ID: 1162393962

View in Genome Browser
Species Human (GRCh38)
Location 19:10405327-10405349
Sequence CAGAACTGGGGATAGAGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 217}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162393955_1162393962 -6 Left 1162393955 19:10405310-10405332 CCCGGAGCCTCAGCTTCCAGAAC 0: 1
1: 0
2: 2
3: 49
4: 551
Right 1162393962 19:10405327-10405349 CAGAACTGGGGATAGAGCGCCGG 0: 1
1: 0
2: 1
3: 19
4: 217
1162393952_1162393962 17 Left 1162393952 19:10405287-10405309 CCCAGCTTCAGCAAAACAGGGTT No data
Right 1162393962 19:10405327-10405349 CAGAACTGGGGATAGAGCGCCGG 0: 1
1: 0
2: 1
3: 19
4: 217
1162393953_1162393962 16 Left 1162393953 19:10405288-10405310 CCAGCTTCAGCAAAACAGGGTTC No data
Right 1162393962 19:10405327-10405349 CAGAACTGGGGATAGAGCGCCGG 0: 1
1: 0
2: 1
3: 19
4: 217
1162393956_1162393962 -7 Left 1162393956 19:10405311-10405333 CCGGAGCCTCAGCTTCCAGAACT 0: 1
1: 0
2: 7
3: 101
4: 879
Right 1162393962 19:10405327-10405349 CAGAACTGGGGATAGAGCGCCGG 0: 1
1: 0
2: 1
3: 19
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162393962 Original CRISPR CAGAACTGGGGATAGAGCGC CGG Intronic
900642895 1:3695778-3695800 CAGTGCTGGGGATAGACCACAGG + Intronic
901025657 1:6277515-6277537 CAGGGCTGGGGAGAGAGGGCTGG - Intronic
901448481 1:9322345-9322367 CAGAGCTGGGATTAGAACGCAGG + Intronic
902171143 1:14612303-14612325 CAGCTCAGGGGTTAGAGCGCGGG - Intronic
903293987 1:22332183-22332205 CAGGACTGGGGAGAGAGGGGTGG - Intergenic
905011691 1:34751456-34751478 CAGAAATGGGGTTTGAGCCCAGG + Intronic
905244147 1:36601065-36601087 CAGAGCTGGGGCTAGAACCCAGG + Intergenic
905907212 1:41627094-41627116 CAGCACTGGGGCCAGAGGGCAGG + Intronic
907779651 1:57554134-57554156 CAGAAGAAGGGATAGAGAGCAGG + Intronic
908350385 1:63281140-63281162 CAGAGCTGGGGCTAGAACCCAGG - Intergenic
909336779 1:74484374-74484396 CAGTACTGGGCATAGAGCAGGGG + Intronic
909736806 1:78971477-78971499 CAGAACAGGGGAGAGAGGCCAGG - Intronic
915608556 1:156971634-156971656 TAGAACTGGGGGTAGAGTGAGGG - Intronic
916756637 1:167777032-167777054 CAGAACTGGGGCTAGAACCCAGG + Intronic
919856691 1:201711151-201711173 CAGGACTGGGGATAGAGCTTAGG + Intronic
920206269 1:204294488-204294510 GAGAACTGGGATTAGAGCCCAGG + Intronic
920263269 1:204703965-204703987 CAGAACTGAGGATGGAGTCCTGG + Intergenic
920516186 1:206586059-206586081 CAGAACTGGAACTAGAGCCCAGG - Intronic
920548769 1:206840477-206840499 CAGGAATGGGGCTAGAGCCCAGG - Intronic
920579200 1:207089081-207089103 CAGCACTGGGGAAAGAGAACGGG - Intronic
920853069 1:209641967-209641989 CAGAGCTGGGGAGAAAGCTCTGG - Intronic
922577962 1:226675583-226675605 CAGAACTGGGACTAAAGCCCAGG - Intronic
924335132 1:242980092-242980114 CAGAACAGGGACTAGAGCCCAGG + Intergenic
1063126025 10:3137375-3137397 CAGAAATGGGGGCAGAGAGCTGG + Intronic
1063460259 10:6211043-6211065 TATAACTGGGGATATAGCTCAGG - Intronic
1064174852 10:13066081-13066103 AGGAACTGGGGATGGAGCCCAGG - Intronic
1064824995 10:19388287-19388309 AAGAACTGGGGTTAGAACTCTGG + Intronic
1066482368 10:35809405-35809427 CAGGACTGGGGATAGGTGGCAGG - Intergenic
1066490531 10:35889760-35889782 CACAACTGCGGATACAGGGCAGG - Intergenic
1068006861 10:51401501-51401523 CAGAACTGGTGACAGAGGGGTGG - Intronic
1069293631 10:66815319-66815341 CAGAACTGGGGATGAAGGGAGGG - Intronic
1069784094 10:70977057-70977079 CAGAAATGGGGAGAGAGGGGAGG + Intergenic
1069902258 10:71713012-71713034 CAGAGCTGAGGATAGGGCTCTGG + Exonic
1070829076 10:79407752-79407774 CAGAGCTGGGAGTGGAGCGCAGG + Intronic
1072880302 10:99220507-99220529 TAGAACTGGGGATGGAGGCCAGG + Intronic
1073425627 10:103453905-103453927 CAGAAGTGGGAATAGAGGGAAGG + Exonic
1074183771 10:111084170-111084192 CAAAACTGGGCCTAGAACGCAGG - Intergenic
1074375934 10:112940709-112940731 CAAAGCTGGGGAGAGAGCTCTGG + Intergenic
1075702486 10:124478354-124478376 CAGTACCGGGGCTAGAGGGCAGG + Intronic
1079093571 11:17496870-17496892 CAGAAATGGGGATGGAGTGCCGG - Intronic
1080121183 11:28679858-28679880 CAGTACTGGGGCTAGAACACAGG - Intergenic
1081718532 11:45268652-45268674 CAGAACTGGGAATTGAACCCAGG + Intronic
1083261086 11:61523539-61523561 CAGAGCTGGGGATAGAACCCAGG + Intronic
1084694621 11:70746171-70746193 CAGATCTGGGGGCAGAGCCCAGG + Intronic
1084710181 11:70839392-70839414 CAGACCTGGGGAGACTGCGCTGG - Intronic
1084901243 11:72311530-72311552 CAGAACTGAGGGTAAAGCCCAGG - Intronic
1084904789 11:72337176-72337198 AAGAACTGGGAATAGAGCTCTGG + Intronic
1088190436 11:107222384-107222406 CAGAGCTGGGGTTAAAGCCCAGG - Intergenic
1089681939 11:120123471-120123493 CAGAGTTGGGGATTGAGCTCTGG + Intronic
1090682552 11:129077192-129077214 TGGAACTGGGGATAGACCACAGG + Intronic
1091216917 11:133907759-133907781 TAGAACTGGGCAAAGAGGGCAGG + Intergenic
1091609026 12:1986997-1987019 TAGAAGTGGGGATAGAACGAAGG + Intronic
1092270093 12:7017153-7017175 CAGGACTGGGGCTAGAGCAGAGG - Intronic
1093902340 12:24650326-24650348 CAGCAATGGGGATAGAGTGAAGG + Intergenic
1093935560 12:24996703-24996725 CAGAACTGGGGTTTGAACTCAGG + Intronic
1094476481 12:30844542-30844564 TAGCACTGGGGATATAGCTCAGG + Intergenic
1094488193 12:30941557-30941579 CAGAACTGGGACTAGAGCCCAGG + Intronic
1095954720 12:47799493-47799515 CATGACTGGGGATAGAGCATGGG - Intronic
1095983767 12:47986724-47986746 CAGATTGGGGGATAGAGCCCTGG + Intronic
1101531913 12:105581054-105581076 CAGAACTGGGAATTGAGCCCAGG - Intergenic
1102273392 12:111560008-111560030 CAGAACTAGGGAAAGAGAGCTGG + Intronic
1102933444 12:116879218-116879240 TAGAACTGTGGAGAGAGGGCTGG - Intronic
1105463321 13:20611900-20611922 CAGAACTGGTGAAAGTGGGCCGG - Intronic
1108007179 13:45961056-45961078 CAAATCTGGTGATAGAGCCCAGG - Intronic
1109190448 13:59316502-59316524 CAGCACTGGGGTTAGAGCTGTGG - Intergenic
1111161011 13:84394615-84394637 CAGAATTGGGAAAAGACCGCAGG - Intergenic
1112791640 13:103009249-103009271 CAGAGCTGTGGATGGAGGGCAGG + Intergenic
1116108176 14:40538924-40538946 CAAAAGTGGGGATAGAGGGAAGG + Intergenic
1118713944 14:68546063-68546085 CAGAACTGGGAATACAGTGGTGG - Intronic
1118897073 14:69953933-69953955 AAGGACTGGGGATAGAAAGCAGG - Intronic
1119861689 14:77940584-77940606 CTGAACTGGGGACAGAGGTCAGG + Intergenic
1119935813 14:78591456-78591478 CTGAGCTGGGGCTAGAGCTCAGG - Intronic
1121313656 14:92948675-92948697 CAGGGCTGGGGACAGAGCCCTGG + Intronic
1121526901 14:94625473-94625495 CAGAGCTGGGGAGGGAGAGCGGG + Intergenic
1122677244 14:103425777-103425799 CAGAACTGGGGAAGGAGTGGAGG - Intronic
1126402631 15:48288963-48288985 CAGAGCTGGGGCTAGAACCCAGG - Intronic
1127656694 15:61062240-61062262 CAGAACTGGGGAGACGGCTCTGG + Intronic
1129543448 15:76370753-76370775 CAGAGCTGGGGCTAGAACCCAGG + Intronic
1129602436 15:77008071-77008093 CAGAGCTGGGGGTGGAGGGCGGG + Intronic
1129691122 15:77714207-77714229 CAGAACTGGGGACAGGGAGAAGG - Intronic
1130921088 15:88345098-88345120 CAGAGCTGGGGTTTGAGCCCAGG - Intergenic
1134690817 16:16190113-16190135 CAGCACTGGGGAAGGAGTGCGGG - Intronic
1137919832 16:52476017-52476039 CAGAAATGCTGATAGAGCACAGG + Intronic
1138377063 16:56571526-56571548 CAGAACTGGGAACTGAGCTCAGG + Intergenic
1141606293 16:85155496-85155518 CAGAACTGGGCCTAGATCTCTGG - Intergenic
1143335004 17:6165501-6165523 CAGAACAAGGGATATAGCTCTGG + Intergenic
1144248942 17:13396312-13396334 CAGAAGTGGGGAAGGAGTGCTGG + Intergenic
1144892052 17:18499856-18499878 CAGCACTGGGCATAGAGCACTGG + Intergenic
1145140173 17:20444461-20444483 CAGCACTGGGCACAGAGCACTGG - Intergenic
1145795700 17:27654210-27654232 CAGCACTGGGCACAGAGCACTGG + Intergenic
1145810140 17:27759542-27759564 CAGCACTGGGCACAGAGCACTGG + Intronic
1147045269 17:37746617-37746639 CAGAATTGGTGATACAGTGCTGG + Intergenic
1151365809 17:73615570-73615592 CAGGACTGGGGATGGAGGGAGGG - Intronic
1152009684 17:77704587-77704609 CAGCACTGGGGATATATCTCTGG + Intergenic
1153900782 18:9614989-9615011 CAGGCCTGGGGATGGGGCGCTGG - Intronic
1156940443 18:42760616-42760638 CAGAACTGGGACTAGAACCCAGG - Intronic
1162393962 19:10405327-10405349 CAGAACTGGGGATAGAGCGCCGG + Intronic
1163195445 19:15716436-15716458 CAAAGCTGGGGATAGAGAGGAGG - Intergenic
1163619094 19:18347576-18347598 CAGAAATGGGGAGAGAGAGAAGG - Intronic
1163772103 19:19197460-19197482 CAGCACTGGGGATAGGGGGCAGG + Intronic
1165152117 19:33766986-33767008 GAGAACTGGGGAAGGAGGGCAGG - Intronic
1165157572 19:33797315-33797337 CAGAACAGGGGCCAGAGTGCGGG - Intronic
1166127721 19:40725660-40725682 CAGAACTAGGGTTTGAGCTCAGG - Intronic
1168251731 19:55145947-55145969 GCGAGCTGGGGAGAGAGCGCTGG - Intronic
1168477687 19:56688967-56688989 CACAGCTGTGGAGAGAGCGCAGG - Intergenic
926065633 2:9837302-9837324 CAGAAATGGGAATGGAGAGCTGG - Intergenic
926404644 2:12538850-12538872 CAGAACTGGGAATAGAATTCAGG + Intergenic
926887669 2:17612880-17612902 TAGAACTGGGGACTGAGCCCTGG - Intronic
927291401 2:21408379-21408401 CTGAACTGGGGAAAGAACCCTGG + Intergenic
927550966 2:23998903-23998925 AAGAACTGGGGAAAGATTGCTGG - Intronic
927686971 2:25177956-25177978 CAGAGCTGGGGCTAGAACCCAGG - Intergenic
928604947 2:32936915-32936937 CAGAACTGGGAACTGAGCCCAGG + Intergenic
930092198 2:47539402-47539424 CAGTACTGGGGACAGACTGCAGG + Intronic
931145710 2:59514840-59514862 CAGAACTGGGATTAGAACTCAGG + Intergenic
932046031 2:68350827-68350849 CAGAGCTGGGGTTAGAACCCGGG + Intergenic
932089957 2:68797616-68797638 CAGGACTGGGGCTTGAGCGGGGG - Intronic
932450669 2:71808614-71808636 CAGAACTGGGGAGAGAGTAGGGG + Intergenic
933632603 2:84674270-84674292 CAAAACTGGGATTAGAGCCCAGG + Intronic
933772420 2:85752990-85753012 CAGAGCTGGGGTTTGAGCCCAGG + Intronic
935101236 2:99997964-99997986 CAGAGCAGGGGAAAGAGGGCTGG - Intronic
935900458 2:107786895-107786917 CAGAACTGGGCATGGAGTGGAGG + Intergenic
936007606 2:108905185-108905207 CAGAGCTGGGCATGGAGCACAGG + Intronic
937690177 2:124746690-124746712 CAGAACTGAGGACAGAGGTCAGG + Intronic
939734082 2:145821864-145821886 CAGAAGTGGGGTTAGAGCCCTGG + Intergenic
944540093 2:200746296-200746318 AAGAACTGGGGCTGGAGTGCTGG + Intergenic
944711432 2:202338285-202338307 CAGTCCTGGGGATAGAAGGCTGG - Intergenic
946625812 2:221611189-221611211 CAGTACTGGGGAGAGAGGGCTGG + Intergenic
948216993 2:236239455-236239477 CAGAACTGGGACCAGAGGGCGGG - Intronic
948217009 2:236239534-236239556 CAGAACTGGGACCAGAGGGCGGG - Intronic
948687611 2:239678908-239678930 CAGAACTGGAGACAGAACACTGG - Intergenic
948861516 2:240754950-240754972 CAGGGCTGGGGAGGGAGCGCAGG - Intronic
1169200611 20:3707414-3707436 CAGAACTTGGGATAGGGCCAAGG - Intergenic
1171878579 20:30599980-30600002 CAGAACCTGGGAGAGAGTGCAGG - Intergenic
1172437096 20:34937019-34937041 GAGCACTGGGGAAAGAGCACAGG + Exonic
1174696490 20:52564899-52564921 CAGAGCTGGGCATAGGCCGCAGG - Intergenic
1175880408 20:62254684-62254706 CAGAACTGTGCAGAGAGCTCTGG + Intronic
1175946594 20:62561935-62561957 CAGAACTGGGGTTGGAGCCTGGG - Intronic
1176720242 21:10386792-10386814 CAGGAATGGGGAAAGAGAGCAGG + Intergenic
1178544258 21:33479957-33479979 CAGACGCGAGGATAGAGCGCCGG + Exonic
1178741121 21:35202404-35202426 CAGAACTGGGGTTTGAACTCAGG + Intronic
1179725173 21:43337920-43337942 CAGAACAGGGGTCAGAGCCCCGG - Intergenic
1180301441 22:11039552-11039574 CAGGAATGGGGAAAGAGAGCAGG + Intergenic
1181618485 22:24071355-24071377 CAGAATGGGGGCCAGAGCGCAGG + Intronic
1181783819 22:25211360-25211382 CAGAACTGGGATTTGACCGCAGG + Intergenic
1183600983 22:38840541-38840563 CAGAACTGGGGGGAGAGGGAGGG + Intronic
1183678016 22:39310654-39310676 CAGAACTCGGTACAGAGCCCTGG + Intergenic
1184128217 22:42502144-42502166 CAGACCTGGGGCCAGAGCCCAGG - Intergenic
1184137007 22:42555457-42555479 CAGACCTGGGGCCAGAGCCCAGG - Intronic
1185397333 22:50599883-50599905 CAGAACTAGGGAGAGACTGCAGG - Intronic
950478902 3:13232571-13232593 CAGGTCTGGGGAGAGAGGGCAGG + Intergenic
952710603 3:36428559-36428581 AGGAAATGGGGATAGAGCACAGG + Intronic
953363461 3:42321769-42321791 CAGCACTGGGGACAGAGAGCTGG - Intergenic
953914679 3:46910554-46910576 CAGCACTGTGGATGGAGCCCTGG - Intergenic
954387927 3:50254141-50254163 CAGAACTGTGGAAAGGGTGCAGG - Intronic
955101915 3:55858947-55858969 CAAAATTAGGGATAGAGTGCAGG - Intronic
955408878 3:58643072-58643094 CAGAACAGGGGACAGACCCCGGG - Intronic
959025042 3:101231491-101231513 CAGAACTGGGCCTAGAACCCAGG + Intronic
959571834 3:107893135-107893157 CAGCACTGGGAAGAGAGCACTGG + Intergenic
960236128 3:115284740-115284762 CTGAAATGGGGATACAGAGCTGG + Intergenic
960852432 3:122069863-122069885 CAGAGCTCAGGATAGAGCTCAGG - Intronic
960860486 3:122147808-122147830 CAGAGCATGGGATAGAGCTCTGG - Intergenic
961155088 3:124672760-124672782 CAGAACTGGGAATAGAAACCAGG - Intronic
961480055 3:127173769-127173791 GAGCACTGGGGACAGAGCCCAGG + Intergenic
961823145 3:129585511-129585533 CAGAACAGGGGATGGAGGGAGGG - Intronic
962027145 3:131560293-131560315 CAGAGCTGGGGTTTGAGCCCGGG + Intronic
962316126 3:134360554-134360576 CCGAAATGGGGATACAGCACAGG + Intronic
962611094 3:137076830-137076852 CAGAACTGGTGATACAGCAGAGG + Intergenic
962692819 3:137917610-137917632 CAGAACTTGGGATGGAGAGAAGG - Intergenic
963474320 3:145784753-145784775 CAGAACTGAGGACAGAGCCCAGG + Intergenic
966375145 3:179289068-179289090 CAGATCTGCTGATAGAGAGCTGG + Intergenic
967314881 3:188142874-188142896 CAGAGCTGGGACTAGAGCCCAGG + Intergenic
967688143 3:192441378-192441400 CTGAACTGGGGCTAGAACCCTGG - Intronic
967932775 3:194702558-194702580 CAGAACTGGGGCTGGAGTCCTGG + Intergenic
967971026 3:194999615-194999637 CAGAGCTGTGCATAGAGGGCTGG - Intergenic
969651253 4:8469599-8469621 CAGACCTGGAGATGGAGAGCGGG + Intronic
969901750 4:10356386-10356408 CAGAATTGGGGAAGGACCGCAGG - Intergenic
971304050 4:25464884-25464906 GAGAAATGGGGATATAGGGCTGG + Intergenic
976207975 4:82640097-82640119 CAGGACTGGGGTCAGAGAGCAGG - Intronic
976562871 4:86521909-86521931 CAGAACTGGGGAGGGACCACAGG - Intronic
978340669 4:107719020-107719042 TAGAACAGTGGAAAGAGCGCTGG - Intronic
979241982 4:118455188-118455210 CAGAACAGGGACTAGAGCCCAGG - Intergenic
981641081 4:146944480-146944502 CATCTCTGGGGATAGAGGGCAGG - Intronic
982218822 4:153107386-153107408 CAGACCTGGGGATGGGGGGCGGG - Intergenic
991550615 5:67831844-67831866 CAGAAATGGGGAAAGACCCCAGG - Intergenic
992372026 5:76153156-76153178 CTGAGCTGGGGAAAGAGCTCGGG - Intronic
998383318 5:141741460-141741482 CAGAACTGGGGCCAGGGGGCTGG - Intergenic
1000295277 5:159908216-159908238 CAGAAATGGGATTAGAGCACAGG - Intergenic
1001995135 5:176151325-176151347 CAGCACTGGCGACAGAGCGAGGG - Intergenic
1003776923 6:9377410-9377432 AAGAACTGGGGATAGATCTAGGG + Intergenic
1005615193 6:27566169-27566191 CGGAAGTGGGGATAGAGCACAGG + Intergenic
1007045925 6:38774170-38774192 CAAAACTGAAGATAGAGCTCTGG - Intronic
1014009371 6:116458809-116458831 CAGACCTGGGTATGGAGGGCTGG + Intergenic
1015283641 6:131460252-131460274 CAGAAATGGGGCTAGAGCTGGGG - Intergenic
1015833868 6:137398352-137398374 AAGCACTGGGGATAGAGAGGTGG - Intergenic
1016936567 6:149452497-149452519 CAGAACTTGGGCAAGAGCCCAGG + Intronic
1018226738 6:161636235-161636257 CAGAGCTGTGGATAGAGCAGGGG - Intronic
1018995185 6:168704943-168704965 CAGAAATGGGGACAGAGGGACGG + Intergenic
1020265442 7:6557192-6557214 CAGGACTGGGGATACATCGGAGG - Intergenic
1020747433 7:12094839-12094861 CAGCACAGGGGTTAGAGCACAGG - Intergenic
1021016853 7:15546599-15546621 CAGAGCTGGGGCTAGAGGTCTGG + Intronic
1022180468 7:27914065-27914087 CAAATCTGGGGACAGAGCACAGG + Intronic
1022652592 7:32290598-32290620 CAGAACTGGGTCTAGAGCCCAGG + Intronic
1024184651 7:46938048-46938070 CAGAGCTGGGGAGAGAGGGCAGG + Intergenic
1025016166 7:55440642-55440664 CAGACCTGGGGCAAGAGGGCAGG - Intronic
1026524706 7:71143897-71143919 CAGCAGTGGGTATAGAGAGCTGG + Intronic
1026893592 7:73997378-73997400 CAGAGCTGGAGAAAGAGAGCTGG + Intergenic
1027199350 7:76053302-76053324 CAGAACTGGGAATGCAGAGCTGG + Intronic
1033444044 7:141404879-141404901 CAGAGCAGTGGATACAGCGCTGG - Intronic
1034692498 7:153025069-153025091 CAGAGCTGGGGGTAGACCTCCGG - Intergenic
1035386727 7:158477981-158478003 CAGAGAAGGGGAGAGAGCGCTGG + Intronic
1039430242 8:37520055-37520077 CAGAACTGGAGATACAGTGATGG - Intergenic
1040669143 8:49666082-49666104 CAGAACTGAGAATAGAGGCCTGG - Intergenic
1044992219 8:97806346-97806368 CTGCACTGGGGATAGAGAACAGG + Intronic
1047457398 8:125028474-125028496 CAGAGCTGGGGGTAGAGCAGTGG + Intronic
1048598233 8:135889610-135889632 AAGCACTCGGGATAGAGCTCTGG - Intergenic
1049510740 8:143025551-143025573 TAGATCTGGGGACAGAGCTCAGG - Intergenic
1051487981 9:17629136-17629158 CAGAACTGGGGCTAGAACCCAGG - Intronic
1051560677 9:18437336-18437358 CAGCACTGGGGATGGAGCAAAGG - Intergenic
1053304165 9:36972318-36972340 CAGAGCTGGGGCTAGAACCCGGG - Intronic
1057879446 9:98782076-98782098 CAGAATGGGAGATAGAGCGATGG - Intronic
1059009233 9:110438796-110438818 CAAACCTGTGTATAGAGCGCTGG - Intronic
1060295609 9:122340987-122341009 CAGAACTGGGAATGGGGCCCAGG - Intergenic
1060398811 9:123335463-123335485 CAGAACTGGGATTGGAGCCCAGG + Intergenic
1061218701 9:129236635-129236657 CAGAGCTGGGGACAGAGCCACGG + Intergenic
1062660468 9:137628817-137628839 CAGAGGTGGGGCTAGAGCCCTGG + Intronic
1185540655 X:900711-900733 CAGGAATGGGGAGAGAGAGCAGG - Intergenic
1186888934 X:13941094-13941116 CACAACTGGGGATAGGGTGGGGG + Intergenic
1187018737 X:15357552-15357574 CAGAATTGGGGAAAGAGGGATGG - Intronic
1189565154 X:42234221-42234243 CAGAACTAGAAATAGAGCCCTGG - Intergenic
1190726220 X:53192594-53192616 CAGAACTGGGGAGAGAAGGGAGG + Exonic
1190873964 X:54446576-54446598 CAGAACTGGGGCTAAAATGCAGG + Intronic
1193775311 X:85634633-85634655 CAGACCTGGGGATCGAGAGCAGG + Intergenic
1199721485 X:150545888-150545910 CAGAGCTGGGGTTGGAGCTCAGG - Intergenic
1199882489 X:151985686-151985708 CAGAGCTGGGGCTAGAATGCAGG + Intergenic
1199985578 X:152947643-152947665 CTGACCTGGGGCTAGAGAGCTGG + Intronic
1200038595 X:153349343-153349365 CAGAACTGGGGATAGACCCCAGG + Exonic
1202389684 Y:24356994-24357016 CAGAACAGGGACTAGAGCCCAGG - Intergenic
1202481100 Y:25313120-25313142 CAGAACAGGGACTAGAGCCCAGG + Intergenic