ID: 1162397151

View in Genome Browser
Species Human (GRCh38)
Location 19:10423894-10423916
Sequence AGGGTCCTCCCCCATTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 284}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162397143_1162397151 21 Left 1162397143 19:10423850-10423872 CCAAAGCTGGGACTGATGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 179
Right 1162397151 19:10423894-10423916 AGGGTCCTCCCCCATTCCCAGGG 0: 1
1: 0
2: 1
3: 33
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162397151 Original CRISPR AGGGTCCTCCCCCATTCCCA GGG Intronic
900498333 1:2987090-2987112 AGGGGCTCCCCCCATTCCCAGGG + Intergenic
900961213 1:5922007-5922029 AGGGTCATCCCCCCATCTCAGGG - Intronic
901311458 1:8272291-8272313 AGGGTCCTGCCCCATTCCTTTGG - Intergenic
901628793 1:10638474-10638496 AGGATCCTCCCCCCTGCCCAGGG - Exonic
901925777 1:12565209-12565231 AGGGTTCCTCCCCATCCCCAAGG - Intergenic
902547515 1:17199226-17199248 AGGCTTCTCCCCCATTCACCAGG + Intergenic
905394864 1:37660717-37660739 GGGGGCCGCCCCCTTTCCCAGGG - Intergenic
905494201 1:38371753-38371775 AGGGTCTTGCTCCATTGCCAAGG + Intergenic
905563494 1:38945254-38945276 AGTGACCTCACCCACTCCCATGG - Intergenic
907186216 1:52611269-52611291 AGGGTCCACTCCCATTGCCCAGG - Intergenic
907794248 1:57698961-57698983 AGGGTCCTTCTCCATTGCCCAGG + Intronic
907809668 1:57856122-57856144 AGGGGCCTCAGCCAGTCCCAGGG - Intronic
909076159 1:71053187-71053209 GGGGTCCTGCCCCATACCCAGGG - Intergenic
910368805 1:86494354-86494376 AGGAGCCTCCCCAATTCTCAGGG + Exonic
913530322 1:119729454-119729476 AGGCTCCTGCCCCCTTCCCCAGG + Intronic
916665438 1:166962664-166962686 AGGATACTCCCCTACTCCCAGGG - Intronic
917098015 1:171418898-171418920 TGGGTCCTCCCCTTTGCCCAGGG - Intergenic
917965590 1:180176505-180176527 AGGGGCCACCCCCATGCCCCAGG - Intronic
919919726 1:202160770-202160792 TGGCCCCTCACCCATTCCCAGGG - Exonic
920202887 1:204270895-204270917 CGGGTCCTCCCCCAATGCCAGGG - Intronic
920232519 1:204480089-204480111 AGGGCCCAGCCCCATTCCAAGGG + Intronic
920675232 1:208033750-208033772 AGGGGACTCCCAAATTCCCAAGG - Intronic
923511348 1:234656550-234656572 AGGGTCCTCCTCCCCTCCCCAGG + Intergenic
923777545 1:236993267-236993289 AGGGGCCTCCCCAGTTCTCAGGG + Intergenic
923788520 1:237091448-237091470 AGGGTCTTGCCCCATTGCCCAGG + Intronic
1063907879 10:10799043-10799065 ACTGTCCTCCCTCATTGCCAAGG - Intergenic
1064350047 10:14568251-14568273 AAGGTGCACTCCCATTCCCAAGG + Intronic
1064512605 10:16111574-16111596 AGGTTCCTATCCCTTTCCCAAGG - Intergenic
1065515934 10:26524254-26524276 AGCGTCCTGCCCCATACCCGGGG + Intronic
1069886600 10:71627739-71627761 AGGCTCCTTCCCCACACCCACGG + Intronic
1070773983 10:79099365-79099387 AAGGTCCTTCCCCCTCCCCATGG + Intronic
1070788426 10:79175722-79175744 AGGTTCCTCCCCACTCCCCATGG + Intronic
1070931555 10:80264666-80264688 AAGGTCCTCCCCCATTTCCCAGG + Intergenic
1071878173 10:89865388-89865410 TGGCTGCTCCCCCATCCCCAAGG - Intergenic
1075912841 10:126140883-126140905 AGGGTCACCCCCCACCCCCAGGG - Intronic
1078305665 11:10183270-10183292 AGCGTCCTCCTCCTTTCCAATGG + Intronic
1078310077 11:10231996-10232018 AGGGGCGTCCGCCATTGCCAAGG - Intronic
1080859279 11:36139261-36139283 TGGGTCTGCCCCCACTCCCAGGG - Intronic
1081159086 11:39731761-39731783 AGGGCTCTCCCCCATTCACTAGG - Intergenic
1081866213 11:46362012-46362034 AGAGTCCTCCTCCCTTCCCCAGG - Intronic
1083262863 11:61532519-61532541 AGTGACCTGCCCCATTCCCATGG - Intronic
1083323893 11:61863640-61863662 AGGGCCCGGCCTCATTCCCAGGG - Intronic
1084063876 11:66692480-66692502 TGGGTCCTCCACTCTTCCCACGG + Intronic
1084353328 11:68619399-68619421 AGGGTCTTGCCACATTCCCCAGG - Intergenic
1084492551 11:69486683-69486705 AGGAGCCTCTCCCAGTCCCAGGG + Intergenic
1088422948 11:109668808-109668830 AGGCTCCTTCCCCATGCACAAGG - Intergenic
1089105961 11:116005355-116005377 AGGGGCACCCCCCATTGCCAAGG + Intergenic
1089586431 11:119512577-119512599 ACTTTCCTCCCCCATCCCCAGGG - Intergenic
1091205578 11:133818640-133818662 AGGTTTTTCCCCAATTCCCAGGG + Intergenic
1091368077 11:135038415-135038437 TGTGTCCTACCCCACTCCCAAGG + Intergenic
1093186540 12:16026350-16026372 AGGGTCATCTCCTCTTCCCATGG + Intronic
1096895657 12:54818886-54818908 AGGGGCCTCCACCATTCCTGAGG - Intergenic
1097323059 12:58246676-58246698 GGGGTCCTGCCCCATACCCAGGG + Intergenic
1099849527 12:88074725-88074747 GGGGTCCTGCCCCATACCCTAGG + Intronic
1100247914 12:92782845-92782867 AGGGTCCTGCCTCATACCCTGGG + Intronic
1100454023 12:94734181-94734203 AGGGTGCTGCCCCAGCCCCATGG - Intergenic
1100706127 12:97202390-97202412 AGAGCCCTCCTCCATTCCCATGG - Intergenic
1101624485 12:106425517-106425539 GGTGTCCTGCCCCCTTCCCAGGG + Intronic
1102412013 12:112728253-112728275 AGGGTCCTCCCCCAGTCTAGTGG - Intronic
1102988897 12:117300646-117300668 AGGGTGATCCAACATTCCCAGGG - Intronic
1103198153 12:119064204-119064226 AGTGATCTCCCTCATTCCCAAGG + Intronic
1103713480 12:122929732-122929754 TGGTCCCTGCCCCATTCCCAGGG - Exonic
1104753489 12:131254588-131254610 GGGGTCCTCCCCCACTCACCAGG + Intergenic
1105280218 13:18958940-18958962 CAGGCCCTCCCCCATCCCCAGGG + Intergenic
1107623522 13:42258954-42258976 AGGCTCCTCCCCCGTGCACAAGG - Intergenic
1114048942 14:18903462-18903484 TGGGTCCTCCTCCACTCACATGG + Intergenic
1114113621 14:19498471-19498493 TGGGTCCTCCTCCACTCACATGG - Intergenic
1114115322 14:19616220-19616242 TGGGTCCTCCTCCACTCACATGG - Intergenic
1114380170 14:22194745-22194767 AGGGTCCTCTGGGATTCCCAGGG - Intergenic
1117172394 14:53114037-53114059 AGGGGCGTCCACCATTACCAAGG + Intronic
1118001538 14:61527780-61527802 AGCCTCCTCCACCATACCCAGGG + Intronic
1118575808 14:67240680-67240702 TGAGTCCTGCCCCATTCCAAGGG + Intergenic
1118730404 14:68662013-68662035 AGTCCCCTCCCCCATCCCCATGG + Intronic
1119507485 14:75185460-75185482 AGGGTCCTTCCCTATTCCCTGGG + Intergenic
1119599927 14:75968734-75968756 AAGATCCTGCCCCAGTCCCAAGG - Intronic
1121817917 14:96942598-96942620 AAAGTCCTCCCCCAGTCCCCAGG - Intergenic
1121865363 14:97357814-97357836 AGAGTCTTCCCTCATTCCCAAGG - Intergenic
1121886820 14:97550665-97550687 AGAGTCATCCCACATTCCCTGGG - Intergenic
1122284123 14:100640737-100640759 AGGGTCCTGGCCGCTTCCCAGGG + Intergenic
1122691937 14:103535653-103535675 AGGGACCTCCTCCATGCCCTTGG - Exonic
1126413915 15:48398395-48398417 AGGGTCTTCCTCCATCCCCCCGG + Intergenic
1126804978 15:52339092-52339114 ACCCTCCTCCCTCATTCCCATGG + Intronic
1127718277 15:61673487-61673509 AAGATCATACCCCATTCCCAGGG + Intergenic
1128935891 15:71746418-71746440 AGGGTCCTACTCCATTGCCCAGG + Intronic
1130878916 15:88038289-88038311 AGACTCTTGCCCCATTCCCAAGG + Intronic
1132610432 16:813387-813409 TGGGTCCACCCCGACTCCCATGG + Exonic
1132835983 16:1953814-1953836 AGCGTCCACCCCAATTCCCGGGG + Intronic
1132864276 16:2085898-2085920 AGGGGCCTACCCCACTCCCACGG - Intronic
1133942062 16:10317477-10317499 AGGGTCCTCCTCCATTGCTAAGG - Intergenic
1134056173 16:11171103-11171125 AGTGTCCTCCCCCCTGCCCACGG - Intronic
1135091605 16:19522184-19522206 TGGGCCCTCCCCCGTTGCCATGG - Intergenic
1139581541 16:67876789-67876811 TGTGTCCTCTCCCATCCCCAGGG + Intronic
1141569479 16:84925552-84925574 AGGGTCCCGCCCCCATCCCAGGG + Intergenic
1142759651 17:2035190-2035212 GGGGTTCTCCTCCATTCCTAGGG + Intronic
1143476259 17:7205341-7205363 AGGGGCTTCCCCAATTGCCAGGG + Intronic
1144941685 17:18946597-18946619 AGGGTCCTGCCCCACACCCTGGG - Intergenic
1145248917 17:21286843-21286865 AGGGACCTCCCTCAGGCCCAGGG + Intronic
1145905200 17:28512488-28512510 ACGGTGCTCACCTATTCCCAGGG - Intronic
1147915597 17:43883418-43883440 AGGGTCCTCCCTCAGCCCCCAGG + Intronic
1148440682 17:47710316-47710338 AGTGTCCACCCCCCTGCCCAGGG - Intronic
1149268282 17:54951414-54951436 AGGGTCCTGCCCTATACCCTGGG - Intronic
1149932446 17:60769560-60769582 GGGGCCCTCCCCCTTCCCCACGG - Intronic
1150425182 17:65071965-65071987 AGGCTCCTGCCCACTTCCCATGG - Intergenic
1151286192 17:73113363-73113385 AGGGTCCTCCTCCAAGCCCCTGG + Intergenic
1151531282 17:74706753-74706775 GTGGTCCTCACCCCTTCCCAGGG - Intronic
1153963668 18:10161168-10161190 AGGGGACTCCCCCCTCCCCAAGG - Intergenic
1155121619 18:22826620-22826642 AGAGTCCTCCCTCCTACCCAGGG + Intronic
1156921588 18:42529148-42529170 AAAGTCCTCCCCCATTCCCCAGG + Intergenic
1157632072 18:49108094-49108116 AGGGGCATCCGCCATTGCCAAGG - Intronic
1157777834 18:50410155-50410177 AGGCTCCTCCCACCTGCCCATGG + Intergenic
1157957375 18:52113407-52113429 ATGACCCTCCCCCTTTCCCAAGG - Intergenic
1158760026 18:60373899-60373921 AAGGTCCTACCCAATTCCAAAGG - Intergenic
1158942991 18:62423325-62423347 AGGGTCCAAACCCATTTCCATGG - Intergenic
1160665818 19:327687-327709 AGGGTCCAGCCCCATGCCCATGG + Intronic
1160704159 19:521826-521848 AGGGTCCTGCCCTATACCCCTGG - Intergenic
1160832902 19:1111788-1111810 TGGGTCCTCCCCCAGACCCCTGG + Intronic
1160983865 19:1828546-1828568 CGGCTCCTCCCCCAGGCCCAGGG + Exonic
1161143158 19:2660763-2660785 AGGGTCTTCCTCCATTGCCCAGG - Intronic
1161157717 19:2741823-2741845 AGGGTCCTGCCCCATCACCCAGG + Intergenic
1161241704 19:3226642-3226664 TGTGGACTCCCCCATTCCCACGG - Intronic
1161469230 19:4448027-4448049 AGGGTCCCACCCCACTCCCCGGG - Intronic
1161628045 19:5338406-5338428 AGGGTCCTGCCCTGTTCCCCAGG - Intronic
1162397151 19:10423894-10423916 AGGGTCCTCCCCCATTCCCAGGG + Intronic
1162917348 19:13881530-13881552 AGAGCCCACCCCCATCCCCAGGG - Intergenic
1162918246 19:13885620-13885642 TGGGTCCCCTCCCCTTCCCAGGG + Intronic
1164753547 19:30673079-30673101 GGAGTCCTCACCCATTCCCCTGG - Intronic
1165393294 19:35550427-35550449 ACTCCCCTCCCCCATTCCCAAGG - Exonic
1166432699 19:42740619-42740641 AGAGGCCTCCACAATTCCCAGGG - Intronic
1166435807 19:42765816-42765838 AGAGGCCTCCACAATTCCCAGGG - Intronic
1166445679 19:42855857-42855879 AGAGGCCTCCACAATTCCCAGGG - Intronic
1166453078 19:42918030-42918052 AGAGGCCTCCACAATTCCCAGGG - Intronic
1166465353 19:43026611-43026633 AGAGGCCTCCACAATTCCCAGGG - Intronic
1166482624 19:43186642-43186664 AGAGGCCTCCACAATTCCCAGGG - Intronic
1166485105 19:43205771-43205793 AGAGGCCTCCACAATTCCCAGGG - Exonic
1166934520 19:46323006-46323028 AGGGTCCTGCCCGATACCCTGGG - Intronic
1166969497 19:46555289-46555311 AGGGTCTTGCTCCATTCCCCAGG - Intronic
1166979034 19:46621910-46621932 AGGGTCCTCCCAGCTTCCAAGGG - Intronic
1167606287 19:50482505-50482527 AGGGGCTTCCCCCCTGCCCATGG + Exonic
1168651560 19:58095636-58095658 AGGGTCCTCGGCCATTGGCAGGG + Intronic
926921160 2:17941437-17941459 AGGGTCCTTCCCTATTCCTCTGG - Intronic
927298063 2:21477638-21477660 AGGGTCTTGCTCCATTGCCAAGG - Intergenic
927949814 2:27159692-27159714 AGGCGCCTACCACATTCCCAAGG - Intergenic
929597405 2:43185046-43185068 AGGGTTCTCCCACAGCCCCAGGG + Intergenic
929707263 2:44226997-44227019 AGGGTCTTCCTCCATTGCCCAGG + Intronic
930144334 2:47985965-47985987 AGGGGCTTCCCCCCTTCCCTGGG - Intergenic
933725803 2:85426493-85426515 AGGGTCCTGCCCCATACTCTGGG + Intronic
933741092 2:85534428-85534450 AGGGTCCTACCCCATACCCTGGG - Intergenic
933780776 2:85799451-85799473 AGGTGCCTCCCCCACCCCCAGGG - Intergenic
934037428 2:88099956-88099978 TGGCTCCTCCCCCTTTCCTATGG + Intronic
935561904 2:104568172-104568194 AGGGTTCTCGGCCATACCCAAGG + Intergenic
935718394 2:105958916-105958938 AGGGTCTTGCCCCATTGCCCAGG + Intergenic
935914875 2:107938368-107938390 GAGGTCCTGCCCCATCCCCAGGG - Intergenic
936152828 2:110030987-110031009 AGGGCCCTCCCGCAGTCACATGG + Intergenic
936191852 2:110340425-110340447 AGGGCCCTCCCGCAGTCACATGG - Intergenic
936293766 2:111249126-111249148 AGGGTCCTCTGCCTTTCTCAGGG - Intergenic
937235964 2:120432184-120432206 AGGGACTTCACTCATTCCCACGG - Intergenic
937450441 2:121998203-121998225 AGTGCCCACTCCCATTCCCATGG - Intergenic
937707267 2:124935620-124935642 AGGGCCCTGTCCCATTCCCCAGG - Intergenic
938426256 2:131191718-131191740 TGGGTCCTCCTCCACTCACATGG + Intronic
941930046 2:170929668-170929690 AAGGTTGTCCCCCCTTCCCAGGG - Intronic
942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG + Intergenic
943081996 2:183267023-183267045 GGGGTCCCGCCCCATACCCAGGG - Intergenic
945439834 2:209865068-209865090 AGTGTCCTCCCCCAAGCCAAGGG - Intronic
946217340 2:218194750-218194772 AGGGTCTTCCCCGACTCACATGG + Intergenic
946414854 2:219534913-219534935 AGGACCCCCCCCCAGTCCCAGGG + Intronic
948268588 2:236656811-236656833 AGGGTCCTACTCTGTTCCCATGG + Intergenic
948769340 2:240240547-240240569 ATGTTCCTCCCCCATCCCCTAGG + Intergenic
948915081 2:241030337-241030359 AGTGGCCTTCCCCATTGCCAAGG + Exonic
1169334486 20:4744373-4744395 AGGGTCTCCCCCCATTGCCCAGG - Intergenic
1169648684 20:7842825-7842847 AGGGTCCTGCCCCATATCCAGGG + Intergenic
1169883193 20:10369487-10369509 AGGGTCTTGCCCCATTGCCCGGG - Intergenic
1171507971 20:25654528-25654550 AGGGTCCTGCTCCATTACCCAGG - Intergenic
1172625592 20:36344847-36344869 AGGGTCCCCCCTCCTTCCCTAGG + Intronic
1172800721 20:37574381-37574403 AGAGCCCTCCCCCACTGCCAGGG - Intergenic
1173348446 20:42222544-42222566 AGGGTCCCACCTCATACCCAGGG + Intronic
1173688168 20:44938558-44938580 AGGATCCTCCTCCATCCACAGGG - Intronic
1175415324 20:58797098-58797120 AGGGCCCACCCTCATTCCCGAGG + Intergenic
1177479981 21:21674314-21674336 AGAGTCCACCCACATTCCCTAGG + Intergenic
1178904756 21:36627261-36627283 AGGGTCCTGTCCCATCTCCATGG - Intergenic
1179475348 21:41639712-41639734 AGTGCCCTGCCCCATTCACAGGG - Intergenic
1180467426 22:15625846-15625868 TGGGTCCTCCTCCACTCACATGG + Intergenic
1184847447 22:47097958-47097980 AGGGGCCCCCACCACTCCCAGGG - Intronic
1184847484 22:47098277-47098299 AGAGTCCTACCCTTTTCCCAGGG + Intronic
1185139419 22:49092110-49092132 AGGGTCCTCCCCCAGACCTGGGG + Intergenic
1185251999 22:49807427-49807449 AGGGTTCTCTGCTATTCCCATGG - Intronic
950071287 3:10154923-10154945 AAGGTCCTACCCCATACCCTGGG + Intergenic
950410951 3:12836555-12836577 AAGGTTCTCCCCCAGTCACAGGG + Intronic
950424607 3:12918287-12918309 AGGAGCCTCCCCACTTCCCATGG - Intronic
950773855 3:15332988-15333010 CGGAACCTCCGCCATTCCCAAGG - Intronic
950917244 3:16658378-16658400 GGGGTCCTCCCACTTTCCAAGGG - Intronic
950930607 3:16785159-16785181 AGGGTCCTGCCCCATACCCTGGG - Intergenic
951233747 3:20210810-20210832 AGTGTCCTCAACCAATCCCATGG - Intergenic
951741680 3:25931786-25931808 AGGGGACTCCACCATTACCAAGG + Intergenic
951972434 3:28462237-28462259 AGGGTACTGCCACATGCCCAGGG - Intronic
953797637 3:45997588-45997610 AGGGTCCTCCCCTATACCCTGGG - Intergenic
954434687 3:50489796-50489818 AGGCTCCCCTGCCATTCCCATGG - Intronic
955320057 3:57968022-57968044 AGGGTCCTGCCCCATACTCTGGG + Intergenic
955420102 3:58727268-58727290 TGGGCCCTCCCCCTTTCCCCAGG - Intronic
956014493 3:64867349-64867371 AGTGTCCTGCCCTATACCCAGGG - Intergenic
957550514 3:81697710-81697732 AGGGTCCTGCCTCATACCCTGGG - Intronic
960507928 3:118515574-118515596 AAGATCCTACCCCATACCCAGGG + Intergenic
960507963 3:118515875-118515897 AGGTTCCTCACCCATTGCAAGGG - Intergenic
962709984 3:138078058-138078080 AGGGTCCTCCCCCAGACTTATGG - Intronic
962816273 3:139004101-139004123 ACTCTTCTCCCCCATTCCCAGGG - Intergenic
963282945 3:143404722-143404744 AGCCTCCTCCCCCATACCCATGG + Intronic
964528113 3:157637148-157637170 AGAGTTCTTCCCCATACCCAGGG - Intronic
964806961 3:160620854-160620876 AGGTTCAACCCTCATTCCCAAGG + Intergenic
966309417 3:178576659-178576681 AGGGGCATCCACCATTACCAAGG + Intronic
967090668 3:186132432-186132454 AGAGTCCTCGCCCAGTCCCGAGG + Intronic
967933221 3:194705778-194705800 CCGGTCCTGCCCCATTCCCACGG + Intergenic
968188367 3:196649438-196649460 AGAGCCCTCCCCCAGACCCAGGG + Intronic
969877382 4:10145798-10145820 TGGGTTCCTCCCCATTCCCATGG + Intergenic
970692585 4:18636621-18636643 AGTGTCCATGCCCATTCCCAGGG + Intergenic
973822098 4:54670782-54670804 GGGGTCCTGCCCCATCCCCAGGG + Intronic
974222794 4:58997919-58997941 AGGCTCCTCCTCCCTTCACAAGG - Intergenic
975638795 4:76478294-76478316 AGGGGCATCCGCCATTACCAAGG + Intronic
977046640 4:92076590-92076612 AGGGTCTTCCCCCATATCCTAGG + Intergenic
977578146 4:98696492-98696514 AGGGAACTTCTCCATTCCCAGGG - Intergenic
978191436 4:105917290-105917312 AGGCCCTTCACCCATTCCCATGG + Intronic
978227333 4:106353032-106353054 AGGGTCCTGCCCCATACCCAGGG - Intergenic
978805068 4:112791183-112791205 AGGGTCCTCCCTGCTTCACAAGG - Intergenic
978829932 4:113071941-113071963 AGGGGCATCCCCCTTTCACAGGG - Intronic
979507495 4:121514729-121514751 AGGCTCCTCCCCCATGCAAATGG - Intergenic
982084432 4:151819425-151819447 AGGGTCCAGCCCCATACCCTGGG + Intergenic
982398195 4:154936778-154936800 AGGCTCCAACCCCATACCCATGG - Intergenic
983044515 4:162969686-162969708 AGGGGCGTCCCCCATTACTAAGG - Intergenic
985531886 5:438662-438684 TGGGCCCTTCCCCCTTCCCATGG - Intergenic
986284193 5:6347866-6347888 AGGGTCCCACCGCATTCCCTGGG - Intergenic
988804993 5:34732047-34732069 AGGGGCCACTCCCATTTCCAGGG - Intronic
990031281 5:51262440-51262462 AGAGTCCTGCTCCATACCCAGGG - Intergenic
990226937 5:53665514-53665536 AGGGGCGTCCGCCATTGCCAAGG - Intronic
990614581 5:57494573-57494595 CTGGGCCTCCCCCACTCCCATGG - Intergenic
991946477 5:71902759-71902781 AGAGTTCTCCACCATTCCTAGGG + Intergenic
992113466 5:73517359-73517381 AGGGTCCTGCTCCATTCCCCAGG + Intergenic
997750778 5:136343453-136343475 AGGGTCCTTCCCTATTCCTTGGG + Intronic
999064993 5:148676114-148676136 AGGCTCCTCCCCCATCCAAATGG + Intronic
1000105139 5:158052454-158052476 AGGGACCCTCCCCATTCCCAAGG - Intergenic
1000556464 5:162732480-162732502 AGGCTCCTCCCCCTTGCACAAGG + Intergenic
1001932910 5:175685931-175685953 AGCTGCCACCCCCATTCCCAGGG + Exonic
1002027350 5:176404603-176404625 GGTGTCCTGCCCCAGTCCCAAGG + Intronic
1002301978 5:178262514-178262536 AGGGTCCCCCCCCAGTCAAATGG - Intronic
1002349040 5:178569868-178569890 AGGGTCCTCATCCCTTCCAAGGG + Intronic
1006589000 6:35140923-35140945 AGGGGCCTCCCCAATTGCCAAGG + Intronic
1006787707 6:36679390-36679412 CGGGTCCTGGCACATTCCCAAGG - Intronic
1007818465 6:44541886-44541908 AGGGTCCTCCCTCTCTCCCTGGG - Intergenic
1007973340 6:46075374-46075396 AGGGTCTTGCCCCGTTGCCAGGG - Intronic
1010471498 6:76233704-76233726 AGGCTCCTCCCCTAATGCCATGG - Intergenic
1011061829 6:83278648-83278670 AGGGTCCTCCTACATTGCCCAGG + Intronic
1013089706 6:106888940-106888962 GGGGTCCTGCCCCATATCCAGGG + Intergenic
1015999435 6:139028670-139028692 AGGGGCCGCCCACACTCCCAGGG - Exonic
1016810413 6:148255661-148255683 AGGGTCTTTCCCCATTGCCCAGG + Intergenic
1016939885 6:149474947-149474969 AGTGACCTCCCAAATTCCCATGG + Intronic
1017055046 6:150429311-150429333 AGCTTCCTTCCCCATTTCCAGGG - Intergenic
1018957643 6:168420871-168420893 AGGGACCTCCCCCTTGCACATGG + Intergenic
1019082519 6:169444788-169444810 AGGGGCCTCTGTCATTCCCAGGG + Intergenic
1019348309 7:541318-541340 AGCCCCCTCCCCCACTCCCAGGG + Intergenic
1020013355 7:4818015-4818037 AGGGTCCTGGCCCCTTCCCCAGG - Intronic
1022504761 7:30903144-30903166 AGGGTCCTTCCCCAAGCCCTTGG - Intergenic
1022787539 7:33653339-33653361 TCGGTCCTGCCCCATCCCCAGGG - Intergenic
1024558326 7:50622672-50622694 AGGTGCCCCCCACATTCCCAGGG + Intronic
1024971823 7:55078364-55078386 AGGCTCCAGCCCCATCCCCAGGG + Intronic
1026624642 7:71981323-71981345 AGGGTCCTCCCCTATACCCTGGG + Intronic
1027786484 7:82585372-82585394 AGGGTAATTCCCTATTCCCAAGG - Intergenic
1030271900 7:107677629-107677651 AGGGTCTTGCCCCATTGCCTGGG + Intronic
1034376444 7:150649065-150649087 AAGGTCATCTCCCATTCCCAGGG - Intergenic
1034552879 7:151832543-151832565 GGGGTTCTCCCCCCTTCCCCTGG + Intronic
1035618623 8:1021703-1021725 TGGGTCCCCCACCTTTCCCAGGG - Intergenic
1035881035 8:3244371-3244393 CGTGTCCTCCCCCATTACCCTGG + Intronic
1036489871 8:9214996-9215018 AGGGACCTTCCCCAAACCCAGGG - Intergenic
1036571085 8:9980328-9980350 AAGGGCCTCCCCCATCCCGAGGG + Intergenic
1038848967 8:31255576-31255598 AGGGTCCTTCCTCATACCCCAGG - Intergenic
1039567886 8:38564335-38564357 GGGGTGCTCCCCCATGCCTAGGG + Intergenic
1039886646 8:41658073-41658095 AGGGTCCTACCACATTGCCCAGG + Intronic
1040736393 8:50513604-50513626 AGGGGCATCCGCCATTGCCAAGG - Intronic
1041771177 8:61474038-61474060 AGAGTTCTCCTCCATTCCCATGG - Intronic
1042149573 8:65767593-65767615 AGGGTCTTGCCCCATACCCTGGG + Intronic
1042450933 8:68944780-68944802 AGGGTCTTGCCACATTGCCAAGG + Intergenic
1045486011 8:102632444-102632466 AGGGTCTCACCCCATTCCAAGGG + Intergenic
1047969425 8:130072081-130072103 AGGGTCCTACCCTATACCCTGGG + Intronic
1047979508 8:130166045-130166067 AGGGTCTTCCTCCATTGCCCAGG + Intronic
1048542564 8:135355698-135355720 GGGGTCCTGCCTCATACCCAGGG + Intergenic
1049455577 8:142684652-142684674 AGGTTCCTGCCCCATCCTCATGG - Intergenic
1049637187 8:143695339-143695361 AGTGTCCCGACCCATTCCCACGG - Exonic
1050056281 9:1659085-1659107 AGTCTCTTCTCCCATTCCCATGG - Intergenic
1051571482 9:18563835-18563857 AGGGGCGTCCACCATTACCAAGG - Intronic
1053050546 9:34958025-34958047 GCCGTCCTCCCGCATTCCCACGG + Intronic
1053055592 9:34991556-34991578 AGGGTTCTTTCCCAGTCCCAGGG + Intronic
1053351636 9:37417207-37417229 AGGGACCACTCCCATTCCCAGGG + Intergenic
1053538854 9:38952638-38952660 GGAGCCCTGCCCCATTCCCAGGG - Intergenic
1054627286 9:67411281-67411303 GGAGCCCTGCCCCATTCCCAGGG + Intergenic
1055106645 9:72520105-72520127 ATAGTCCTCCCTCATTTCCAAGG - Intergenic
1056329159 9:85507662-85507684 AAGCTCCTCCCCAAATCCCAAGG - Intergenic
1057021097 9:91698158-91698180 AGGGTCCTGCCCCCTACCCTGGG + Intronic
1057272680 9:93659631-93659653 TGGGCCCTCCCCAATCCCCAGGG - Intronic
1057827455 9:98381900-98381922 AGGGACATCCCCCACACCCAGGG - Intronic
1060187828 9:121574756-121574778 AGGGCCCTTTCCCATGCCCAGGG + Intronic
1061043373 9:128152027-128152049 TGGGTCCTCTCCCATCCCCTCGG + Intronic
1061188870 9:129070485-129070507 AGGCTCCTCCTCCCTTCCCTGGG + Exonic
1062393275 9:136342505-136342527 AGGGTCCTCCTCCCCGCCCAGGG + Intronic
1062480638 9:136749266-136749288 AGGGTCCTCCCCCAGTGCCGTGG + Intergenic
1187195211 X:17077300-17077322 AGGGTCCTCGCCCCTTTTCATGG - Exonic
1187200404 X:17128734-17128756 TGGGTCTTCGACCATTCCCATGG - Intronic
1187500224 X:19833182-19833204 ACAGTCCTCCCTCCTTCCCAGGG + Intronic
1187547469 X:20267322-20267344 ACTGTTCTCCCTCATTCCCAAGG - Intergenic
1188524593 X:31075349-31075371 AGGTTCCTACCTCTTTCCCAGGG - Intergenic
1189285905 X:39852314-39852336 AGGCTCCTTCCCCATTCTCTTGG - Intergenic
1189332791 X:40153603-40153625 AGGGTTTTCCCCCTTTCCCCTGG + Intronic
1191104217 X:56762419-56762441 AGGGACATCCCCCATTACCAAGG - Intergenic
1193003645 X:76591246-76591268 AGGGTCATCCCCCATTGCTGAGG - Intergenic
1193071895 X:77314986-77315008 AGGGTCATCCACCATTACCAAGG + Intergenic
1194963572 X:100262611-100262633 AGGATTCTACCCCATACCCAGGG + Intergenic
1195261041 X:103131834-103131856 AGGGGCATCCTCCATTGCCAAGG + Intergenic
1195281492 X:103338846-103338868 TTGATCCTCCCCCAATCCCACGG + Intergenic
1195954621 X:110317031-110317053 AGAAACCTCCCCCCTTCCCAGGG + Intronic
1196744186 X:119054598-119054620 AGCTTCCACTCCCATTCCCATGG - Intergenic
1197350127 X:125372573-125372595 AGGGTCGTCCCCCATTACTGAGG - Intergenic
1199377200 X:147127123-147127145 AGGGGCATCCACCATTACCAAGG + Intergenic
1200130828 X:153844242-153844264 AGGGTCTCCCTCCATTGCCAGGG - Intergenic
1201795253 Y:17889982-17890004 AGGGGCGTCCACCATTGCCAAGG + Intergenic