ID: 1162393959

View in Genome Browser
Species Human (GRCh38)
Location 19:10405315-10405337
Sequence AGCCTCAGCTTCCAGAACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 737
Summary {0: 1, 1: 0, 2: 5, 3: 69, 4: 662}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162393953_1162393959 4 Left 1162393953 19:10405288-10405310 CCAGCTTCAGCAAAACAGGGTTC No data
Right 1162393959 19:10405315-10405337 AGCCTCAGCTTCCAGAACTGGGG 0: 1
1: 0
2: 5
3: 69
4: 662
1162393949_1162393959 28 Left 1162393949 19:10405264-10405286 CCTGGCTCTGGAGACTGGAGCTG 0: 1
1: 0
2: 2
3: 60
4: 366
Right 1162393959 19:10405315-10405337 AGCCTCAGCTTCCAGAACTGGGG 0: 1
1: 0
2: 5
3: 69
4: 662
1162393952_1162393959 5 Left 1162393952 19:10405287-10405309 CCCAGCTTCAGCAAAACAGGGTT No data
Right 1162393959 19:10405315-10405337 AGCCTCAGCTTCCAGAACTGGGG 0: 1
1: 0
2: 5
3: 69
4: 662

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162393959 Original CRISPR AGCCTCAGCTTCCAGAACTG GGG Intronic
900333013 1:2145800-2145822 CGCCTCAGCTTCCAGAGCAGCGG - Intronic
900659129 1:3774181-3774203 AGCCTCAGCTCCTAGAAGTGAGG + Intronic
901015440 1:6226822-6226844 TGCCTCAGCTTCCAGAGTAGGGG + Intronic
901784537 1:11616152-11616174 AGCCTCAGCTTCCAAATCTGTGG - Intergenic
901820319 1:11825058-11825080 AGCCTCAGTTTCCCCATCTGAGG - Intronic
902380818 1:16051472-16051494 AGAATCAGCATCCAGAACTGTGG - Exonic
902633641 1:17720519-17720541 AGCTGCAGCAACCAGAACTGAGG + Intergenic
902782651 1:18714722-18714744 AGTCACAGCCTCCAGATCTGCGG + Intronic
902947225 1:19850468-19850490 AGCCGCAGCTTCCTGAACTGTGG - Intergenic
902975681 1:20086518-20086540 AGCTTCAGCTTGGACAACTGAGG + Intronic
903672225 1:25043254-25043276 AGCCACAGCTGCCCAAACTGTGG - Intergenic
903947573 1:26973278-26973300 TGCCTCAGCCTCCCGAGCTGAGG - Intergenic
904780234 1:32941139-32941161 AGCCTCAACTTCCTGGACTCAGG - Intronic
904828116 1:33288803-33288825 AGCCCCAGCTCCCACATCTGCGG - Intronic
905226335 1:36481521-36481543 AGCCTCAGTTTCCCCATCTGTGG + Exonic
905240650 1:36578850-36578872 GGCCTCAGTTTCCTCAACTGTGG + Intergenic
905673326 1:39807722-39807744 AGCCTCGGCTTTCACAACTTTGG - Intergenic
905796222 1:40818115-40818137 GTCCTCAGTCTCCAGAACTGGGG - Intronic
905813706 1:40931636-40931658 AGGCTCCACTTCCAAAACTGGGG + Intergenic
905830009 1:41058038-41058060 AGCCTCAGCTTCCCACACTCAGG - Intronic
905953382 1:41972021-41972043 CTTCCCAGCTTCCAGAACTGTGG + Intronic
906064005 1:42967009-42967031 TGCCTCAGTTTTCACAACTGTGG - Intergenic
906103262 1:43276555-43276577 CGCCTCAGCTTCCAAAAGTGCGG - Intergenic
906167632 1:43698868-43698890 AGCCTCAACTTCCTGGATTGAGG + Intronic
906316393 1:44788820-44788842 GGCCTGAGCTTCCAGATCTGTGG - Intergenic
907644910 1:56232648-56232670 AGCATAAGGCTCCAGAACTGAGG - Intergenic
907903677 1:58764798-58764820 AGGCTCAGCTTCCAGAACCCAGG - Intergenic
908070697 1:60455972-60455994 GCCCACAGCTTCCACAACTGAGG + Intergenic
910448586 1:87324925-87324947 AGCCTCAACTTCCAGGGCTCAGG + Intergenic
910525393 1:88172254-88172276 AGCCTCAGCCTCCAGAGTAGTGG - Intergenic
912600134 1:110922416-110922438 CTTCTCAGCCTCCAGAACTGTGG + Intergenic
912679432 1:111719839-111719861 AGCCTCAGCTCCCTGAGCAGAGG - Intronic
913302547 1:117387736-117387758 CTTCTCAGCCTCCAGAACTGTGG - Intronic
914804989 1:150985081-150985103 AGCCTCAACTTCCCAAGCTGGGG - Intronic
914992632 1:152511867-152511889 AGCAGCAGCCTCCAGAGCTGTGG - Exonic
915006628 1:152644407-152644429 AGCAGCAGCTCCCAGAGCTGTGG + Intergenic
915083875 1:153371204-153371226 CTTCTCAGCCTCCAGAACTGTGG - Intergenic
915245100 1:154551094-154551116 AGTCCCAGCTCCCAGCACTGTGG + Intronic
915483873 1:156206612-156206634 AGCCTCTACTTCCAGGACTCAGG + Intronic
915812144 1:158924476-158924498 AACCCCAGCCTCCAGAACTGGGG + Intergenic
916407124 1:164508691-164508713 AGCCTCAGCTTCCCAAGCTCAGG + Intergenic
916657139 1:166886259-166886281 TGCCTCATCTTCTTGAACTGGGG - Intergenic
916671864 1:167029283-167029305 AGCCTCGGCTTTCACAACTTTGG - Intergenic
916796740 1:168174532-168174554 TGCCACCGTTTCCAGAACTGAGG - Intergenic
917871688 1:179247941-179247963 AGCCTCAACTTCCCGAGCTCAGG - Intergenic
918654986 1:187013884-187013906 TGCCTCAGTGTCAAGAACTGTGG + Intergenic
919746572 1:201012723-201012745 AGCCTCAGCCTCCTGGACTCAGG + Intronic
920062839 1:203239819-203239841 AGTCTCAGCTTCAAAAAATGTGG - Intronic
920431406 1:205921466-205921488 TCCCTCAGCTTCCTGAAATGAGG + Intronic
921110559 1:212032725-212032747 CGCCTCAGCTTCCCAAAGTGCGG + Intronic
922191339 1:223321200-223321222 AGGCTCAGGTACCAGACCTGAGG + Intronic
922375178 1:224956753-224956775 GGCCTGAGCTTCCAGAATTCTGG + Intronic
922966098 1:229692179-229692201 AGACTCAGCTCCCAGGGCTGAGG - Intergenic
923193186 1:231640485-231640507 AAACTCAGCTTCCAAAACTGTGG + Intronic
923498893 1:234548402-234548424 TGCCTCAGCCTCCAGAGCAGTGG + Intergenic
923798162 1:237180189-237180211 AGCCTCGCCTTCCTGACCTGGGG - Intronic
923893589 1:238242957-238242979 AGCCTGAGCTACCTGAAATGTGG + Intergenic
924218273 1:241847869-241847891 AACATCAGCCTCCAGAACTGGGG + Intergenic
924225724 1:241920164-241920186 AACCTCAGCTTCCTGAGCTCAGG + Intergenic
924406695 1:243755180-243755202 TGCCTCAGCCTCCAGAGCAGTGG + Intronic
924607913 1:245551125-245551147 AGCCTCAACTTCCTGAGCTCAGG + Intronic
1062901867 10:1152695-1152717 ATCCTCAGCTCCCTAAACTGAGG - Intergenic
1062935202 10:1380348-1380370 ATCCACAGCTTCCAAAACAGAGG - Intronic
1063448763 10:6137038-6137060 AGCCAAAGCTGCCAGAACTCTGG - Intergenic
1064182671 10:13132596-13132618 AGCCTCAACTTCCTGAGCTCAGG + Intronic
1064277607 10:13921059-13921081 ATCTTGGGCTTCCAGAACTGTGG - Intronic
1065250611 10:23807751-23807773 GGCCTCAGCTGTCAGAAATGAGG + Intronic
1065264055 10:23956904-23956926 AGTCTCCACTTCCAAAACTGGGG + Intronic
1066057474 10:31695487-31695509 ACTTTCAGCTTCCAGAACGGTGG - Intergenic
1066115384 10:32234228-32234250 AGCCTCCGCTTTCACAACTTTGG + Intergenic
1066458249 10:35590474-35590496 AGACTCTGCTTCCAGCCCTGTGG - Intergenic
1066635215 10:37493114-37493136 GGCCCCAGCTTCCAGATCTCAGG - Intergenic
1066680091 10:37929845-37929867 CTTCTCAGCCTCCAGAACTGTGG - Intergenic
1067294298 10:44966000-44966022 AGCCTCATCTTCTAGAGCTCTGG - Intronic
1067457674 10:46432932-46432954 TGCCTCAGCTTCCTGAATAGCGG + Intergenic
1067935733 10:50610888-50610910 AGCCTGAGCCTTCAGAATTGTGG - Intronic
1068792477 10:61042050-61042072 ATGTTCAGCTTCGAGAACTGTGG + Intergenic
1069382854 10:67858310-67858332 TGCCTCAGCTTCCCAAAGTGCGG - Intergenic
1069635246 10:69921086-69921108 ACTTCCAGCTTCCAGAACTGTGG - Intronic
1069657543 10:70101163-70101185 AGCCTGGGCTTCCAGAGCTCGGG - Intronic
1069988553 10:72300057-72300079 TGCCTCAGCCTCCACAAGTGCGG - Intergenic
1070277759 10:75023755-75023777 TGCCTCAGCTTCCCAAAGTGTGG - Intronic
1070783090 10:79148706-79148728 AGCCTCAGCTTGCATATCTCTGG + Intronic
1070834952 10:79442397-79442419 ATCTTCAGCTTCCAGAGCTGAGG + Intronic
1071809918 10:89168229-89168251 ACACTCAGCTACCACAACTGGGG + Intergenic
1072144370 10:92621060-92621082 AGCATCTGATTCCAGGACTGAGG - Intronic
1072292759 10:93979813-93979835 TGCCTCAGCCTCCAGAGCTATGG - Intergenic
1072301879 10:94069722-94069744 GTCCTCTGCTTCCAGAACTGTGG - Intronic
1072434572 10:95403528-95403550 AGCCTGAGCTGCCAGCACGGTGG + Intronic
1073602640 10:104861800-104861822 AGACTCAGCCTCCAGGACGGTGG - Intronic
1073607833 10:104914077-104914099 AGCCTCAGGTTCCTTATCTGAGG - Intronic
1074911223 10:117911153-117911175 AGCATCAGGTTCCACAAGTGAGG + Intergenic
1075139250 10:119816750-119816772 AGGCTCAGCTCCCAGACTTGGGG + Intronic
1075283774 10:121165085-121165107 TGCCTCAGCTTCCCAAAGTGCGG + Intergenic
1075573660 10:123563024-123563046 AGCCTTGCCTTCCAGTACTGGGG - Intergenic
1076131914 10:128019253-128019275 AGCCTCAGTTTCCCCAGCTGGGG + Intronic
1076399352 10:130170248-130170270 AGCCTCACCTTTCAAAACTTTGG - Intronic
1076495735 10:130896450-130896472 CTTCACAGCTTCCAGAACTGTGG + Intergenic
1076905909 10:133360991-133361013 AGCCTTGGCCTCCAGAACTGTGG - Intergenic
1077317587 11:1926234-1926256 AGCCTCAGTTTCCCCACCTGGGG + Intronic
1077414100 11:2416522-2416544 AGCCTCAGCCTCCACAACCATGG + Intronic
1078112529 11:8409288-8409310 AGCCACAGGTTCCAGAATTGTGG - Intronic
1078485679 11:11721258-11721280 TGCCTCAGCCTCCCAAACTGTGG + Intergenic
1078640976 11:13095955-13095977 AGCCTCAACTTCCTGATCTCAGG + Intergenic
1081519109 11:43864049-43864071 AGCCTGAGATTCCTGCACTGGGG - Intergenic
1082696792 11:56376931-56376953 AGCTTCAGAATCCTGAACTGGGG - Intergenic
1082871159 11:57944592-57944614 AGCCTCGGCTTTCACAACTTTGG + Intergenic
1082952161 11:58828993-58829015 AGCCTCAGTTTCCTCATCTGTGG - Intergenic
1083262304 11:61529881-61529903 CGCCTCAGCTTCCCAAAGTGCGG + Intronic
1083780583 11:64915391-64915413 GGCCTCAGTTTCCCGAGCTGTGG - Intronic
1083896005 11:65620119-65620141 AGGCTCAGCTTACAGTACAGGGG + Intronic
1084145980 11:67265682-67265704 AGACTCAACACCCAGAACTGTGG - Intergenic
1084623447 11:70289978-70290000 TGCCTCAGCCTCCCGAAGTGTGG - Intronic
1084997699 11:72998289-72998311 TGCCTCAGCCTCCAAAAGTGCGG - Intronic
1085576537 11:77609778-77609800 GGCGTCAACTTACAGAACTGGGG + Exonic
1085716248 11:78876126-78876148 GGCCTCAGTTTCCACATCTGGGG + Intronic
1085772635 11:79338821-79338843 AGCCTCAGTTTCCTCAACTGTGG + Intronic
1086559758 11:88154325-88154347 AGCCTCCACAACCAGAACTGTGG + Intronic
1087191020 11:95254568-95254590 AGCCTCAGCTTCAAGTGCAGAGG - Intergenic
1088918039 11:114241947-114241969 AGCTTTAGCTTCCAGAGCTCGGG + Intronic
1089052832 11:115560748-115560770 TGCCTCAGCTTCCAGAGCAATGG - Intergenic
1089253868 11:117183387-117183409 CGCCTCAGCCTCCCGAAGTGTGG - Intronic
1090483189 11:127086178-127086200 AGCCTCCACAGCCAGAACTGTGG + Intergenic
1090629921 11:128637104-128637126 AGCCTCCACAGCCAGAACTGTGG + Intergenic
1090686524 11:129128620-129128642 AGCCTCGGCTTTCACAACTTTGG - Intronic
1091649312 12:2298135-2298157 AGCCTCAGTTTCCCCATCTGAGG + Intronic
1091749592 12:3014161-3014183 AGCCTCAGCTTCCACAGCCATGG + Intronic
1091753113 12:3034682-3034704 TGCCTCAGCTTCCCAAAGTGGGG - Intronic
1091853817 12:3722944-3722966 AGCCTCAGTTTCCTTATCTGTGG + Intronic
1091930692 12:4392948-4392970 AGCCTCAGTTTCCTGATCTGTGG + Intergenic
1092185634 12:6476306-6476328 AGCCTCAGCCTCCCAAAGTGCGG + Intergenic
1092212206 12:6653942-6653964 AGCCTCAACTTCCTGAGCTCTGG + Intronic
1092302263 12:7263061-7263083 AGCCTCAACCTCCAGAGCTCAGG - Intergenic
1092507124 12:9114032-9114054 AGGCTCAGATTCCATATCTGTGG - Intronic
1092569191 12:9703474-9703496 AGCCTCAGCTTCCCAAACTCTGG + Intergenic
1094014275 12:25846030-25846052 AGCCTCAACTTCCTGAGCTCAGG + Intergenic
1094722888 12:33083299-33083321 ACCTCCAGCTTCCAGAACTGTGG + Intergenic
1095199974 12:39372483-39372505 AGCACCAGCTTCCTCAACTGTGG + Intronic
1096411470 12:51379774-51379796 AGCCTCATCCTCCAGAACCAAGG + Exonic
1097101988 12:56596426-56596448 AGCCTCAGTTTGAAGAAGTGGGG - Exonic
1097324693 12:58262996-58263018 GGCCTCAGCTTGCACAATTGGGG - Intergenic
1097616091 12:61886275-61886297 AAGCTCAATTTCCAGAACTGGGG - Intronic
1097794511 12:63847078-63847100 TGCCTCAGCCTCCTGAAATGCGG - Intronic
1097905899 12:64919473-64919495 CTCCCCAGCCTCCAGAACTGTGG - Intergenic
1098487782 12:71041492-71041514 AGCCTCTGCCTCCAGCATTGGGG + Intergenic
1098650892 12:72966976-72966998 AGCCTCAACTTCCCGAGCTCAGG + Intergenic
1098797611 12:74911124-74911146 AGCCTCAACTTTCAGGACTCAGG + Intergenic
1099869060 12:88323045-88323067 ACTCTCAATTTCCAGAACTGGGG + Intergenic
1100442149 12:94627154-94627176 AGCTTCAGTTTCCATAAGTGTGG - Intronic
1100980251 12:100157587-100157609 AGCCCCAGCCCCAAGAACTGGGG - Intergenic
1102196170 12:111026639-111026661 TCCATCAGCATCCAGAACTGTGG - Intergenic
1102264688 12:111473190-111473212 AGCCTCAACTTCCCGAGCTAAGG - Intronic
1102547497 12:113667273-113667295 AGCCTCAGCTTCCTCATCTGTGG + Intergenic
1102619003 12:114178783-114178805 AGCCTCAGGTTCCAGGTCCGGGG - Intergenic
1102949673 12:117022571-117022593 AGCCTCAGCTTCCTGGGCTCAGG - Intronic
1103553910 12:121754465-121754487 ACCGCCGGCTTCCAGAACTGTGG - Intronic
1103951017 12:124551080-124551102 AGACACAGCATCCAGAACCGTGG - Intronic
1104571865 12:129933173-129933195 ACTTCCAGCTTCCAGAACTGAGG - Intergenic
1104712996 12:130997951-130997973 AGCCTCAGCCTCCGGAGGTGCGG - Intronic
1105292429 13:19061483-19061505 AGCCTCAGCCCACAGAACAGGGG + Intergenic
1105901183 13:24754639-24754661 AGCCTCAGCCTCCCAAAGTGCGG - Intergenic
1106249221 13:27971325-27971347 AGCCTCGGCTTCCAGAGCTCAGG - Intergenic
1107009958 13:35660591-35660613 AGGGTCAGCGTCCAGAGCTGAGG - Intronic
1107943982 13:45400576-45400598 AGCCTCACCTTCCTGAGCTCAGG + Intronic
1108391802 13:49954299-49954321 TGCCTCGGCTTCCTGAAGTGCGG + Intergenic
1108625567 13:52225170-52225192 AGCCTCAACTTCCTGAGCTCAGG - Intergenic
1108721330 13:53135839-53135861 ATCCTGAGCTTCCGGCACTGAGG + Intergenic
1109180991 13:59213826-59213848 AGCCTCAACTTCCTGAGCTCAGG + Intergenic
1109281550 13:60362414-60362436 AGCCTCAAATTCCTGAGCTGAGG - Intergenic
1109600852 13:64626656-64626678 TGCCTCAGTTTCCACATCTGAGG + Intergenic
1110542638 13:76723245-76723267 AGCCTCAGCCTCCCAAAGTGTGG - Intergenic
1110748848 13:79089468-79089490 AACCTTAGCTTCCAGAACTTAGG - Intergenic
1111406856 13:87818636-87818658 ATCCTCAGGTTCCATATCTGTGG + Intergenic
1111411893 13:87887871-87887893 AGCCTCTGCTTCCAGGGCTCAGG + Intergenic
1111451584 13:88425686-88425708 GGGCTTACCTTCCAGAACTGAGG + Intergenic
1111536986 13:89614693-89614715 AGCCTCTGCTTCCCAAAATGCGG + Intergenic
1112002198 13:95221308-95221330 AGCCTCAACTTCCTGAGCTCAGG + Intronic
1112462994 13:99619372-99619394 TTCCCCAGCCTCCAGAACTGTGG + Intronic
1114660679 14:24341840-24341862 ACCCTCAGCTTCCAGCAAGGGGG + Intergenic
1115049227 14:29036015-29036037 AACTTCTGCCTCCAGAACTGTGG + Intergenic
1115658415 14:35466245-35466267 CTTCTCAGCCTCCAGAACTGTGG - Intergenic
1115817917 14:37182773-37182795 AGCCTCAGCCTCCCAAAGTGCGG + Intergenic
1117374898 14:55111154-55111176 AGGCTCAGATTCCTGAGCTGTGG + Intergenic
1117406383 14:55408202-55408224 AGCCTCAGCCTCCCCAAGTGCGG - Intronic
1118845304 14:69543594-69543616 GGCCTCAGCGCCTAGAACTGGGG + Intergenic
1119722182 14:76898827-76898849 AGCCTCGGCTTTCACAACTTTGG + Intergenic
1120075388 14:80151173-80151195 ATCCTCAGGTTCCATATCTGTGG - Intergenic
1120193902 14:81463098-81463120 AGCCTCCGCTTTCACAACTTTGG + Intergenic
1120497355 14:85253594-85253616 CTTCCCAGCTTCCAGAACTGTGG - Intergenic
1120723243 14:87910067-87910089 GGCCACAGCTTCCTGATCTGTGG + Intronic
1120735162 14:88044570-88044592 AGCTTCATCTCCCACAACTGTGG + Intergenic
1120814157 14:88836423-88836445 AGCCTCAACCTCCAGAATTCAGG - Intronic
1120978313 14:90268895-90268917 CTTCTCAGCCTCCAGAACTGTGG - Exonic
1121055108 14:90845744-90845766 AGCCTCAGCAACAGGAACTGGGG + Intergenic
1121511726 14:94517605-94517627 AGCAAAAGCTTCCAGTACTGGGG - Exonic
1121810667 14:96885958-96885980 TTTCTCAGCCTCCAGAACTGTGG + Intronic
1122134209 14:99623496-99623518 AGCCTCAACTTCCTGGGCTGTGG + Intergenic
1122202376 14:100130453-100130475 GGCCTCACCTGCCAGAACAGAGG + Intronic
1122205375 14:100145576-100145598 GGCCTCAGCCTCCAGGACTTAGG - Exonic
1122537378 14:102475089-102475111 CGCCTGTGCTTCCAGAGCTGTGG + Intronic
1123201139 14:106665616-106665638 TGCCTCAGCTTCCCAAGCTGGGG + Intergenic
1123755549 15:23395097-23395119 AGCCCCAGCCTCCAAAACTAGGG - Intergenic
1124013416 15:25857869-25857891 AGCCTCAGTTTCCTCATCTGTGG + Intronic
1124477696 15:30049269-30049291 ATTCCCAGCCTCCAGAACTGTGG - Intergenic
1124589813 15:31043051-31043073 AGCCACAGCTTCCTAATCTGAGG - Intronic
1125020733 15:34984406-34984428 AGCCTCAGCCTCCCAAAGTGCGG - Intronic
1125315933 15:38431216-38431238 ATCCTCAGGTTCCACATCTGGGG - Intergenic
1125519539 15:40340251-40340273 AGCCACAGCTCCCAGCAGTGGGG + Intronic
1125861393 15:43004415-43004437 AGCCTCGGCTTTCACAACTTTGG - Intronic
1126582061 15:50251102-50251124 AGCCTAAGAAGCCAGAACTGTGG + Intronic
1127039979 15:54964003-54964025 AGCAGCAGCTTCCATACCTGGGG + Intergenic
1127167451 15:56261601-56261623 TGCCTCAGCTTCCCGAATAGCGG - Intronic
1127319773 15:57831707-57831729 ATCCTCAGCTTCTAGACCAGTGG - Intergenic
1127347281 15:58113376-58113398 AGTCTGAGCTTCCAGAACTCGGG - Intronic
1127415458 15:58752901-58752923 AGCCTCAGCCTCCAGGGCTGAGG + Intergenic
1127444423 15:59046273-59046295 AGCCTCAGCCTCCAGGGCTAAGG + Intronic
1127577543 15:60306541-60306563 TGCCTCAGCCTCAAGAAGTGCGG + Intergenic
1127854655 15:62944611-62944633 TGCCTCAGCCTCCTGAAGTGCGG - Intergenic
1128101232 15:65001747-65001769 AGCCTCAGCCTCCCAAAGTGGGG - Exonic
1128114347 15:65095960-65095982 AACCTCAGTTTCCTCAACTGTGG - Intronic
1128195923 15:65756139-65756161 AGCCTCCACTTACAGATCTGGGG - Exonic
1128727651 15:69999738-69999760 CTTCTCAGCTTCCAGAACTAGGG - Intergenic
1128968445 15:72085277-72085299 TGCCTCAGCTTCCCGAAAAGCGG - Intronic
1129111222 15:73338464-73338486 AGCCTCAGTTTCCTCATCTGTGG + Intronic
1129141683 15:73604372-73604394 AGCCTCAACTTCCTGGACTCAGG - Intronic
1129272819 15:74428426-74428448 AGCCTCAGTTTCCCCATCTGTGG + Intronic
1129790910 15:78340187-78340209 TGCCTCAGCCTCCAGAGGTGCGG - Intergenic
1129930418 15:79405956-79405978 AGCCTCAGGCTCTAGGACTGTGG - Intronic
1130048476 15:80464270-80464292 AGCCTCAGCTTCCTCCTCTGGGG + Intronic
1131177562 15:90219681-90219703 GGCCTCTGCTCCCAGGACTGGGG - Intronic
1131468364 15:92673716-92673738 ACTTTTAGCTTCCAGAACTGAGG - Intronic
1131667546 15:94586466-94586488 GGCCTCTGCTTCCATATCTGTGG + Intergenic
1131795067 15:96007942-96007964 AGCCTAGACTTCCTGAACTGAGG + Intergenic
1132313029 15:100870917-100870939 AGCCTCAGGTTGCAGAGGTGAGG - Intergenic
1132581401 16:686313-686335 AGCCTCAGCTTTCCTACCTGGGG - Intronic
1132654918 16:1037734-1037756 AGCCTCTGCCTCCTGACCTGGGG + Intergenic
1132871578 16:2117850-2117872 GACCTCAGCATCCAGAACCGCGG - Exonic
1133813721 16:9180521-9180543 AGCCTCAGCCTCCCAAAATGTGG + Intergenic
1133932847 16:10246352-10246374 AGTTCCAGCCTCCAGAACTGTGG + Intergenic
1134111290 16:11516893-11516915 AGCCTCAGCCTCCAAAGCTCTGG + Intronic
1134460774 16:14427539-14427561 AGCCTCAGTTTCCTCACCTGTGG - Intergenic
1134460827 16:14427929-14427951 AGCCCCAGCCTCCAAAACTAGGG + Intergenic
1134520951 16:14919045-14919067 GACCTCAGCATCCAGAACCGCGG + Intronic
1134550620 16:15136928-15136950 GACCTCAGCATCCAGAACCGCGG - Intronic
1134626967 16:15729192-15729214 AGCCTAAGACCCCAGAACTGGGG + Intronic
1134708627 16:16317696-16317718 GACCTCAGCATCCAGAACCGCGG + Intergenic
1134950977 16:18350949-18350971 GACCTCAGCATCCAGAACCGCGG - Intergenic
1134958916 16:18394430-18394452 GACCTCAGCATCCAGAACCGCGG - Intergenic
1135747567 16:25030175-25030197 AGTCTCACCGTCCAGACCTGTGG + Intergenic
1136139943 16:28282023-28282045 TGCCTCAGCTTCCCCATCTGGGG + Intergenic
1136403248 16:30029756-30029778 AGACTCAGTTTCCACAAATGGGG - Intronic
1136550740 16:30981055-30981077 AGCTTCTTCTTCCGGAACTGGGG - Exonic
1136993724 16:35173498-35173520 GGCCTCAGCTTCCTGCTCTGCGG + Intergenic
1137769560 16:51005012-51005034 TGCCTCAGCTTCCCGAAGTGTGG - Intergenic
1137812339 16:51364793-51364815 AGCCTCAACTTCCTGGACTCAGG - Intergenic
1138317157 16:56080279-56080301 CTCCCCAGCCTCCAGAACTGCGG - Intergenic
1139367635 16:66443350-66443372 AGCCTCAGCTTCCTCATGTGTGG - Intronic
1140179873 16:72704521-72704543 AGCCTCAGCCTCCAGGGCTCAGG - Intergenic
1140213226 16:72987068-72987090 AGCCTCAGCCTCCTGGACTCTGG - Intronic
1140422244 16:74830112-74830134 AGCCTCAACTTCCTGATCTCGGG + Intergenic
1140602735 16:76498140-76498162 TGCCTCAGCCTCCCGAAGTGCGG - Intronic
1140732865 16:77872091-77872113 TGCCTCAGTTTCCCCAACTGTGG - Intronic
1140874310 16:79136727-79136749 AGCCTCAGCTTCCTGACATATGG + Intronic
1141027953 16:80565598-80565620 CGCCTCAGCTTCCCAAAGTGCGG + Intergenic
1141214394 16:82010249-82010271 ATCATCAGCTTTCAGAAATGAGG + Intronic
1141595640 16:85095284-85095306 AGCCTCAGCTTCTTCATCTGTGG + Intergenic
1141766963 16:86065014-86065036 AGCCTCAGTTTCCTCATCTGTGG + Intergenic
1142221156 16:88855953-88855975 AACCTCAGCTGCCACACCTGGGG - Intronic
1142766882 17:2069512-2069534 AGCCTCCGCCTCCAGAGCTCAGG - Intronic
1142769192 17:2084433-2084455 GGGCTCAGCTTCCAGGACAGAGG - Intronic
1143021647 17:3919743-3919765 TGCCTCAGCCTCCCGAAGTGCGG - Intergenic
1143408119 17:6691419-6691441 CTCCTGAGCTTCCAAAACTGTGG - Intronic
1145006006 17:19338195-19338217 TGCGGCAGCTTCCAGCACTGTGG - Intronic
1145086892 17:19950346-19950368 AGCCTCGGCTTTCACAACTTTGG - Intronic
1145269832 17:21398946-21398968 TGCCTCAGTTTCCACATCTGTGG - Intronic
1146030842 17:29364820-29364842 AGCCTCAGCCTCCAGGGCTCAGG + Intergenic
1146088808 17:29855421-29855443 AGCCTCAACTTCCTGAGCTCAGG - Intronic
1146418641 17:32661571-32661593 AGCCTCAACTTCCTGAACTCAGG - Intronic
1146511655 17:33454709-33454731 ATTCTCAGCCTCCAGAACTGTGG - Intronic
1146971463 17:37076043-37076065 AGCCTCAGCCTCCAGGGCTTGGG + Intergenic
1147199696 17:38792228-38792250 AGCCTCAACTTCCTGAGCTCAGG + Intronic
1147893482 17:43734158-43734180 ACCTTCTGCTTCCAGAAGTGAGG - Intergenic
1148136203 17:45293466-45293488 AGCCTCAGCTTCCACTTCTCTGG - Intronic
1148169277 17:45505610-45505632 TACCTCAGCCTCCAGAGCTGGGG - Intergenic
1148453997 17:47801138-47801160 AGCCTGAGCCTCCTTAACTGGGG + Intergenic
1149149371 17:53541610-53541632 AGTCCTAGCCTCCAGAACTGTGG + Intergenic
1149455037 17:56780827-56780849 GGCCTCAGTTTCCAAATCTGGGG - Intergenic
1149505931 17:57193933-57193955 AGAATCAGCTTCCTGAATTGGGG + Intergenic
1150105826 17:62461830-62461852 CGCCTCAGCCTCCGGAAGTGCGG + Intronic
1150400470 17:64852073-64852095 TACCTCAGCCTCCAGAGCTGGGG - Intergenic
1151320133 17:73347998-73348020 AGCCTCAGTTTCCCCATCTGTGG - Intronic
1151413158 17:73944331-73944353 AGCCTCAGTTTCCCCACCTGGGG - Intergenic
1151773471 17:76180671-76180693 CGCCTCAGCTTCCCAAAGTGCGG + Intronic
1152025305 17:77805042-77805064 AGCCTCACCTGGCTGAACTGGGG + Intergenic
1153783868 18:8517136-8517158 CGCCTCAGCTTCCCAAAATGTGG - Intergenic
1154301213 18:13194320-13194342 AGGCTCAGGTCCCAGAACTCAGG + Intergenic
1154928233 18:20961885-20961907 AGCCTCAGCTTCCTAAGCAGTGG + Intronic
1155128536 18:22904844-22904866 AGCCTCAGCTTTCCGAAGTGTGG + Intronic
1155332311 18:24730748-24730770 ACCCTCAGCCTCCAGCACTCTGG - Intergenic
1155666709 18:28317844-28317866 TGTCCCAGCCTCCAGAACTGTGG + Intergenic
1156278015 18:35603390-35603412 AGCCTCAGATTCAAGTTCTGGGG + Intronic
1156859447 18:41818855-41818877 AGCTTCTGCCTCCAGAAATGTGG + Intergenic
1157083262 18:44551547-44551569 TGCCTCAGCCTCCTGAGCTGGGG + Intergenic
1157499029 18:48177249-48177271 GGCCTCAGCTTCTAGAACTCAGG + Intronic
1157539785 18:48492343-48492365 AGCTGCATCTTCCAGTACTGGGG - Intergenic
1157767504 18:50311392-50311414 ATCCTCAGCTTTCAGAACCCTGG - Intergenic
1157793726 18:50556918-50556940 ATTCCCAGCCTCCAGAACTGAGG + Intergenic
1158352176 18:56573982-56574004 AACCTGAGCTTCCAGACCTTTGG + Intergenic
1159719574 18:71871390-71871412 AGCCTCAACCTCCAAAAGTGCGG - Intergenic
1159779012 18:72639712-72639734 AGTCTCACCTGCCTGAACTGAGG - Intergenic
1160965361 19:1744908-1744930 AGCCTCAGTTTCCCCATCTGTGG - Intergenic
1161106101 19:2444837-2444859 AGCTCCAGCTCCCAGAACAGCGG + Intronic
1161141912 19:2653288-2653310 ACCCTCAGCTCCCAAACCTGGGG + Intronic
1161479092 19:4501797-4501819 AGCCTCAGGTGCCACAACGGGGG + Intronic
1161497043 19:4592291-4592313 TGCCTCAGCTTCCTGAGCAGCGG - Intergenic
1161581019 19:5081205-5081227 AGCCTCAGTTTCCACGTCTGTGG + Intronic
1161970773 19:7578736-7578758 AGCCTCAGCCTCCCAAAGTGCGG + Intergenic
1161992836 19:7694725-7694747 AGCCCCAGCTGCCCTAACTGGGG - Intronic
1162046044 19:8001078-8001100 AGCTTCAGCTTCCTCCACTGGGG + Intronic
1162393959 19:10405315-10405337 AGCCTCAGCTTCCAGAACTGGGG + Intronic
1162852364 19:13440649-13440671 GGCCTCAGCTTCCTCATCTGTGG - Intronic
1162897726 19:13775359-13775381 AGCCTCAGCCTCCTGGACTTAGG + Intronic
1163120888 19:15217109-15217131 TGCCTCAGCCTCCTGAAGTGCGG + Intergenic
1163269447 19:16242226-16242248 AGCCTCAGCTTCCTGAACTCAGG - Intronic
1163397692 19:17073754-17073776 AGCCTCAGCCTCCCAAAGTGAGG - Intronic
1163635313 19:18434642-18434664 AGCCCCACCTTTGAGAACTGGGG + Exonic
1164012298 19:21213399-21213421 AGCCTCGGCTTTCACAACTTTGG + Intergenic
1164168695 19:22703814-22703836 AGCCTCGGCTTTCACAACTTTGG + Intergenic
1164389571 19:27806052-27806074 AGCCTCAGCTCCCTGCTCTGCGG - Intergenic
1164671354 19:30073867-30073889 ATCACCAGCTGCCAGAACTGGGG + Intergenic
1165206647 19:34194089-34194111 AGCCTCAGCTTCCCGGGCTCAGG - Intronic
1167000626 19:46744321-46744343 AGCCTCAGCCACCACAAGTGAGG + Intronic
1167142075 19:47658656-47658678 AGCAGCAGCTTCTAGAACAGTGG + Intronic
1167298965 19:48668259-48668281 AGCCTCACCTTCCTCAGCTGGGG + Intronic
1167476681 19:49705437-49705459 AGCCTCAGCTTCCACTAAAGTGG + Intronic
1167797661 19:51720192-51720214 AGCCTCAGCTTCCCGAGCTCAGG + Intronic
1202677640 1_KI270711v1_random:22199-22221 TGCCTCAGCCTCCTGAACAGGGG + Intergenic
924999844 2:396149-396171 GACCTCAGCCTCCAGACCTGTGG + Intergenic
925524508 2:4785157-4785179 AGAGTCAGTTTCCACAACTGTGG + Intergenic
927518818 2:23687298-23687320 AGTCTGAGCCTCCAGACCTGGGG - Intronic
927753925 2:25693643-25693665 AGCCTCAGCTTCCCAAGCTCAGG - Intergenic
927941712 2:27107684-27107706 AGCCTCAGCCTCCTAAAGTGCGG - Intronic
928149701 2:28815031-28815053 CGCCTCAGCTTCCCAAAGTGTGG - Intronic
928200140 2:29242684-29242706 AGCCTCAACGTCCACTACTGAGG + Intronic
928336942 2:30406321-30406343 AGACTCAGATTCCAAAAATGGGG - Intergenic
928478095 2:31652038-31652060 AGCCTCCGCCTCCAGGACGGAGG + Intergenic
928801194 2:35094873-35094895 CTTCTCAGCCTCCAGAACTGTGG - Intergenic
929705393 2:44206808-44206830 TGCCTCAGCCTCCCAAACTGCGG + Intronic
929770216 2:44885572-44885594 ATCCCCAGCTTCCAGTCCTGGGG + Intergenic
929774805 2:44922562-44922584 AGTCTCTGCTTGCAGAAGTGTGG + Intergenic
929960341 2:46491508-46491530 ACTTTCAACTTCCAGAACTGTGG - Intronic
930011688 2:46942217-46942239 AGCCTCAGTTTCCTCATCTGTGG + Intronic
930071459 2:47369567-47369589 CGCCTCACCTTCCTGAGCTGCGG - Exonic
931265326 2:60655227-60655249 TGCCTCAGTTTCCCTAACTGGGG - Intergenic
931337443 2:61361338-61361360 AGCCTCGACTTCCTGCACTGAGG - Intronic
931379457 2:61738845-61738867 AGCCTCAGCTTCCTGGGCTGAGG - Intergenic
931808316 2:65829566-65829588 AGGCTCACCTTCCACAACAGGGG + Intergenic
932202182 2:69839949-69839971 AGCCTCAGCTTCCTCAACTAAGG - Intronic
932233157 2:70099212-70099234 AGCCTCAACTTCCCGAGCTCAGG + Intergenic
932410885 2:71547056-71547078 AGCCCCAGCTTCCTGGGCTGAGG + Intronic
932585265 2:73023670-73023692 AGCCTCAGTTTCCTCATCTGTGG + Intronic
932728180 2:74198070-74198092 AGCCTCAACCTCCTGAACTCAGG + Intergenic
932932995 2:76064435-76064457 TGCCTCAGCTTCCTGAATAGAGG + Intergenic
936277198 2:111109925-111109947 CGCCTCAGCTTCCCAAAGTGTGG + Intronic
936490159 2:112963205-112963227 AGCCTCAGCTTCCATCCCTGAGG + Intergenic
936594570 2:113835667-113835689 AGCCTCAACTTCCTGCACTTGGG + Intergenic
936609632 2:113989199-113989221 CTTCTCAGCTTCCAGAACTGTGG + Intergenic
936895631 2:117424309-117424331 AGCCTCGACTTCCAGAGCTCAGG - Intergenic
936930634 2:117784968-117784990 ACTTTCAGCCTCCAGAACTGTGG + Intergenic
937319100 2:120950162-120950184 AGCCTCAGTTTCCTCATCTGTGG - Intronic
937361749 2:121234542-121234564 AGCCTCAGTTTGCTCAACTGTGG - Intronic
937420568 2:121751442-121751464 TGCCTCAGCTTCCAGAGTAGTGG - Intronic
937666128 2:124489260-124489282 ACTTCCAGCTTCCAGAACTGTGG - Intronic
937794840 2:126004804-126004826 AGCCTCAGCTACGTGGACTGAGG + Intergenic
938564329 2:132504424-132504446 ATCCAGAGCTTCTAGAACTGGGG - Intronic
938737006 2:134194896-134194918 ATTATCAGCTTCCAGAAGTGAGG - Intronic
938971175 2:136434302-136434324 AGGTTCACCTTCCACAACTGGGG + Intergenic
939318428 2:140582721-140582743 CTTCTCAGCCTCCAGAACTGTGG + Intronic
939937070 2:148305691-148305713 AGCCTCAGCTTGCAGAGCTTTGG + Intronic
941786285 2:169502310-169502332 AGCCTCAGTCTCCTTAACTGTGG - Intronic
941999878 2:171635333-171635355 TGCCTCAGCTTCCCAAACTGCGG - Intergenic
942091346 2:172494424-172494446 AGCCTCGACTTCCTGAGCTGAGG - Intronic
942594302 2:177577946-177577968 CTTCCCAGCTTCCAGAACTGTGG + Intergenic
942665856 2:178316533-178316555 AGCCACAGTTTCCAGATCCGTGG + Intronic
944048527 2:195440240-195440262 ACCCTCAGCTGCCACCACTGTGG + Intergenic
944213089 2:197226738-197226760 GGCCTCAGCTTCCTTACCTGTGG - Intronic
944693237 2:202177446-202177468 CTTCTCAGCCTCCAGAACTGTGG - Intronic
944772539 2:202928976-202928998 AGCCTCAGCCTCCCAAAATGTGG + Intronic
945223463 2:207507903-207507925 AGCCTCAGCCTCCTGAGCTCAGG + Intergenic
945253388 2:207783474-207783496 AGCCTCAGCCTCCTGAGCTCAGG - Intergenic
945735565 2:213594688-213594710 AGTCCCTGCTTCAAGAACTGAGG - Intronic
946132243 2:217615675-217615697 AGCCTGTGCTTCCAGAACTGGGG - Intronic
946946381 2:224826879-224826901 AGCCTCAACTTCCCCAACTTAGG - Intronic
947317703 2:228879505-228879527 ACTTTTAGCTTCCAGAACTGTGG - Intronic
947413452 2:229868281-229868303 AGCCTCAACTTCCTGAGCTCAGG + Intronic
947601277 2:231452050-231452072 AGCCTCAGATTCCAGACCAGTGG - Intergenic
948624561 2:239261127-239261149 AGCCTCAGCCTCCTGAGATGGGG + Intronic
948950936 2:241251084-241251106 TGCCTCAGCCTCCAGAGCAGCGG + Intronic
949074018 2:242043917-242043939 AGCCTCTGCTAGCAGAACTGGGG + Intergenic
1168782880 20:509655-509677 AGCCTCAACTTCCTGGACTCCGG + Intronic
1170577999 20:17679201-17679223 AGAATCAGATTCCACAACTGTGG - Intronic
1170973793 20:21141525-21141547 AGCCCCAGATTCCAGAAGTTAGG + Intronic
1172099611 20:32477268-32477290 AGCCTCAGTTTCCTCATCTGTGG - Intronic
1172113613 20:32561445-32561467 AGCATCAGCTTCCAGAGCCGAGG + Intronic
1172309276 20:33905074-33905096 AGCCTCAACTTCCTGAGCTCAGG + Intergenic
1172836117 20:37874247-37874269 AGCCTCAGCTTGCATAAATCGGG - Intergenic
1172947548 20:38700956-38700978 ATCCCCACCTTCCAGCACTGGGG - Intergenic
1173374151 20:42468457-42468479 AGCCTCAGAATACAGAACTGAGG + Intronic
1173647060 20:44639942-44639964 AGGCTGAGCCTACAGAACTGTGG + Intronic
1173745089 20:45430096-45430118 AGCCTCAACTTCCCGAGCTCAGG - Intergenic
1174144534 20:48442179-48442201 CTTCTCAGCCTCCAGAACTGTGG - Intergenic
1174456826 20:50654825-50654847 AGCCTCAACTTCCCAAACTCAGG + Intronic
1175458175 20:59130810-59130832 AGCCTCTGCTTTCAGGACTCAGG + Intergenic
1175690145 20:61059217-61059239 AGCCTCAGTTCCCAACACTGTGG - Intergenic
1175749681 20:61486639-61486661 CACCTCAGCTTCCAAAACTCTGG - Intronic
1175929025 20:62484906-62484928 AGCCTCAGTTTCCCAATCTGTGG + Intergenic
1176088512 20:63308800-63308822 AGCCCCAGCTTCCACATCTGCGG + Intronic
1176201785 20:63864254-63864276 AACCTCAGCTTCCTCATCTGTGG + Intergenic
1178198103 21:30371805-30371827 AGCCACAGCTTCCATAACCCAGG + Exonic
1178494949 21:33078593-33078615 AGCCTCAGCTTCCTGGACTCAGG - Intergenic
1178623433 21:34196190-34196212 TGCCTCAGCCTCCAGAGCAGCGG - Intergenic
1178905783 21:36634830-36634852 AGCCTCAGCTTGCAAAACTGTGG - Intergenic
1179047817 21:37861930-37861952 ACCCTGAGCTTCCAGTAGTGGGG + Intronic
1179878219 21:44282164-44282186 GGCCTCAGTTTCCATATCTGTGG + Intergenic
1179998920 21:44986414-44986436 AGCCTCAGCCACCAGGTCTGAGG - Intergenic
1180684253 22:17652685-17652707 CGCCTCAGCCTCCAAAAGTGTGG + Intronic
1181311020 22:21944909-21944931 TGCCTCAGCTTCCTCACCTGTGG + Intronic
1182117593 22:27766069-27766091 AGCTTCAGCTCCCAGAGTTGGGG - Intronic
1182242295 22:28925763-28925785 AGCCTCAACTTCCTGAACTCAGG + Intronic
1183103430 22:35598137-35598159 AGCCTCAGATGCAAGAACTGGGG + Intergenic
1183112481 22:35660624-35660646 CTTCTCAGCCTCCAGAACTGTGG - Exonic
1183117577 22:35703619-35703641 ACCATCCCCTTCCAGAACTGAGG + Intergenic
1183352651 22:37342761-37342783 AGGCTCAGCTTCAAGAGCTGGGG + Intergenic
1183537343 22:38410656-38410678 AGCCTCGGCTTTCACAACTTTGG + Intergenic
1183809340 22:40240902-40240924 AGCCTCAGCTTCCTGGGCTCAGG + Intronic
1183867709 22:40717107-40717129 TGCCTCAGCCTCCAAAAGTGCGG + Intergenic
1183934872 22:41256356-41256378 AGCCTCAGTTTCCCCAAGTGAGG + Intronic
1184636435 22:45835674-45835696 AGCCTCAGCTTTCAGTGCAGGGG + Intronic
949667553 3:6357874-6357896 AGCCTCAGCCTCCCAAAGTGTGG - Intergenic
950283095 3:11723497-11723519 AGCCTCAACTTCCTGGACTCAGG - Intergenic
950954284 3:17034879-17034901 ATCCGCAGCTTCCAATACTGTGG + Intronic
950963750 3:17131705-17131727 AGCCACAGTTTACAGAACTGAGG + Intergenic
951976711 3:28518494-28518516 AGCTTCTGCTTCCAGAGCAGTGG - Intronic
952892475 3:38052826-38052848 AGCCTCGGCTTTCACAACTTTGG - Intronic
952928522 3:38341034-38341056 ATTCCCAGCCTCCAGAACTGTGG + Intergenic
953669599 3:44951564-44951586 AGCCTCATCTTCCAAGACAGTGG - Intronic
954026480 3:47787085-47787107 AGCCTCAACTTCCAGGGCTCAGG - Intergenic
954186904 3:48924241-48924263 AGCCTCAGCCTCCCAAAGTGTGG + Intronic
954326848 3:49868670-49868692 AGCCTCAGTTTCCTCAACTGGGG - Intronic
954677512 3:52323972-52323994 GGCCCCAGCTTCCTTAACTGTGG + Intronic
954795133 3:53157485-53157507 TGCCTCAGCTTCCTCATCTGTGG - Intronic
954975724 3:54692414-54692436 AGGCACAGCATCCAGAAATGTGG - Intronic
955166768 3:56522458-56522480 AACCTCAGCATCAAGCACTGTGG - Intergenic
956187193 3:66573991-66574013 AGCCTCAGTTTCCTCATCTGGGG - Intergenic
956197152 3:66664406-66664428 TGCCTCAGCCTCCCAAACTGTGG + Intergenic
956326027 3:68054174-68054196 GGCCTCATCTTCCAACACTGGGG - Intronic
956827774 3:73014950-73014972 TGCCTCAACTTCCCAAACTGCGG + Intronic
956882741 3:73527735-73527757 AGACTCATTTTCCAGAACTCTGG + Intronic
957149054 3:76461334-76461356 AGGCTCTGCCTCCAGCACTGGGG + Intronic
959402916 3:105924246-105924268 CGCCTCGGCTTCCAAAAGTGCGG - Intergenic
959420655 3:106124287-106124309 CTTCCCAGCTTCCAGAACTGTGG + Intergenic
960048508 3:113219452-113219474 AGCTTCAGCTTCCTTATCTGTGG - Intronic
960568121 3:119156700-119156722 AGTGTCAGCTTCCAGCACAGTGG - Intronic
960935921 3:122902500-122902522 AGCCTCAGCCTCCAGGGCTCAGG - Intergenic
961157108 3:124689294-124689316 AGCCTCAACTTCCTGGACTCAGG + Intronic
961209892 3:125117512-125117534 AGCCTCAACTTCCAGGGCTCAGG - Intronic
961333861 3:126158623-126158645 CTTCTCAGCTTCCAGACCTGTGG + Exonic
961651797 3:128420649-128420671 AGACTCTGCTTCGGGAACTGGGG - Intergenic
961934799 3:130571754-130571776 AGCCTCAACTTCCAGGACTCAGG + Intronic
962285938 3:134085575-134085597 AGCCTCTGCTTCTTGGACTGAGG - Intronic
962315959 3:134359673-134359695 AGCATCAAATTCCAGAGCTGTGG - Intronic
962923999 3:139975206-139975228 AGGCACAGCCTCAAGAACTGGGG + Intronic
964366068 3:155951963-155951985 AGGCTCAGCTTCCATAATTAGGG + Intergenic
965376777 3:167934554-167934576 TGCCTGAGTTTCCAGAACTTTGG - Intergenic
965616354 3:170596714-170596736 AACCCCACCTTCCAGAACTTTGG - Intronic
966128686 3:176609930-176609952 AGTTTCATGTTCCAGAACTGTGG - Intergenic
966428330 3:179805003-179805025 TGCCTCAGCCTCCAGAATAGCGG - Intronic
967036170 3:185649679-185649701 AGCCTCCGCTCACAGACCTGGGG + Intronic
967053768 3:185809546-185809568 AGCCTCATCTTCCAGTGCTCAGG - Intronic
967323016 3:188212679-188212701 CGCCTCAGCTTCCAGAACAAGGG - Intronic
968129158 3:196182480-196182502 AGCCTCAACTTCCAGAGCTCAGG + Intergenic
968328360 3:197841778-197841800 AGCTTTAGTTTCCAGCACTGTGG - Intronic
969254826 4:5994582-5994604 AGCCTCAGTTTCCTCACCTGTGG - Intergenic
969705303 4:8788447-8788469 AGCCTCAGTTTCCTCATCTGTGG - Intergenic
969803151 4:9585698-9585720 CGCCTCAGCTTCCCAAAGTGCGG + Intergenic
969849372 4:9944189-9944211 AGCCTCAGCTCCCACATCTCCGG - Intronic
969883964 4:10198678-10198700 AGGCTCTGCCTCCAGAACTGAGG + Intergenic
970371247 4:15408908-15408930 ATTCCCAGCCTCCAGAACTGTGG + Intronic
971208759 4:24595734-24595756 ATCCTCAGCTTCCTGGATTGTGG - Intergenic
971542987 4:27845051-27845073 GGCCTCAGCCTCCCAAACTGTGG + Intergenic
971566264 4:28145330-28145352 AGGCCCCACTTCCAGAACTGGGG + Intergenic
971933419 4:33116580-33116602 AGCCTCAGCTTCCTGGGCTCAGG - Intergenic
972293620 4:37715332-37715354 ACCCTCAGGTTCTAGAGCTGGGG - Intergenic
972586712 4:40444115-40444137 AGCCTCAACTTCCTGAGCTCAGG - Intronic
972743683 4:41912581-41912603 AGGCCCAACTTCCAGCACTGGGG - Intergenic
973263213 4:48185894-48185916 AGCCTCGGCTTTCACAACTTTGG - Intronic
973551576 4:52040562-52040584 CTTCTCAGCCTCCAGAACTGTGG - Intergenic
975013861 4:69386372-69386394 ACCTTCAGCCTCAAGAACTGTGG + Intronic
975127962 4:70803533-70803555 AGCCTCAACTTCCCGAGCTTAGG + Intronic
975710187 4:77153766-77153788 AGCCTCAGCTTTCTAAACTGAGG - Intergenic
976589123 4:86831580-86831602 AGCCTCAGGGTACAGAACTATGG + Intronic
977268932 4:94890623-94890645 ACGTTCAGCTTCCAGAACTGTGG - Intronic
978142576 4:105334426-105334448 AGCCTCGGCTTCCTGAACTCAGG - Intergenic
979608140 4:122661041-122661063 AGCCTCAGCCTCCTCATCTGTGG - Intergenic
981364941 4:143891574-143891596 CGCCTCAGCTTCCCAAAGTGAGG + Intronic
982206938 4:153003971-153003993 ACCTCCACCTTCCAGAACTGAGG + Intergenic
982486608 4:155974154-155974176 AGCCTCACCTCCCAGGATTGGGG + Intergenic
983267497 4:165522785-165522807 CTCCCCAGCCTCCAGAACTGTGG + Intergenic
983309316 4:166037557-166037579 AGCCTCAGCCTCCCAAACTCTGG - Intronic
983628616 4:169827840-169827862 AGCCTCGGCTTTCACAACTTTGG - Intergenic
983702500 4:170615050-170615072 CACCCCAGCTTCCATAACTGTGG - Intergenic
984191726 4:176613766-176613788 ATGTCCAGCTTCCAGAACTGTGG + Intergenic
984889604 4:184479347-184479369 AGCATCTGCTTGCAGACCTGGGG - Intergenic
985892628 5:2727551-2727573 AGCCTCAGAGTCCAGAGTTGGGG + Intergenic
985965675 5:3337476-3337498 CGCCTCAGCTTCCCAAAGTGCGG - Intergenic
987139912 5:14934561-14934583 TGCCTCAGCCTCCCAAACTGTGG - Intergenic
987466499 5:18278043-18278065 AGCCATAGCTTCCAGGAATGAGG + Intergenic
987889793 5:23862573-23862595 AGCCTCAGCCTCCTGAGCTCAGG - Intergenic
988505410 5:31818049-31818071 AGCCTCAACTTCCCGGACTCAGG + Intronic
988566347 5:32322548-32322570 AGTTTCAGCTTCCAGAACAATGG + Intergenic
988671289 5:33384793-33384815 AGGCTCCACTTCCAGCACTGGGG + Intergenic
988992337 5:36683870-36683892 AGCCACAGCTGCCAGTATTGGGG + Exonic
989081483 5:37627168-37627190 AGCCTCAGCTTCCTGAGCTCAGG + Intronic
989148131 5:38269095-38269117 AGCCTCAACTTCCTGAGCTCAGG - Intronic
989222585 5:38985398-38985420 ATCCACAGCTTCCACATCTGTGG - Intronic
990372668 5:55136443-55136465 TGCCTCAGCTTCCTGAATAGTGG - Intronic
991193167 5:63899997-63900019 CGCCTCAGCCTCCCAAACTGCGG - Intergenic
992402158 5:76421363-76421385 TGCCTCAGCTTCCCAAAGTGCGG - Intronic
992569580 5:78041475-78041497 AGCCTCAACTTCCTGAGCTCAGG - Intronic
992832982 5:80613472-80613494 TGCCTCAGCCTCCTGAGCTGAGG + Intergenic
992858607 5:80889780-80889802 TGCCTCAGCCTCCCGAAATGCGG + Intergenic
993350129 5:86839509-86839531 TGCCTCAGTTTCCTCAACTGAGG - Intergenic
993645489 5:90455910-90455932 AGCCTCAACCTCCAGGACTCAGG - Intergenic
994216528 5:97143999-97144021 AGCCTTGGCTTCCAGAAGAGTGG + Intronic
994688210 5:102983194-102983216 CGCCTCAGCCTCCCAAACTGTGG - Intronic
994695380 5:103067294-103067316 AGCCTCAGCCTCCTGGACTCAGG + Intergenic
995886877 5:116905073-116905095 CGCCTCAGCCTCCCAAACTGCGG - Intergenic
995911482 5:117193064-117193086 AGGCCCAGCCTCCAGCACTGGGG - Intergenic
996014782 5:118520981-118521003 ATCATCAGCTTCCAGAGGTGAGG + Intergenic
996862866 5:128084456-128084478 AACGTGAGCTTCCAGAACGGCGG + Exonic
996989116 5:129606561-129606583 AGATTCAGCTTCCTGAATTGTGG + Intronic
997529806 5:134575014-134575036 ACCCTCTGCTTCCTCAACTGTGG - Intronic
998320227 5:141223442-141223464 AGCTTCAGCTTCCAAAATTACGG + Exonic
998378972 5:141710499-141710521 AGCCTCAGTTTCCTCATCTGTGG + Intergenic
998438547 5:142136074-142136096 AGCCTCATCTTCCAGGTCTACGG + Intronic
998663180 5:144263793-144263815 CTTCCCAGCTTCCAGAACTGTGG - Intronic
998787323 5:145727046-145727068 AGTCTGGGCTTCCAGAACTCTGG - Intronic
999172695 5:149608734-149608756 TGCCTCAGGTTACACAACTGGGG + Intronic
999865233 5:155694006-155694028 CTTCCCAGCTTCCAGAACTGTGG + Intergenic
1000630406 5:163584544-163584566 AGCCTCGGCTTTCACAACTTTGG + Intergenic
1001079285 5:168655144-168655166 GGCCTCAGCTTCCTCAAATGAGG + Intergenic
1001401767 5:171450471-171450493 AGCCTCGGCTTCCTCATCTGTGG - Intronic
1001460499 5:171908757-171908779 AGCCTCAGGTTTCAGGCCTGAGG + Intronic
1001594758 5:172891052-172891074 AGCCTCAGTTTCCTGATCTGGGG + Intronic
1001679809 5:173547830-173547852 AACCTCAGCATTCAGGACTGTGG + Intergenic
1001996491 5:176164544-176164566 ATCCTCAGCTGCCAGAGGTGAGG + Intergenic
1002019592 5:176354493-176354515 AGCCTCTGCTTCCCGACCTCAGG - Intronic
1002304417 5:178274775-178274797 AGCCTCAGCTTCCTCATCTATGG + Intronic
1002626323 5:180531943-180531965 AGCCTCGGCTTTCACAACTTTGG + Intronic
1002710643 5:181192612-181192634 ACCCTCAGCATCCAGAATGGGGG - Intergenic
1002799298 6:505776-505798 AGCCTCAGCTCCCATCACAGAGG + Intronic
1003033353 6:2621805-2621827 AGCCTCAGCTTCCTGGAGTCAGG + Intergenic
1003213260 6:4087030-4087052 AGCTTCATCGTCCAAAACTGAGG - Intronic
1003378176 6:5598267-5598289 AGCCTCAGCCTCCAGAGTAGCGG - Intronic
1003831379 6:10015807-10015829 AGCTTCAGCTTCCTCAACTGAGG + Intronic
1004369145 6:15037214-15037236 AGGCTCACCTCCCTGAACTGGGG - Intergenic
1004450690 6:15742739-15742761 AGCTTCAGCTTTCAGGACTTTGG - Intergenic
1004471194 6:15930965-15930987 ACTTCCAGCTTCCAGAACTGTGG - Intergenic
1004605660 6:17192874-17192896 CTCCCCAGCCTCCAGAACTGTGG - Intergenic
1004895662 6:20145322-20145344 ATCTCCAGCCTCCAGAACTGAGG + Intronic
1005259769 6:24046135-24046157 AACCCCAGCTTCCATATCTGAGG - Intergenic
1005318521 6:24628644-24628666 ACTTCCAGCTTCCAGAACTGTGG - Intronic
1006858169 6:37150793-37150815 AGCCTCAGCTTCCCCAGCTCAGG + Intergenic
1007157831 6:39763072-39763094 AGCCTCAGCCTCCCAAAGTGTGG - Intergenic
1007763111 6:44145685-44145707 TGCCTCAGCTTCCCAAAGTGTGG - Intronic
1007772566 6:44202998-44203020 AGCCTCAGTTTCCATAGCTGTGG - Intergenic
1007976188 6:46103830-46103852 AGCTGCAGCTTCCAGAAGAGTGG - Intergenic
1008069380 6:47084267-47084289 CTTCTCAGTTTCCAGAACTGTGG - Intergenic
1009200886 6:60744072-60744094 AGCCTCGGCTTCCCAAAGTGCGG + Intergenic
1009324464 6:62332723-62332745 CTTCTCAGCCTCCAGAACTGAGG + Intergenic
1010246642 6:73665840-73665862 AGTCCCATCTTCCACAACTGTGG + Intergenic
1010393373 6:75361709-75361731 AGCCTCAGTTTCCTCATCTGTGG - Intronic
1012948806 6:105495838-105495860 AGGCTCAGGTACCAGAACTGAGG - Intergenic
1013255505 6:108380563-108380585 GGCCTCCACATCCAGAACTGTGG - Intronic
1013573481 6:111454189-111454211 TGCCTTAGCTTCCTGAAGTGAGG + Intronic
1014541350 6:122679860-122679882 AGCCTCAGCTTCCACTTCTTTGG - Intronic
1015210093 6:130687142-130687164 CTTCTCAGCCTCCAGAACTGTGG - Intergenic
1015587955 6:134795342-134795364 TGCCTCAGCTTCCCAAAGTGTGG - Intergenic
1015608732 6:134990630-134990652 AGCCTCAACTTCCTGAGCTCAGG + Intronic
1015759987 6:136648438-136648460 AGCAGCATCTTTCAGAACTGTGG - Intronic
1016456507 6:144236345-144236367 AGCCTCAACTTCCAGGGCTCCGG + Intergenic
1016669311 6:146683165-146683187 CTTCCCAGCTTCCAGAACTGTGG + Intronic
1016702121 6:147065695-147065717 AACTCCAGCATCCAGAACTGTGG - Intergenic
1016966249 6:149720944-149720966 AGCCTCAGCCTCCTGAGCTCAGG - Intergenic
1017306380 6:152922930-152922952 AGCCAAAGCTGCCAGACCTGGGG + Intergenic
1017811877 6:157989677-157989699 AGCCTCTGCTCCCAGTGCTGGGG - Intronic
1017878484 6:158543399-158543421 AGCCCCAGCTTCCATATCTGGGG - Intronic
1018042629 6:159938368-159938390 AGCCTCAACTTCCTGAGCTCAGG - Intergenic
1018405309 6:163475242-163475264 ATCCTCAGGTTCCACATCTGTGG + Intronic
1018539380 6:164862060-164862082 AGCATCAACTCTCAGAACTGTGG + Intergenic
1018924063 6:168194457-168194479 ACCCCCAGCCTCCAGAAATGTGG - Intergenic
1019208862 6:170388079-170388101 AACCTCAGCTGACAGAAATGAGG - Intronic
1019378371 7:708290-708312 ACTTTCAGCCTCCAGAACTGTGG + Intronic
1019549021 7:1593099-1593121 AGCCTCAGATTCCAGACCCCTGG - Intergenic
1020022675 7:4878424-4878446 AGCCTCAGCCTTCAGAGCAGTGG - Intronic
1020091665 7:5345476-5345498 AGCCTCAGTTTCCTCACCTGTGG + Intronic
1020216995 7:6200835-6200857 AGCCTCAGCGTCCCAAACTCAGG + Intronic
1020466165 7:8482161-8482183 AGCCTCAGCTTGAACAGCTGGGG + Intronic
1020929177 7:14371863-14371885 AGCCTCCACAGCCAGAACTGTGG - Intronic
1021566939 7:22025559-22025581 AGCTTCAGCCTCCAGGGCTGAGG + Intergenic
1021595423 7:22311261-22311283 TGCCTCAGCTGCCCAAACTGCGG + Intronic
1022199079 7:28098314-28098336 TTCCCCAGCCTCCAGAACTGTGG + Intronic
1022941009 7:35239564-35239586 AGCTTCAGCTTCCTCACCTGTGG + Intronic
1023515359 7:40996339-40996361 AGCCTCAGCTTCTGCACCTGTGG + Intergenic
1023952634 7:44859069-44859091 AGCCTCAGCCTCCCAAAGTGCGG + Intergenic
1024244099 7:47456403-47456425 AGCCTCAGATTCCCCACCTGGGG + Intronic
1024266652 7:47611837-47611859 AGCCTCAGCCTCCTGAATAGCGG + Intergenic
1024599082 7:50963640-50963662 AGCCTCAGTTTCCCCATCTGTGG + Intergenic
1026167396 7:67922482-67922504 GGCCTCAGCTTCCCCAAATGCGG - Intergenic
1026490814 7:70861797-70861819 ATCATCAGCTGCCAGAAATGTGG + Intergenic
1026929179 7:74213759-74213781 AGCCTCACCTTCCCCAGCTGTGG + Intronic
1027048978 7:75009688-75009710 AGCCACAGCTTCTAGTACTGGGG + Intronic
1027707830 7:81556143-81556165 AGCATCAGCTTTAAGAACTCTGG - Intergenic
1028032061 7:85928703-85928725 AGCTGCAGCTAGCAGAACTGGGG + Intergenic
1028164865 7:87526788-87526810 AGCCTCAGCTGCCAGTATTTTGG - Intronic
1028850116 7:95528289-95528311 AGCCTCACCTTATGGAACTGTGG - Exonic
1029154377 7:98504707-98504729 AGCCACAGCTTCCAGGACGGTGG + Intergenic
1029384040 7:100231974-100231996 AGCCACAGCTTGTAGTACTGGGG - Intronic
1029971053 7:104789778-104789800 AACCACAGCTTCCTGAACTCAGG - Intronic
1030271854 7:107677093-107677115 AGCCTCAACTTCCTGAGCTCAGG - Intronic
1031309637 7:120179752-120179774 AGTCTTAGTTTCCAGAACTTAGG - Intergenic
1032589036 7:133175382-133175404 ATGCTCAGCTTCCAGAACACAGG + Intergenic
1033147358 7:138882914-138882936 GGCCTCAGCTTCTAGAGCTGTGG + Intronic
1033342894 7:140505799-140505821 ACTTCCAGCTTCCAGAACTGGGG - Intergenic
1034945040 7:155256434-155256456 ACTCCCAGCCTCCAGAACTGGGG + Intergenic
1034979015 7:155464035-155464057 AGCCACATGTTTCAGAACTGTGG - Exonic
1035851408 8:2922524-2922546 ACTCTCAGCCTCCAGAACTATGG + Intergenic
1036631263 8:10517668-10517690 CCCCTGAGCTTCCAGAACTCTGG + Intergenic
1037252500 8:16913005-16913027 AGCAGCAGCTTTCAGAACAGTGG + Intergenic
1038193423 8:25344540-25344562 AGTCTCAGCCTCCAGTTCTGTGG + Intronic
1039981140 8:42410872-42410894 AGCCTCAGCTTCTAGCGCAGGGG + Intergenic
1040359956 8:46655717-46655739 AGCCACAGCGTCCAGGGCTGTGG - Intergenic
1040414984 8:47187885-47187907 AGCCCCATCTTCTAGAACTGAGG - Intergenic
1040684215 8:49851654-49851676 TGCCTCAGCTTCCTGAGCAGCGG - Intergenic
1041631022 8:60086953-60086975 AGCCTCAGGTTTCTGCACTGTGG - Intergenic
1041826322 8:62099684-62099706 AGCTTCATCTTCCAGACATGTGG - Intergenic
1042191185 8:66188913-66188935 TGTCCCAGCCTCCAGAACTGTGG + Intergenic
1042214425 8:66415889-66415911 CGCCTCAGCCTCCTGAAGTGTGG - Intergenic
1043543077 8:81284457-81284479 AGCCTTAGATTCCAGAGCAGTGG - Intronic
1044597354 8:93971372-93971394 AGCCTCGGCTTTCACAACTTTGG + Intergenic
1044739825 8:95314775-95314797 ACTTTCAGCCTCCAGAACTGTGG - Intergenic
1044926067 8:97209758-97209780 AGCTTCAGCTTCCTTATCTGTGG + Intergenic
1045261726 8:100581215-100581237 AGCCTCAACTTCCCAGACTGAGG - Intronic
1045855317 8:106758202-106758224 AGCCTCATCTTGCAACACTGTGG + Intergenic
1046829335 8:118727007-118727029 TCCCTCAGCTTCCTGAACTGTGG - Intergenic
1047300025 8:123606094-123606116 TGACTCACCTTCCAGAGCTGGGG + Intergenic
1047785999 8:128154373-128154395 ACTTCCAGCTTCCAGAACTGTGG - Intergenic
1047968727 8:130066819-130066841 AGCCTCAGCAGCCAAGACTGAGG + Intronic
1048115208 8:131514103-131514125 AGGCTCCACTTCCAGCACTGGGG - Intergenic
1048555713 8:135473859-135473881 AGCCCCACCTTCTAGCACTGAGG + Intronic
1048649128 8:136454625-136454647 TGCCTCTCATTCCAGAACTGTGG + Intergenic
1049016816 8:139925768-139925790 AGCCTCAGAAAACAGAACTGGGG + Intronic
1049019769 8:139948064-139948086 AGCCTCAGTTTCCTTATCTGTGG + Intronic
1049365968 8:142237055-142237077 GGCCTGAGGTTCCAGAACGGCGG + Intronic
1049490844 8:142900897-142900919 ACTCTCAGCCACCAGAACTGTGG + Intronic
1049599510 8:143500583-143500605 TCTCTCAGCCTCCAGAACTGTGG - Intronic
1050189899 9:3013828-3013850 AGCCTCAGCTTCCTCATCTGAGG - Intergenic
1050924153 9:11241805-11241827 AGCCTCTACTTCCAGAGCAGTGG - Intergenic
1051076824 9:13248717-13248739 CGCCTCAGCCTCCCAAACTGCGG - Intronic
1051169404 9:14304198-14304220 AGCCTCATCTTTCTGAAATGTGG - Intronic
1051478923 9:17538842-17538864 ACATTCAGCCTCCAGAACTGTGG - Intergenic
1051805967 9:20992847-20992869 TGCCTCAGCCTCCAGAGCAGCGG - Intronic
1052167112 9:25345406-25345428 TGCCTCAGCCTCCCGAAGTGCGG - Intergenic
1052206405 9:25846564-25846586 TGCCACAGATTCCAGAACAGAGG + Intergenic
1052363873 9:27589653-27589675 AGCATCAGCTTCCAGCACAATGG + Intergenic
1052944887 9:34160411-34160433 CCTCCCAGCTTCCAGAACTGTGG - Intergenic
1053080703 9:35174237-35174259 AGCCTCAACTTCCAGGGCTCAGG + Intronic
1053124700 9:35570879-35570901 AGCCTCAGCTTCCTGGGCCGAGG - Intergenic
1053302611 9:36962636-36962658 GGCCTCAGTTTCCATATCTGTGG - Intronic
1054702859 9:68431576-68431598 TGCCACAGCCTTCAGAACTGTGG - Intronic
1055352553 9:75404064-75404086 AGGCACAGCTTCCAGCACTGAGG - Intergenic
1055702978 9:78966344-78966366 CTTCCCAGCTTCCAGAACTGTGG + Intergenic
1057091883 9:92265737-92265759 AGCCTCAGCTTCCTGGGCTCAGG + Intronic
1057150833 9:92794446-92794468 AGCCTCAGCAACCAGGACAGAGG - Intergenic
1057267937 9:93631137-93631159 AGCCTCAGCTCACAGAACAGGGG - Intronic
1057280799 9:93710194-93710216 GGCCTGGGCTTCCAGATCTGGGG + Intergenic
1057746776 9:97758700-97758722 AGCCTCAGTTTCCTCATCTGTGG + Intergenic
1058747177 9:108003036-108003058 AGCCTCAGTTTCCTCAAATGTGG - Intergenic
1059308736 9:113374164-113374186 AGCCACAGCTTCCCCAACTACGG - Exonic
1059409976 9:114125658-114125680 AGCCTCAGTTTCCCTAACTGTGG - Intergenic
1059886194 9:118747260-118747282 AGCCACAGCTCCCAGCCCTGAGG + Intergenic
1060475060 9:123980595-123980617 AGGCAGAGCTTCCAGGACTGAGG - Intergenic
1060523991 9:124310207-124310229 AGCCTCAGATTCCTGAAATGGGG + Intronic
1060731496 9:126039703-126039725 AGCCTCAGCTCCCCGGGCTGGGG + Intergenic
1060750056 9:126163021-126163043 AGCCTCAGCCTCCTCAGCTGTGG + Intergenic
1060792964 9:126498156-126498178 AGCCTCAGCTTCCTCACATGAGG - Intronic
1060933037 9:127500875-127500897 AGCCTCTGCTCTCAGATCTGAGG - Intronic
1061544062 9:131293733-131293755 AGCCTCAGTTTCCCTATCTGGGG + Intronic
1061748650 9:132758705-132758727 TGCCTCAGCTTCCCAAAGTGTGG + Intronic
1061847655 9:133396918-133396940 GGCCTCAGCTCACAGAGCTGGGG - Intronic
1062282241 9:135757238-135757260 AGCCCCAGCTGCCAGGAGTGCGG + Intronic
1062420663 9:136480279-136480301 AAACTCTGCTGCCAGAACTGGGG + Intronic
1062421856 9:136486467-136486489 AGCTTCAGCGTCCAGGACTAAGG - Intergenic
1185607814 X:1377185-1377207 ACCTGCAGCTTCCAGGACTGTGG + Intronic
1185622460 X:1460972-1460994 GGCCCCAGCCTCTAGAACTGTGG + Intergenic
1185853473 X:3510608-3510630 GACTTCAGCTTCCAGGACTGTGG + Intergenic
1186044649 X:5522148-5522170 TGCCTCAGCTTCCCAAAGTGTGG - Intergenic
1186495821 X:10012537-10012559 AGCCTCAGTTTCCTCATCTGAGG + Intergenic
1186842609 X:13499350-13499372 AACATCTACTTCCAGAACTGAGG - Intergenic
1187428529 X:19201064-19201086 AGCCTCAACTTCCTGAGCTCAGG + Intergenic
1188063835 X:25633361-25633383 AGCCACAGCTGCCACCACTGAGG + Intergenic
1188544895 X:31294247-31294269 AGCCTCAGTTTCCAAGTCTGTGG + Intronic
1189195570 X:39149416-39149438 ACTTTTAGCTTCCAGAACTGTGG - Intergenic
1189311423 X:40020944-40020966 AGCCTCAACTTCCTGGACTCAGG + Intergenic
1189872975 X:45404159-45404181 AGCATCAGCTTCCAGCCCAGTGG + Intergenic
1192026019 X:67452596-67452618 AGCCTCAACTTCCTGAGCTCAGG - Intergenic
1192123799 X:68481893-68481915 TGCCTCAGCCTCCAAAAGTGCGG + Intergenic
1192250071 X:69404784-69404806 AGTTCCAGCCTCCAGAACTGTGG + Intergenic
1192980150 X:76330613-76330635 ACACTAAGCTTCTAGAACTGGGG + Intergenic
1194303322 X:92213393-92213415 AGCCTCAGTTTCCTCAACTGAGG - Intronic
1194325558 X:92511852-92511874 CCCCTCATCTTCCAGAAATGCGG - Intronic
1194625474 X:96221730-96221752 AGCTCCAGCTTCCAAAACAGTGG - Intergenic
1194679575 X:96835893-96835915 AGCCTCAACTTCCCGGACTCAGG + Intronic
1196321385 X:114344515-114344537 ATTCCCAGCCTCCAGAACTGTGG + Intergenic
1196333246 X:114497413-114497435 AGCCTCAACTTCCTGGACTCAGG + Intergenic
1196998795 X:121415603-121415625 AGCCCCAGCTGCCACCACTGGGG - Intergenic
1198146251 X:133860286-133860308 AGCCTCAGTTTCAAAATCTGGGG - Intronic
1199175347 X:144781874-144781896 TGCCTCAGCTTCCCAAAGTGTGG - Intergenic
1199657315 X:150009057-150009079 ACTTCCAGCTTCCAGAACTGTGG + Intergenic
1199774200 X:150996641-150996663 AGCCTCAGCCTCCTGGGCTGAGG + Intergenic
1199779817 X:151047959-151047981 CTTCCCAGCTTCCAGAACTGTGG + Intergenic
1200041068 X:153369904-153369926 ATTTCCAGCTTCCAGAACTGTGG - Intergenic
1200634288 Y:5631018-5631040 CCCCTCATCTTCCAGAAATGCGG - Intronic
1201054879 Y:9978713-9978735 AGCCGCATCCTCTAGAACTGTGG - Intergenic
1201390496 Y:13492229-13492251 TGCCTCAGCTTCCCAAAGTGCGG - Intergenic
1201567344 Y:15380255-15380277 TGCCTCAGCTTCCCAAAGTGTGG + Intergenic
1201607333 Y:15801417-15801439 TGCCTCAGCCTCCCAAACTGCGG - Intergenic