ID: 1162396304

View in Genome Browser
Species Human (GRCh38)
Location 19:10419710-10419732
Sequence CTGTCGTCTGACTGTAGTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162396304 Original CRISPR CTGTCGTCTGACTGTAGTGT CGG (reversed) Intronic
907188201 1:52627869-52627891 CTGTATTTTGACTGTGGTGTTGG + Intergenic
908285650 1:62596308-62596330 CTGGAGTCAGACTGTGGTGTGGG - Intronic
908879544 1:68715212-68715234 CTATAGTCTAAATGTAGTGTTGG - Intergenic
909441020 1:75696548-75696570 CTCTTGGCTGACTGTATTGTTGG - Intergenic
910980966 1:92960414-92960436 CTGTCCTCTGAATGCAGCGTTGG + Intronic
912588758 1:110792329-110792351 CTGTGGTCTGACAGTACAGTTGG - Intergenic
917662709 1:177193206-177193228 GTGGCTTCTGACTGTAGGGTAGG - Intronic
920978307 1:210807183-210807205 CTGTATTTTGAATGTAGTGTTGG - Intronic
922584292 1:226722162-226722184 CTGGCCTCTGACTGTAGTTTGGG - Intronic
1063918309 10:10906754-10906776 CTGTCGCCAGGCTGTAGTGCGGG + Intergenic
1067733461 10:48830701-48830723 CTGTCTTCTGGATGTTGTGTTGG - Exonic
1068163257 10:53295547-53295569 CTGTCATTTTACTGTAGTTTGGG - Intergenic
1069127144 10:64649958-64649980 CTCTGGTCTGACTGCAGTCTGGG - Intergenic
1070873411 10:79778698-79778720 CTCTCTTCTGGCCGTAGTGTAGG - Intergenic
1071090396 10:81911547-81911569 CTGCTGTTTGACTGGAGTGTGGG + Intronic
1071640341 10:87300848-87300870 CTCTCTTCTGGCCGTAGTGTAGG - Intergenic
1071654894 10:87437097-87437119 CTCTCTTCTGGCTGTAGTGTAGG + Intergenic
1075396225 10:122129648-122129670 CTGTAGTTTGCCTGTAGTTTAGG + Intronic
1078590761 11:12638793-12638815 CTGATGTCTGAGTGTTGTGTAGG + Intergenic
1084631194 11:70352106-70352128 CTGTCCTCTGACAAAAGTGTGGG + Intronic
1085601785 11:77861949-77861971 CTGTCACCTGACTGTACTGAAGG - Intronic
1088889775 11:114035457-114035479 CTGATGTCTGACTGTGGTGTGGG - Intergenic
1089000747 11:115050228-115050250 CTGGGGTCTGCCTGTAGTTTGGG - Intergenic
1091349291 11:134880221-134880243 CTGTTGTCACACTGGAGTGTGGG + Intergenic
1096884771 12:54706203-54706225 CTGTCGTCTACCTCTAGTGATGG + Intergenic
1096977217 12:55706431-55706453 CTGTCTTCTGCCTCTACTGTCGG - Intronic
1098124146 12:67272732-67272754 CTGTCGCCAGGCTGTAGTGCAGG + Intronic
1103706122 12:122873802-122873824 GTGTCGTCTGTATTTAGTGTTGG - Intronic
1105328847 13:19395553-19395575 CTATCGTCAGTCTGTAGTGAAGG + Intergenic
1110664228 13:78097187-78097209 CTGTGGTCTGAGTGTATGGTTGG - Intergenic
1113343430 13:109448636-109448658 CTGTAGACTGACAGTAGTGATGG - Intergenic
1113707434 13:112443879-112443901 AAGTCGTCTGGCTGTGGTGTGGG - Intergenic
1124182176 15:27486585-27486607 GTGTGGTCTGACTCTAGTGCTGG - Intronic
1134874441 16:17684566-17684588 GTGTCCTCTGACTATAGCGTGGG - Intergenic
1136488187 16:30586429-30586451 CTGTCGCCAGCCTGGAGTGTGGG - Intergenic
1139315421 16:66063639-66063661 TTGTCATCTGACTGTTGTATTGG - Intergenic
1141728934 16:85809100-85809122 CTGAGGTCTGACTGAGGTGTGGG + Intergenic
1143680743 17:8474148-8474170 CTGTGATCTGACTGGAGGGTGGG - Intronic
1162396304 19:10419710-10419732 CTGTCGTCTGACTGTAGTGTCGG - Intronic
925500688 2:4501079-4501101 CAGTCTTCTGCCTGTAGTGTAGG + Intergenic
938941003 2:136169575-136169597 TTGTCTTCTGAGGGTAGTGTGGG + Intergenic
939139808 2:138341082-138341104 TTATCGTCTAACTGTAGTGGTGG - Intergenic
941952803 2:171174195-171174217 CTTTCGTGTGGCTGCAGTGTGGG - Intronic
946186071 2:217981057-217981079 TTGCCCTCTGAGTGTAGTGTGGG - Intronic
1172234447 20:33360926-33360948 CTGTCTTCTGTGTGTTGTGTTGG - Intronic
1172601928 20:36190040-36190062 GTGTCGTCTGACTGTAGTCCTGG + Intronic
1179259145 21:39742962-39742984 CTGTCACCTGACTCTAGTGAAGG - Intergenic
1179883575 21:44303878-44303900 CTGCCCTCTGACTGCGGTGTCGG + Intronic
1184848861 22:47106893-47106915 CTGTCGCCAGACTGGAGTGCAGG - Intronic
952754088 3:36850954-36850976 CTGGCTGCTGACTGTACTGTGGG - Intronic
952965516 3:38618638-38618660 CTGTAGCCTGAATGTACTGTGGG - Intronic
954272274 3:49519150-49519172 CTCTCCTCTGACTTGAGTGTGGG + Intronic
955021390 3:55125075-55125097 CTGTAGCCTGACTATAGTCTGGG - Intergenic
956899872 3:73704279-73704301 CTGTCTTCTGGCTTTAGGGTTGG - Intergenic
957307355 3:78474903-78474925 GTGTCATCTGACAGTATTGTTGG - Intergenic
961357355 3:126347507-126347529 CTGTCATCAGCCTGTAGGGTGGG - Intronic
963197568 3:142550266-142550288 CTGTCATCTGACTAGAGTGAAGG + Exonic
964550098 3:157876066-157876088 CTTCCGTCTGGCTGTTGTGTGGG - Intergenic
965375804 3:167922213-167922235 CTGTCTACTCACTGTAGTGGCGG + Intergenic
967860713 3:194149231-194149253 CTGACATTGGACTGTAGTGTTGG + Intergenic
969675548 4:8612346-8612368 CTGTCGTGTGACTGTTGTGGAGG + Intronic
973925453 4:55732810-55732832 CTGTACCCTGACTGTGGTGTTGG - Intergenic
976445624 4:85127614-85127636 CTGTGGGCTGACTGTAGAGCTGG + Intergenic
976950615 4:90825765-90825787 CTGTCACCAGACTGGAGTGTAGG + Intronic
982337534 4:154257208-154257230 CTGTCGCCAGGCTGGAGTGTGGG - Intronic
988624744 5:32861877-32861899 CTGTGGTCTGACAGTATGGTTGG + Intergenic
994118815 5:96091078-96091100 TTGCCGTCTGTTTGTAGTGTAGG + Intergenic
994409880 5:99393655-99393677 CTGTGGTCTGAGTGTATTGGTGG - Intergenic
994483940 5:100371620-100371642 CTGTGGTCTGAGTGTATTGGTGG + Intergenic
1005138243 6:22596503-22596525 CTGTCCTGTAACTGTAGGGTTGG + Intergenic
1006960455 6:37924951-37924973 CTGTTCTCTGACTGTGCTGTAGG - Intronic
1007806998 6:44457921-44457943 CTGTCTTCTGAATGCAGCGTCGG - Intergenic
1009057221 6:58351131-58351153 CTGTGGTTTAACTGTATTGTGGG - Intergenic
1009234007 6:61100435-61100457 CTGTGGTTTAACTGTATTGTGGG + Intergenic
1015777967 6:136833946-136833968 CTGTTCTCTGATTGTAGTTTGGG + Intronic
1016444731 6:144120018-144120040 CTGTCATCTGACTCTATTGAAGG - Intergenic
1017502663 6:155039679-155039701 CTTTCTTCTGACTGCATTGTTGG + Intronic
1020248950 7:6451914-6451936 CTGTCGCCAGGCTGGAGTGTAGG + Intronic
1024092496 7:45956137-45956159 CTGTGTTTTGACTGTAGTGATGG + Intergenic
1024767019 7:52671523-52671545 ATGTAGTTTGACTGTTGTGTAGG - Intergenic
1026079089 7:67201195-67201217 GTGTCGTGTGCCTGTAGTCTTGG + Intronic
1043435026 8:80229644-80229666 CTGTCGCCAGGCTGTAGTGCAGG - Intronic
1051317341 9:15855337-15855359 CTTTCGTCTGATATTAGTGTAGG + Intronic
1055893570 9:81149127-81149149 CTGGCATCTGACTGTAGTTATGG + Intergenic
1056264369 9:84881609-84881631 CTGTCATCTTACTGTAGCTTTGG + Intronic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1057030839 9:91774055-91774077 CTGTGGTCTGTCTGCACTGTGGG + Intronic
1188543889 X:31280503-31280525 CTGTCATTTGACTGCAGTGGTGG + Intronic
1190228624 X:48564313-48564335 CTGTCATCTGACTGCAGTCCTGG - Intergenic
1193306698 X:79959419-79959441 CTGTCGCCTGACTCTATTGAAGG + Intergenic
1193563948 X:83054537-83054559 CTGTAGTCTGAGGGTGGTGTTGG + Intergenic
1195212045 X:102659854-102659876 CTGTCTTCTGACTGTCATGCAGG + Intergenic
1196722654 X:118869407-118869429 CTGTCACCAGACTGGAGTGTTGG + Intergenic
1202603041 Y:26614043-26614065 CTATCGTCAGTCTGTAGTGAAGG - Intergenic