
1178677437 21:34643091-34643113 GATCCTCAGCCTCCTGAGCTGGG + Intergenic
1179928950 21:44554317-44554339 GACTTCCAGCTTCCAGAACTGGG + Intronic
1179994727 21:44968613-44968635 GAGCCTCAGCACCCACACCTGGG - Intronic
1180630622 22:17227088-17227110 CTGCCTCAGCTTCCTGAAGTAGG - Intergenic
1180921293 22:19522901-19522923 GAGCCCCAGCCTCCAGCCCTGGG + Intergenic
1180962783 22:19769827-19769849 GACCTCCAGCCTCCAGAACTGGG + Intronic
1182093120 22:27609442-27609464 GAGCCTCAGTTTCCACACCTGGG - Intergenic
1182924789 22:34111967-34111989 GACTCCCAGCCTCCAGAACTTGG - Intergenic
1183045823 22:35219043-35219065 GCGTCTCATTTTCCAGAACTGGG - Intergenic
1183103429 22:35598136-35598158 CAGCCTCAGATGCAAGAACTGGG + Intergenic
1183352650 22:37342760-37342782 GAGGCTCAGCTTCAAGAGCTGGG + Intergenic
1184987212 22:48144083-48144105 GAGCCTCAGCTCCCTGAAGATGG + Intergenic
1185162504 22:49238349-49238371 GAGCCTCAGTTTCCTCACCTGGG - Intergenic
949997035 3:9626296-9626318 GAGCTTCTGCTTCCAGCACACGG - Intergenic
950168181 3:10816850-10816872 GAGCCTCAGCTTTCCTAACTGGG + Intronic
950490754 3:13303503-13303525 GTGCCTCTGCTTCCACACCTGGG - Intergenic
950505071 3:13389443-13389465 GAGCCTCAGCCTCCTGCCCTGGG - Intronic
950553373 3:13680965-13680987 GAGTCCCTGCTTCCAGAACACGG + Intergenic
950784142 3:15419050-15419072 GATCCTCAGCATCCTGAGCTGGG - Intronic
951640553 3:24830102-24830124 GAGCCTCAGCCTCCAGGGCTCGG - Intergenic
953601460 3:44369864-44369886 GAGGCTCAGTTTGAAGAACTCGG + Intronic
954326849 3:49868671-49868693 GAGCCTCAGTTTCCTCAACTGGG - Intronic
955203986 3:56878510-56878532 GACCCTCAACTCCCAGCACTTGG - Intronic
956323947 3:68029878-68029900 AAGCCTCAGCTGTCAGAAATTGG + Intronic
956483348 3:69695282-69695304 GATCCTCAGTTTCCAGAATCCGG + Intergenic
957225552 3:77440825-77440847 GAGACTGAGCTTCCACAACCAGG - Intronic
957558340 3:81788757-81788779 GAGCATCAGCTTTCAAATCTTGG - Intergenic
957965843 3:87321827-87321849 GAGTCCCTGATTCCAGAACTTGG + Intergenic
960194381 3:114747449-114747471 CTGCCTCAGCCTCCCGAACTGGG - Intronic
960956144 3:123032683-123032705 TAGCCCCAGCTTACAGAACAGGG + Intergenic
961782227 3:129326962-129326984 GAGCCTCAGCCTCCTGCCCTGGG - Intergenic
962215416 3:133516776-133516798 TAGACTTAGCCTCCAGAACTGGG - Intergenic
962319364 3:134377838-134377860 CTGCCTCAGCTTCCTGAGCTAGG - Intergenic
963654564 3:148029307-148029329 GATTTTGAGCTTCCAGAACTGGG - Intergenic
964366067 3:155951962-155951984 CAGGCTCAGCTTCCATAATTAGG + Intergenic
967302287 3:188026738-188026760 GAGCCTCAGCCTCAGGCACTGGG - Intergenic
967323017 3:188212680-188212702 TCGCCTCAGCTTCCAGAACAAGG - Intronic
968726594 4:2250760-2250782 GAGCTTCTGCTTCCAGAAAAGGG - Intronic
970023886 4:11600240-11600262 GAACTCCAGCCTCCAGAACTGGG - Intergenic
972512535 4:39783166-39783188 GAGCCTCAGTTTCCTCATCTAGG + Intergenic
977092659 4:92698063-92698085 AAACCTCAGCTTCCTGAAGTTGG + Intronic
981100893 4:140828203-140828225 GACCTCCAGCCTCCAGAACTGGG - Intergenic
983892699 4:173046994-173047016 TAGCCTTTGCTTGCAGAACTGGG + Intergenic
984271567 4:177554173-177554195 GTGCCTCAGCCTCCTGAGCTGGG + Intergenic
984889605 4:184479348-184479370 GAGCATCTGCTTGCAGACCTGGG - Intergenic
991253863 5:64593731-64593753 GAGTGTCAGCTACCAGCACTGGG - Intronic
992393123 5:76347555-76347577 GTGCCTCAGCCTCCCGAGCTGGG + Intronic
992998389 5:82355198-82355220 GAGCCACATTTTCCAGAACTTGG - Intronic
993349157 5:86825225-86825247 GAGCTTCTGCTCCCATAACTGGG - Intergenic
993711143 5:91226436-91226458 CATCCTCAGCTTCCAGAAATGGG + Intergenic
995754890 5:115492435-115492457 GACTTTCAGCCTCCAGAACTGGG - Intergenic
996343269 5:122461789-122461811 ATGCCTCAGCCTCCATAACTGGG + Intronic
997900754 5:137761886-137761908 GACCTCCAGCCTCCAGAACTAGG + Intergenic
999743554 5:154574848-154574870 ACCTCTCAGCTTCCAGAACTTGG + Intergenic
999962344 5:156769439-156769461 GAGCCTCAGCTGCAAGAGTTCGG - Intergenic
1001594757 5:172891051-172891073 GAGCCTCAGTTTCCTGATCTGGG + Intronic
1001757086 5:174178856-174178878 GAGCCTTAGGTTTCAGAACATGG + Intronic
1002051649 5:176574925-176574947 GAGCCTCAGTTTCCAGCTCCAGG - Intronic
1002710644 5:181192613-181192635 GACCCTCAGCATCCAGAATGGGG - Intergenic
1003570402 6:7252828-7252850 GAGCCTCAACTCCTATAACTAGG + Intergenic
1004403520 6:15310744-15310766 AAATCTCAACTTCCAGAACTGGG - Intronic
1004859077 6:19782481-19782503 GAGCCTCAGTTTCCTCAAGTAGG + Intergenic
1006417393 6:33912846-33912868 GTGCCCCAGCTTCTAGAACAGGG + Intergenic
1007159519 6:39777754-39777776 GAGCCTCAGCTGCCTTAAATAGG + Intergenic
1007283470 6:40730084-40730106 GAGCTTCAGCTTCCTGATTTCGG + Intergenic
1010219926 6:73439904-73439926 GAGCCTCAGGATTCAGAACCAGG + Intronic
1010954567 6:82075118-82075140 GAGCCTCAGTTTCCTCATCTAGG + Intergenic
1012711725 6:102615775-102615797 GAGCTTCAGGTTCCAGTTCTAGG - Intergenic
1013347994 6:109280984-109281006 GACCTCCAGCCTCCAGAACTGGG - Intergenic
1014380593 6:120736033-120736055 GAGCTTCAGCTTCTATAAATAGG + Intergenic
1014743319 6:125170883-125170905 GAGTCTCAGATACCAGAACATGG - Intronic
1015852175 6:137585423-137585445 GAGTTTCAGCCTCCAGAACCGGG + Intergenic
1015957864 6:138616804-138616826 GAGCCTAATCTGCCAGAACCAGG + Intronic
1016750079 6:147622548-147622570 GAGCCCCAGCTTCCTACACTTGG - Intronic
1017486850 6:154910965-154910987 GACTCTCAGCTTGCACAACTGGG + Intronic
1017878485 6:158543400-158543422 GAGCCCCAGCTTCCATATCTGGG - Intronic
1019374211 7:680547-680569 GAGCCTCACCTTCCTGACGTAGG + Exonic
1020016460 7:4834681-4834703 GTGCCTCTGCATCCAGCACTCGG - Exonic
1021493929 7:21251259-21251281 GAGTTTCAGCTTCCAGCACCAGG - Intergenic
1022522386 7:31016591-31016613 GGGCCTCAGCCTCCTGAACAAGG - Intergenic
1025737858 7:64168914-64168936 AGGACACAGCTTCCAGAACTTGG + Intronic
1026192831 7:68145154-68145176 GTGTCTCAGCCTCCAGAGCTGGG + Intergenic
1026355033 7:69550154-69550176 GAGCCTCAGTTTCCCCATCTAGG - Intergenic
1027048977 7:75009687-75009709 CAGCCACAGCTTCTAGTACTGGG + Intronic
1027051810 7:75025491-75025513 GAGCCTCAGCTTCCCCCAGTAGG + Intergenic
1029191185 7:98773445-98773467 CTGCCTCAGCCTCCAGAGCTGGG + Intergenic
1031346961 7:120679659-120679681 GAACCTCAACTTCCAGTGCTTGG - Intronic
1032471275 7:132181104-132181126 GAGCCTGACCTGCCAGTACTTGG + Intronic
1033342895 7:140505800-140505822 GACTTCCAGCTTCCAGAACTGGG - Intergenic
1034211556 7:149367810-149367832 GAGTCTCAGCTCACAGAACTTGG - Intergenic
1034945039 7:155256433-155256455 GACTCCCAGCCTCCAGAACTGGG + Intergenic
1035530539 8:347274-347296 GAGCTCCAGCTTCAAGAGCTTGG + Intergenic
1035712493 8:1729356-1729378 GAGTCTCAGCTCCCAGAAACTGG - Intergenic
1035977880 8:4333450-4333472 GAGCCTCAGTTTCCTTATCTTGG + Intronic
1036717460 8:11139546-11139568 GAGCCTCACCTCCTGGAACTCGG + Intronic
1039542346 8:38382359-38382381 GAGCCCCAGCGTCCCGAACCAGG - Intergenic
1039981139 8:42410871-42410893 GAGCCTCAGCTTCTAGCGCAGGG + Intergenic
1040474529 8:47764625-47764647 GAGCCTCAGGGTGCAGCACTGGG - Intergenic
1041900547 8:62978074-62978096 GGGACACAGCTTCCAGAAGTAGG - Exonic
1044780700 8:95740676-95740698 GACTCTCAGGTTTCAGAACTTGG + Intergenic
1046219815 8:111199936-111199958 GAGACTCATGTTCCAGAGCTTGG - Intergenic
1046540993 8:115582679-115582701 GGAACTCAACTTCCAGAACTTGG + Intronic
1049233143 8:141494596-141494618 GAGCCTCACCTTCCTGGAATGGG + Intergenic
1049311502 8:141936140-141936162 AAGCCCCAGCCTCCAGGACTAGG + Intergenic
1049786490 8:144453328-144453350 GAGCCTCTGCTGCCGGAACCTGG - Exonic
1050968041 9:11833939-11833961 GAGCCTCAGGTTGCAGGTCTCGG - Intergenic
1051365206 9:16316960-16316982 GAGCCTCAGCTCCCAGGAGAAGG - Intergenic
1052916806 9:33929362-33929384 GGCCCTCATCTTCCAGAACTGGG + Intronic
1055690738 9:78827697-78827719 GAGCCTCAGTTTCTACATCTGGG + Intergenic
1056816581 9:89806166-89806188 GCACCTCAGTTTCCACAACTGGG - Intergenic
1056889904 9:90481689-90481711 GAACTTCAGGTTACAGAACTTGG - Intergenic
1057030980 9:91775092-91775114 GACCTCCAGCCTCCAGAACTAGG + Intronic
1057267938 9:93631138-93631160 CAGCCTCAGCTCACAGAACAGGG - Intronic
1059911369 9:119047908-119047930 AAGTGTCAGCTTCCAGTACTAGG + Intergenic
1060155521 9:121317410-121317432 GGGCCTCAGATTCCTGATCTGGG + Intronic
1060290016 9:122293332-122293354 GAGCCTAAATTTCCACAACTAGG - Intronic
1060523990 9:124310206-124310228 AAGCCTCAGATTCCTGAAATGGG + Intronic
1060977651 9:127774382-127774404 GATCCTCAGCTTCCATCAGTAGG - Exonic
1061242511 9:129382802-129382824 GAGCCACAGTTTCGAGAGCTTGG - Intergenic
1061544061 9:131293732-131293754 GAGCCTCAGTTTCCCTATCTGGG + Intronic
1061847656 9:133396919-133396941 GGGCCTCAGCTCACAGAGCTGGG - Intronic
1062420662 9:136480278-136480300 GAAACTCTGCTGCCAGAACTGGG + Intronic
1185875193 X:3696245-3696267 GACTCCCAGCCTCCAGAACTGGG + Intronic
1185922997 X:4114734-4114756 GAGTTTCAGCCTCCAGAACTGGG - Intergenic
1186496065 X:10014260-10014282 GAGCTTCAGCTTCCCCAGCTGGG + Intergenic
1188055015 X:25530778-25530800 GAGCCTCAGCTTCCTCAAACAGG + Intergenic
1189445326 X:41075652-41075674 GGGGCTCAGCTTCCACCACTTGG + Intergenic
1191608347 X:63085292-63085314 GAGCTTTAGCTTCTATAACTTGG - Intergenic
1193152305 X:78138640-78138662 GTGCCTCAGCCTCCCGAGCTGGG - Intronic
1194163474 X:90484485-90484507 GATTCTCAGCCTTCAGAACTGGG - Intergenic
1195331716 X:103808387-103808409 GAGCCTCGTTCTCCAGAACTTGG + Intergenic
1195697093 X:107675096-107675118 GAGTCTCAGCTTCAAACACTCGG - Intergenic
1196466185 X:115973550-115973572 GAGTCCCTGATTCCAGAACTTGG + Intergenic
1197655004 X:129107340-129107362 GAGCCTCAGCTTCCTCATCAGGG - Intergenic
1198146252 X:133860287-133860309 GAGCCTCAGTTTCAAAATCTGGG - Intronic
1199154083 X:144525738-144525760 GAGTCTCTGATTCCAGAATTTGG - Intergenic
1199690576 X:150306255-150306277 GAGCCTCGGCTGCCCGATCTAGG + Intergenic
1200060259 X:153480859-153480881 GGGCCTCAGCTTCAAGGCCTCGG - Intronic
1200509741 Y:4062213-4062235 GATTCTCAGCCTTCAGAACTGGG - Intergenic