ID: 1162397831

View in Genome Browser
Species Human (GRCh38)
Location 19:10427730-10427752
Sequence TACTAGGCCCATTTCAGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 336}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162397831_1162397833 -5 Left 1162397831 19:10427730-10427752 CCGTCTCTGAAATGGGCCTAGTA 0: 1
1: 0
2: 2
3: 48
4: 336
Right 1162397833 19:10427748-10427770 TAGTAAAAACCGTATTCCCAAGG 0: 1
1: 0
2: 0
3: 7
4: 91
1162397831_1162397838 13 Left 1162397831 19:10427730-10427752 CCGTCTCTGAAATGGGCCTAGTA 0: 1
1: 0
2: 2
3: 48
4: 336
Right 1162397838 19:10427766-10427788 CAAGGGCTGATCTGACGAACTGG 0: 1
1: 0
2: 0
3: 3
4: 62
1162397831_1162397840 28 Left 1162397831 19:10427730-10427752 CCGTCTCTGAAATGGGCCTAGTA 0: 1
1: 0
2: 2
3: 48
4: 336
Right 1162397840 19:10427781-10427803 CGAACTGGCAAAACAATTCAGGG 0: 1
1: 0
2: 0
3: 11
4: 81
1162397831_1162397839 27 Left 1162397831 19:10427730-10427752 CCGTCTCTGAAATGGGCCTAGTA 0: 1
1: 0
2: 2
3: 48
4: 336
Right 1162397839 19:10427780-10427802 ACGAACTGGCAAAACAATTCAGG 0: 1
1: 0
2: 0
3: 30
4: 336
1162397831_1162397834 -4 Left 1162397831 19:10427730-10427752 CCGTCTCTGAAATGGGCCTAGTA 0: 1
1: 0
2: 2
3: 48
4: 336
Right 1162397834 19:10427749-10427771 AGTAAAAACCGTATTCCCAAGGG 0: 1
1: 0
2: 1
3: 8
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162397831 Original CRISPR TACTAGGCCCATTTCAGAGA CGG (reversed) Intronic
900705201 1:4076159-4076181 TCCCATGCCCATTTCAGAGATGG - Intergenic
901055618 1:6447571-6447593 AACTAGGCCCAGCTCAGTGAGGG - Intronic
902478770 1:16701066-16701088 AACTAGGCCCAGCTCAGTGAGGG + Intergenic
902552093 1:17225218-17225240 TACTTTCCCCATTTCACAGAAGG - Intronic
902797719 1:18810197-18810219 TATTATTCCCATTTCACAGAGGG - Intergenic
903202141 1:21750150-21750172 CACAAGGGCCATATCAGAGAGGG - Intronic
903335653 1:22622560-22622582 TACTATGTCCATTTCATAGACGG + Intergenic
903705055 1:25279573-25279595 TATTATCCCCATTTTAGAGATGG - Intronic
903722173 1:25413748-25413770 TATTATCCCCATTTTAGAGAGGG + Intronic
904340975 1:29834318-29834340 TACTGTGCCCATTTCACAGAGGG - Intergenic
904499607 1:30906677-30906699 CATTAGCCCCATTTCACAGAGGG + Intronic
904790605 1:33017587-33017609 TACAAGGCTCATTCCACAGAAGG + Intronic
904817831 1:33219216-33219238 CACTGGACCCATTTCACAGATGG - Intergenic
904827998 1:33288138-33288160 TATTATCCCCATTTTAGAGAGGG + Intronic
905221026 1:36447643-36447665 TACTATCCCCATTTTACAGATGG - Intronic
905318990 1:37102338-37102360 TACTGTCCACATTTCAGAGATGG + Intergenic
905873311 1:41416982-41417004 CATTAGACCCATTTCACAGATGG - Intergenic
906384020 1:45351809-45351831 TCCTGGGCCTATTTCAGGGAAGG - Intronic
908054118 1:60264630-60264652 TACTATACCCATTTAACAGATGG - Intergenic
908872830 1:68634249-68634271 TATTTGGCCCTTTTCAGAAAAGG - Intergenic
909864969 1:80656218-80656240 TTCTAGGGATATTTCAGAGATGG - Intergenic
909932949 1:81519044-81519066 TATTAGGCCCATTTTACAGATGG + Intronic
909968287 1:81946444-81946466 TCCTAAGGCCATTCCAGAGAGGG - Intronic
910479612 1:87644092-87644114 TACTAGGTTCATTTCACAGAAGG + Intergenic
911855911 1:102874371-102874393 TACTAGCTACATTTCAGAAAGGG + Intergenic
912563230 1:110565354-110565376 TATTAGGTCCACTTCAGAGGTGG + Intergenic
912563458 1:110566775-110566797 TACTGTGCGCAGTTCAGAGATGG - Intergenic
913438109 1:118868282-118868304 TACTAGCCCCATTTTGAAGAAGG - Intergenic
916786392 1:168090109-168090131 TAGTACCCCCATTTCACAGATGG + Intronic
916887800 1:169086991-169087013 TATTATGCACATTTCACAGATGG - Intergenic
917256510 1:173121987-173122009 CATTATCCCCATTTCAGAGATGG + Intergenic
918309748 1:183277148-183277170 TATTAGGCTCATTTCAGGGATGG + Intronic
920802274 1:209200530-209200552 TACTACTCCCATTTTACAGATGG - Intergenic
920959032 1:210647885-210647907 TAGTAGGTACATTTCAGAGTGGG + Intronic
921273701 1:213495622-213495644 TAATATGCCCATTTTACAGATGG + Intergenic
922946306 1:229518626-229518648 TTCTAGGTCCACTTCAGACATGG - Intronic
923657813 1:235933451-235933473 TATTAGTCGCATTTCACAGATGG + Intergenic
1064316701 10:14264163-14264185 CATTATGCCCAGTTCAGAGATGG + Intronic
1064981010 10:21166661-21166683 TACTGTGCCCATTTGACAGATGG + Intronic
1065438422 10:25724944-25724966 TAATAGCCCCATTCCAGAGAGGG + Intergenic
1065918185 10:30369250-30369272 TACTATTCCCATTTTACAGATGG + Intronic
1066842157 10:39937989-39938011 TTCTAGGCCCATGGCAGAAAAGG + Intergenic
1066850591 10:40104672-40104694 TACTAGGCCTATGGCAGAAAAGG + Intergenic
1066896629 10:41016589-41016611 TACTAGGCCTATGGCAGAAAAGG + Intergenic
1066906381 10:41208464-41208486 TACTAGGCCTATGGCAGAAAAGG + Intergenic
1066914185 10:41361323-41361345 TACTAGGCCTATGGCAGAAAAGG + Intergenic
1067429741 10:46235123-46235145 TGCTGGACCCATTTGAGAGATGG - Intergenic
1067443913 10:46328802-46328824 TGCTGGGCCCATTTAAGAGATGG + Intronic
1069990405 10:72311785-72311807 TACTAGTCCCATTTTACAGATGG - Intergenic
1071288798 10:84173282-84173304 TCCTGTGCCCATTTCACAGATGG + Intergenic
1073288478 10:102402082-102402104 CTCTAGGCCCATGTCAGACAGGG - Exonic
1074616134 10:115070176-115070198 TATTATTCCCATTTCACAGAGGG + Intergenic
1074834918 10:117281673-117281695 TATTATTCCCATTTTAGAGATGG + Exonic
1074961429 10:118449329-118449351 TACCATTCCCATTTCAGAGCTGG - Intergenic
1074980081 10:118612388-118612410 TACTATGCCCATTTTAGAGCTGG - Intergenic
1075502143 10:122984875-122984897 TACTATCCCCATTTTATAGATGG + Intronic
1075614270 10:123880155-123880177 TCCTAGGCCCTGTTCAGGGAGGG - Intronic
1075732964 10:124647230-124647252 TACTAGACCCATTTCATAAATGG + Intronic
1077482195 11:2820985-2821007 TTCTAGGCCCATCTAAGCGAGGG + Intronic
1077631949 11:3816967-3816989 TATTATTCCCATTTCACAGAAGG - Intronic
1080402859 11:31953714-31953736 TACTGGACCCTTTCCAGAGATGG - Intronic
1081575940 11:44318578-44318600 TATTATCCCCATTTCACAGAAGG - Intergenic
1081673724 11:44956304-44956326 TACTAGTCCCATTTTATAGATGG + Intergenic
1082803883 11:57434319-57434341 TATTATCCCCAATTCAGAGAAGG - Intergenic
1083107525 11:60373008-60373030 TAAGATGCCCATTCCAGAGATGG - Intronic
1083756263 11:64793311-64793333 CACACGGCCCATTTCACAGATGG + Intronic
1083902182 11:65649011-65649033 TATTATCCCCATTTCACAGATGG + Intronic
1085082869 11:73648353-73648375 TATTATTCCTATTTCAGAGATGG - Intronic
1085340719 11:75729594-75729616 TACTATCCCCATTTCATTGATGG + Intronic
1085788284 11:79474173-79474195 TCCTAGGCCCAAATCACAGAAGG + Intergenic
1086346635 11:85903690-85903712 AACTAGGACCATGGCAGAGAAGG - Intronic
1086879892 11:92140796-92140818 TATTAGCCCCATTTTACAGAGGG + Intergenic
1087519106 11:99206954-99206976 TACTACATCCATTTCATAGATGG - Intronic
1089973331 11:122711751-122711773 TAGTATTCCCATTTTAGAGATGG - Intronic
1090835496 11:130450431-130450453 TTCCAGGCCCAGTACAGAGAGGG - Intronic
1090946213 11:131431713-131431735 TTCTATGCCCATTTCACAGATGG + Intronic
1091302844 11:134518623-134518645 TATTATTTCCATTTCAGAGATGG + Intergenic
1091390823 12:125254-125276 TACTGTGCCCATTTTATAGATGG + Intronic
1091407257 12:216941-216963 TATTAGCCCCATTTTACAGACGG + Intergenic
1091621720 12:2094091-2094113 TATTAGCCCCATTTCACAGGTGG + Intronic
1091736641 12:2927834-2927856 TTCAAGGACCATTTCAGTGAGGG + Intronic
1093851614 12:24046181-24046203 TAATAGACACATTTAAGAGAGGG + Intergenic
1098576263 12:72046569-72046591 TACCAGGACGATGTCAGAGAAGG - Intronic
1098980590 12:76951673-76951695 TACTATGCCCATTTTATAGAGGG + Intergenic
1100302745 12:93323181-93323203 TACTATGCTCATTACACAGAGGG + Intergenic
1100593845 12:96054894-96054916 TACTATTCCCATTTTACAGATGG + Intergenic
1100882595 12:99035318-99035340 TAATACCCCCATTCCAGAGAGGG + Intronic
1101317600 12:103643683-103643705 TATTAGCCCCATTTTAGATAAGG - Intronic
1101324584 12:103703900-103703922 TACTATCCCCATTTTACAGATGG + Intronic
1101422756 12:104562960-104562982 TACCATACCCATTTCACAGATGG - Intronic
1102213912 12:111146819-111146841 TATTATGCCCATTTTACAGAAGG - Intronic
1102258100 12:111427890-111427912 CATTAGGCCCATTTCACAGATGG + Intronic
1102467282 12:113137260-113137282 TGCTAGGTCCATTTCCCAGATGG - Intergenic
1102708670 12:114905868-114905890 TATTAAGCCCATTTTACAGATGG - Intergenic
1102860751 12:116334425-116334447 TCCTAGTCCCATTTCACAGATGG + Intergenic
1103042419 12:117706374-117706396 TACCAACCCCATTTCACAGATGG + Intronic
1103242019 12:119421630-119421652 CATTAGTCCCATTTCACAGATGG + Intronic
1103249543 12:119487697-119487719 TATTATGCACATTTTAGAGAAGG - Intronic
1104003318 12:124874371-124874393 TATTAGCCCCATTTTACAGATGG - Intronic
1104370032 12:128216257-128216279 CACTATGCCCATTTCACAGAGGG - Intergenic
1104505576 12:129328900-129328922 TATTATCCCCATTTCACAGATGG - Intronic
1105285824 13:19002652-19002674 TACTAGGCCTTTGTCAGATAGGG + Intergenic
1106882468 13:34146902-34146924 TATTATTCCCATTTCACAGAAGG + Intergenic
1107117072 13:36758577-36758599 TGATAAGCCCACTTCAGAGAAGG + Intergenic
1108042961 13:46356514-46356536 TACTAGTTACATTTCAGAGAAGG + Intronic
1111914356 13:94345555-94345577 CACTATGCCCCTTTTAGAGAAGG - Intronic
1112445582 13:99461537-99461559 AAATAGGCCTATTTCAGAGAAGG + Intergenic
1115514146 14:34168324-34168346 TACCAGGCCTATTTGAGAAAGGG - Intronic
1115811554 14:37114376-37114398 TACTAGACATATTTAAGAGATGG + Intronic
1116466099 14:45234561-45234583 TACTTTGCCCATCTGAGAGAGGG + Intronic
1118366132 14:65098020-65098042 TACTATAGCCATTTCAGAGAAGG + Intronic
1118769247 14:68930721-68930743 TACTACCCCCATTTTACAGATGG - Intronic
1119515313 14:75243464-75243486 TACTAGCCCCATTTCACAGATGG + Intronic
1121900713 14:97691247-97691269 TCCTGGGCCTATCTCAGAGAAGG + Intergenic
1122723472 14:103735359-103735381 TACAAGGCACATTTTAAAGAGGG - Intronic
1124422091 15:29531423-29531445 TTCTAGGCCCTTGTCAGAGTGGG - Intronic
1127626003 15:60780991-60781013 TATTATCCCCATTTCACAGATGG + Intronic
1127630672 15:60824647-60824669 TATTAGCCCCATTTTATAGATGG - Intronic
1127660561 15:61096579-61096601 TATAATCCCCATTTCAGAGATGG + Intronic
1127921330 15:63496737-63496759 TGTTATTCCCATTTCAGAGATGG + Intergenic
1128904693 15:71456520-71456542 TACCATCCCCATTTCACAGATGG + Intronic
1129677380 15:77639329-77639351 TACTATACCCATTTTACAGATGG - Intronic
1130183790 15:81659023-81659045 TCCCAGGCTCATTTCAGTGAAGG + Intergenic
1130188095 15:81704891-81704913 TCCCAGGCTCATTTCAGTGAAGG + Intergenic
1131808006 15:96143059-96143081 GACTAACCCCATTTCACAGATGG + Intergenic
1133576802 16:7099382-7099404 TATTAGCCCCATTTTAAAGAGGG - Intronic
1134088015 16:11371894-11371916 TACCAGGCTCAGTGCAGAGAGGG + Intronic
1134336522 16:13304713-13304735 TATTAGTCCCATCTCACAGATGG + Intergenic
1134455539 16:14392750-14392772 TATAATCCCCATTTCAGAGAGGG + Intergenic
1134505413 16:14802042-14802064 TACTATGCCCATTTTACAAATGG + Intronic
1134575165 16:15326868-15326890 TACTATGCCCATTTTACAAATGG - Intergenic
1134727281 16:16429624-16429646 TACTATGCCCATTTTACAAATGG + Intergenic
1134763587 16:16735988-16736010 TACTATTCCCATTTCACAGATGG + Intergenic
1134820213 16:17240824-17240846 CATTAGCCCCATTTTAGAGACGG + Intronic
1134889040 16:17822246-17822268 TACTTGGCCCATTGGAGGGATGG - Intergenic
1134940156 16:18282231-18282253 TACTATGCCCATTTTACAAATGG - Intergenic
1134982465 16:18623169-18623191 TATTATTCCCATTTCACAGATGG - Intergenic
1135033400 16:19056820-19056842 TATTATGCCCATTTTAGAGATGG - Intronic
1135347832 16:21704469-21704491 CATTAGCCCCATTTCACAGATGG - Intronic
1135705549 16:24671598-24671620 CACTGCGCCCATTTCACAGATGG + Intergenic
1136009955 16:27356995-27357017 TGCTAGTCCCATTTCAGAGATGG - Intronic
1136018820 16:27426712-27426734 TATTGTCCCCATTTCAGAGATGG + Intronic
1137621212 16:49877575-49877597 TAATTGGCCCATTTGACAGATGG - Intergenic
1138459622 16:57140478-57140500 TACTACGCCCATTTCATAAGAGG - Intronic
1138481506 16:57306274-57306296 TACTAAGCCCATTTTACAGATGG - Intergenic
1138747907 16:59385161-59385183 TGCTGGGCCCTTTTGAGAGATGG + Intergenic
1139355219 16:66363582-66363604 TGTTAGGCCCATTTTACAGATGG - Intergenic
1139403488 16:66699984-66700006 CACTAGGCACAGTTCAGGGAAGG + Intergenic
1139659207 16:68409473-68409495 TAAAATGCCCACTTCAGAGATGG - Intronic
1140234068 16:73142827-73142849 TACTATGTCCATTTCATGGATGG + Intronic
1140456801 16:75110375-75110397 TGCTAGGCCCTTAGCAGAGAGGG - Exonic
1140976374 16:80063618-80063640 AACCAGGCCCATGTCAGAGTAGG + Intergenic
1141159601 16:81620386-81620408 CATTATGCCCATTTCACAGAGGG - Intronic
1141808281 16:86356622-86356644 TTCCATCCCCATTTCAGAGATGG - Intergenic
1141886298 16:86894699-86894721 TATTATCCCCATTTCACAGATGG + Intergenic
1143118020 17:4591508-4591530 TGCCAGAGCCATTTCAGAGATGG - Intronic
1143143655 17:4758500-4758522 AACTAGGCACATTACACAGAGGG + Intergenic
1143375004 17:6462113-6462135 TATTATGCCCATTTTACAGAGGG - Intronic
1143421254 17:6794369-6794391 TACTAGCCCCATTTTATAGATGG - Intronic
1143421550 17:6797055-6797077 TACTAGCTCCATTTTATAGATGG - Intronic
1143800474 17:9375817-9375839 TATTATCCCCATTTCAAAGATGG + Intronic
1144391676 17:14799226-14799248 TAAGAGCCCCATTCCAGAGAGGG - Intergenic
1144569129 17:16384715-16384737 TAAGACCCCCATTTCAGAGAGGG + Intergenic
1145243359 17:21252482-21252504 TATTATTCCCATTGCAGAGAGGG + Intronic
1145817292 17:27804726-27804748 CACTAGCCCCATTTTATAGATGG + Intronic
1146943154 17:36857794-36857816 CACTACCCCCATTTCACAGATGG - Intergenic
1147443510 17:40461499-40461521 TACTACTCCCATTTGACAGATGG - Intergenic
1147567188 17:41544978-41545000 TATTAGCCTCATTTCAGAGGCGG - Intergenic
1148219171 17:45850073-45850095 AACTCTGCCCATTTCACAGATGG + Intergenic
1148324605 17:46776042-46776064 TATTAGCCCCATTTTACAGATGG + Intronic
1151360667 17:73586851-73586873 TATGAGCCCCATTTTAGAGATGG + Intronic
1152517723 17:80836024-80836046 TCATAAGCCCATTTCACAGATGG + Intronic
1153505147 18:5789179-5789201 TAATACCCCCATTCCAGAGAGGG - Intergenic
1154302687 18:13208094-13208116 TACTAGAGACATTTCTGAGATGG + Intergenic
1155027563 18:21956404-21956426 TACTAGGGACATTATAGAGAGGG - Intergenic
1155144817 18:23074566-23074588 TAGTAGTCCCATTTTACAGATGG - Intergenic
1156205914 18:34885502-34885524 TAATAGACCCATTTCAAATACGG + Intronic
1157203202 18:45676790-45676812 TAATATCCCCATTTCACAGATGG + Intronic
1157231401 18:45919861-45919883 TAGTACTCCCATTTTAGAGATGG + Intronic
1157391352 18:47306245-47306267 AACTGGGCCCATTTGAAAGAAGG - Intergenic
1157574598 18:48735219-48735241 TGCTGGCCCCATTGCAGAGACGG - Intronic
1158326336 18:56317470-56317492 TATTGTGCCCATTTCACAGATGG + Intergenic
1159991625 18:74915228-74915250 TACTAGGCCCATTCCTGAGCTGG - Intronic
1161523300 19:4738112-4738134 TGCTATGCCCATTTCCTAGAAGG + Intergenic
1161631841 19:5360923-5360945 TACCAGCCCCATTTTACAGATGG + Intergenic
1161864864 19:6826471-6826493 TGTTATGCCCATTTCACAGATGG + Intronic
1161935163 19:7367169-7367191 CAGTATGCCCATTTTAGAGATGG + Intronic
1162153216 19:8659955-8659977 TCCTGGGCCCGTTTCACAGAAGG + Intergenic
1162180150 19:8863124-8863146 TACCATTCCCATTTCACAGATGG - Intronic
1162397831 19:10427730-10427752 TACTAGGCCCATTTCAGAGACGG - Intronic
1162462118 19:10819421-10819443 TCCTAGGCTCGTTTCAAAGATGG + Intronic
1162803468 19:13123757-13123779 GACTAGACCCATTTCACAGGTGG - Intronic
1163096255 19:15059527-15059549 TATTTGGCCCCTTACAGAGAAGG + Intergenic
1165348685 19:35265196-35265218 TGTTAGGTCCATTTCACAGATGG + Intronic
1165802882 19:38563660-38563682 TATTATGCCCATTTTACAGAGGG + Intronic
1165885795 19:39077303-39077325 TATTAAGCCCATTTTATAGATGG - Intergenic
1166798538 19:45442549-45442571 TGCTATGCCCATTTTAGAGATGG + Intronic
1167248281 19:48387155-48387177 TACTAGACCCATTTTGAAGATGG - Intronic
1167279814 19:48560356-48560378 TACAATGCCCATTTTACAGATGG + Intronic
1167752949 19:51391421-51391443 TATTAGCCCCATTTCTCAGATGG - Intergenic
1168458130 19:56531135-56531157 TGCTAGGCACATTTCAAAGAAGG + Intergenic
1202712789 1_KI270714v1_random:26897-26919 AACTAGGCCCAGCTCAGTGAGGG + Intergenic
925233883 2:2260245-2260267 TCCAATGCCCATTTCACAGATGG - Intronic
926828494 2:16934201-16934223 TAATACACCCATTTCTGAGAAGG + Intergenic
927431905 2:23033864-23033886 TATTAGTCCCATTTTATAGATGG + Intergenic
928932018 2:36634779-36634801 TCCTACACCCATTTCTGAGAAGG - Intronic
929870877 2:45758220-45758242 TACTATTCCCATTTCACAGATGG - Intronic
930849992 2:55950477-55950499 TACTGTGGTCATTTCAGAGAAGG + Intergenic
932474157 2:71990994-71991016 TATTAGCCCCATTTCCCAGATGG + Intergenic
935208272 2:100915395-100915417 TACTGGGCAGATTTCAGAGAGGG + Intronic
935623789 2:105151830-105151852 TATTAGTCCCATTTTACAGATGG + Intergenic
936954527 2:118011349-118011371 GACCAGGGTCATTTCAGAGACGG - Intronic
937865644 2:126749549-126749571 TATTAGTCCCATTTTAAAGATGG - Intergenic
937865781 2:126750957-126750979 TATTAGTCCCATTTTAAAGATGG + Intergenic
941269282 2:163405188-163405210 TACTATTTCCATTTCACAGATGG - Intergenic
944547108 2:200810053-200810075 TATTAGTCCCATTTTACAGATGG - Intergenic
944849624 2:203705269-203705291 TCCCAGGCCCTTTGCAGAGAGGG - Intergenic
946680875 2:222214551-222214573 TTCTGGGTCTATTTCAGAGATGG + Intronic
947768465 2:232652499-232652521 TAGTAGCCCCGCTTCAGAGATGG - Intronic
947783783 2:232795877-232795899 TACTATCCCCATTTTACAGAGGG - Intronic
947831099 2:233142405-233142427 TACTGTCCCCATTTCACAGATGG - Intronic
948915015 2:241030114-241030136 TGCTGGGCCCATCTCAGGGACGG + Intronic
948964190 2:241363481-241363503 TACTAGGGAGATTCCAGAGAGGG + Intronic
1169145131 20:3247596-3247618 TACCAGGCCCATCTGAGAGGTGG - Intergenic
1169460053 20:5786638-5786660 TAAGACCCCCATTTCAGAGAAGG + Intronic
1169866485 20:10205493-10205515 TACTTTGCCCATTTTTGAGATGG + Intergenic
1170936030 20:20810555-20810577 TTCTAGGTCCAATTCAGAGAAGG - Intergenic
1172134709 20:32679238-32679260 CACTGCTCCCATTTCAGAGATGG + Intergenic
1172163750 20:32886178-32886200 AACTAGCCCCATTTGACAGATGG - Intronic
1172319535 20:33985488-33985510 TATTAGCCCCATTTTACAGATGG - Intergenic
1173665351 20:44759071-44759093 TATTATTCCCATTTCACAGATGG - Intronic
1173848254 20:46201415-46201437 CAATATCCCCATTTCAGAGATGG - Intronic
1174087822 20:48021658-48021680 TATTATTCCCATTTTAGAGATGG + Intergenic
1174109634 20:48189783-48189805 TATTATGTCCATTTTAGAGATGG + Intergenic
1174187726 20:48719076-48719098 TACCATGCCCATTTTACAGATGG + Intronic
1174398935 20:50265386-50265408 TGCTATCCCCATTTCATAGATGG + Intergenic
1174429647 20:50458586-50458608 TGTTAGCCCCATTTCACAGACGG + Intergenic
1175161726 20:57012855-57012877 TATTATGCCCATTTAATAGATGG + Intergenic
1175220701 20:57414904-57414926 GACTGTGCCCATTTCACAGATGG + Intergenic
1175229717 20:57466036-57466058 TACTGGCCCCATTTCACAGGGGG + Intergenic
1175296274 20:57910911-57910933 TAATATCCCCATTTCACAGATGG + Intergenic
1175822010 20:61915094-61915116 TTCTTGTCCCATTTCACAGATGG + Intronic
1181258469 22:21580281-21580303 TATTAGCCCCATTTCACAGATGG - Intronic
1181540340 22:23569598-23569620 CACTATGCCCATTTTACAGATGG - Intergenic
1181888055 22:26037353-26037375 TATTATGCCCATTTTACAGATGG + Intergenic
1181991149 22:26837963-26837985 GATTATGCCCATTACAGAGATGG + Intergenic
1182453239 22:30433429-30433451 CACTATCCCCATTTCACAGAAGG - Intergenic
1182748176 22:32621787-32621809 TAATATGGCCATTTCACAGAGGG + Intronic
1182825847 22:33263973-33263995 TACTAGACCCATTTTACAGAGGG - Intronic
1183316915 22:37141946-37141968 TATTATGCCCATTTTACAGAAGG + Intronic
1183396200 22:37572193-37572215 CACTCTGCCCATTTCATAGATGG - Intronic
1183546479 22:38456749-38456771 GACTAGCCCCATTACAGAGAGGG + Intergenic
1184175391 22:42786039-42786061 TACAACGCCCATTTCACAGGTGG - Intergenic
1184765494 22:46570034-46570056 TACTGTGCCCATTCCACAGACGG - Intergenic
949582455 3:5402436-5402458 TATTAGAGCCATTTCACAGAGGG + Intergenic
949852802 3:8436014-8436036 AACTAGCCCCATTTTACAGATGG + Intergenic
949959717 3:9302134-9302156 TACTATTCCCATTTTAGAGATGG + Intronic
950071283 3:10154904-10154926 TACAACCCTCATTTCAGAGAAGG + Intergenic
950150318 3:10681720-10681742 TATTAGGCCCATTTAACAGAGGG + Intronic
950659969 3:14461262-14461284 TATTAGTCCCATTTTACAGATGG + Intronic
950873456 3:16249231-16249253 TACTCTCCCCATTTCACAGATGG + Intergenic
951461534 3:22956624-22956646 TAATAGGACCATTTCAGTGATGG + Intergenic
951476759 3:23114791-23114813 TACTTGGCCCTTTGCAGAAAAGG + Intergenic
952438851 3:33301952-33301974 TACTATTCCCATTTTATAGATGG - Intronic
953442624 3:42931864-42931886 TACTAGCGAAATTTCAGAGAAGG - Intronic
953618978 3:44516312-44516334 TCCAAGTACCATTTCAGAGAGGG - Intergenic
953750666 3:45606168-45606190 TATTAACCCCATTTCACAGATGG + Intronic
954097413 3:48339703-48339725 TACCATGCCCATTCCAGAGTAGG - Intergenic
954559207 3:51542178-51542200 TATTAGGCCCATTTTACAGATGG - Intronic
954676209 3:52316860-52316882 AACTGGCCCCATTTCACAGATGG - Intronic
955547189 3:60043457-60043479 TACTAGCTCCATTTTACAGATGG + Intronic
955759935 3:62268814-62268836 TACTAGGCCCATTTCTCACATGG + Intronic
960025714 3:113006875-113006897 TATTATTCCCATTTCATAGATGG - Intronic
960325288 3:116288042-116288064 TACTATGACCATATCAAAGAAGG + Intronic
960438937 3:117662986-117663008 AATTATACCCATTTCAGAGAGGG - Intergenic
960721910 3:120632821-120632843 TACTATACCCATTTTATAGATGG + Intronic
961089259 3:124095365-124095387 TACTGTGCCCATTTTATAGATGG - Intronic
961831125 3:129623523-129623545 AATTAGGCCCATTTTACAGATGG + Intergenic
963042961 3:141082704-141082726 TAATATCCCCATTTCACAGATGG + Intronic
963167187 3:142216652-142216674 TACCAGAACCATCTCAGAGAGGG + Intronic
963533715 3:146502202-146502224 TAATAGGCCTATTTTACAGATGG + Intergenic
967074760 3:185991980-185992002 TAATATTCCCATTGCAGAGATGG - Intergenic
967096187 3:186179353-186179375 TACATGGCCCTTTGCAGAGAAGG + Intronic
967311836 3:188113529-188113551 TACTATGCAGATTTCAGAGCTGG - Intergenic
972193820 4:36628029-36628051 TATTACGCCCATTTTACAGATGG - Intergenic
972316186 4:37928081-37928103 TATTAGCCCCATTTTACAGATGG - Intronic
972501473 4:39681899-39681921 TATTAGACCCATTTCAGATAGGG + Intergenic
972963641 4:44484491-44484513 TATTACTCCCATTTCAGAGATGG + Intergenic
973699134 4:53519512-53519534 TATTAGGCCCATCTTATAGATGG + Intronic
973801434 4:54482621-54482643 TATTATGCCCATTTTATAGATGG + Intergenic
976844100 4:89467431-89467453 GACTAGAACCATTTCAGAGTAGG - Intergenic
981655786 4:147111372-147111394 TAATATTCCCATTTTAGAGATGG + Intergenic
982537444 4:156624825-156624847 TACTACACCCATCTCAGAGCTGG - Intergenic
982696786 4:158611155-158611177 TACTATCCCCATTTTAGAGTTGG + Intronic
983343201 4:166492985-166493007 TATTAAGTCCATTTCATAGATGG + Intergenic
984672458 4:182506376-182506398 TACTACTCCCATTTTACAGATGG - Intronic
985659939 5:1152028-1152050 TGATAGGACCATTTCACAGATGG - Intergenic
986488357 5:8263654-8263676 TACTATGCCTATTTCAGTGAGGG - Intergenic
987255300 5:16144089-16144111 TATTAGTCCTATTTCAAAGATGG - Intronic
989101344 5:37826170-37826192 GACTAGCCCCATTTGAAAGATGG - Intronic
991272353 5:64799184-64799206 TATTAGCCCCATTTTACAGATGG - Intronic
991655003 5:68895234-68895256 TACTAAGCCCATTTTACAGGTGG + Intergenic
995186374 5:109276089-109276111 TATTAGGCCCATTCCACAGATGG + Intergenic
995213583 5:109569800-109569822 TATTACGCCCATTTTATAGATGG + Intergenic
996497866 5:124182132-124182154 TAAGATTCCCATTTCAGAGAGGG - Intergenic
998077923 5:139251443-139251465 TACTCCGCCCATTTTACAGATGG - Intronic
998108484 5:139483427-139483449 TTCTAGCCCCATTTTATAGATGG + Intergenic
998113796 5:139521515-139521537 AACTAGGCCAACCTCAGAGAGGG + Intergenic
998227496 5:140338326-140338348 TACTAGCCCCATTTTAAAGATGG + Intronic
998385777 5:141756421-141756443 TGCCAGGCTCATTTCAGGGATGG - Intergenic
999116797 5:149171424-149171446 TACTATCCCCATTTTATAGATGG + Intronic
999438142 5:151580355-151580377 TACCAGCCCCATTTCACAAATGG - Intergenic
999600483 5:153257782-153257804 TATTATCCCCATTTCACAGACGG + Intergenic
1000016610 5:157283390-157283412 TACTAGGTCCATTTTACAGGAGG - Intronic
1000035577 5:157445099-157445121 TACTATGCCCATTTTAAAGACGG - Intronic
1000625591 5:163534541-163534563 TACTGTGCCCATTTCACAGGTGG + Intergenic
1000958077 5:167565665-167565687 TACTGGTCCCATTTCATAGACGG + Intronic
1000981570 5:167822145-167822167 TCCCAAGCCCATTTCACAGATGG - Intronic
1001235916 5:170029490-170029512 TATTATTCCCATTTCAGAAATGG - Intronic
1001283624 5:170406445-170406467 TATTATGTCCATTTTAGAGATGG - Intronic
1001429011 5:171644975-171644997 TACTAGCCCCATCTCACAGATGG - Intergenic
1001777450 5:174339293-174339315 TGCTATTCCCATTTCACAGATGG + Intergenic
1001956520 5:175851531-175851553 TATTACGCCCATTTCACAGGTGG - Intronic
1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG + Intronic
1005233050 6:23726991-23727013 TATTACCCCCATTTTAGAGAGGG - Intergenic
1005622351 6:27631643-27631665 TATTTGGCAGATTTCAGAGAAGG + Intergenic
1006447703 6:34089065-34089087 GACTATGCCCATTTTATAGATGG - Intronic
1007709022 6:43809858-43809880 TATTATTCCCATTTCAAAGATGG - Intergenic
1008476126 6:51937717-51937739 TACCATGCCCATTTTACAGATGG - Intronic
1008591929 6:53002592-53002614 TCCTTTACCCATTTCAGAGAAGG + Exonic
1008933453 6:56964102-56964124 TATTATTCCCATTTCACAGATGG + Intronic
1011561779 6:88626061-88626083 TAATATCCCCATTTCACAGAGGG + Intronic
1012391262 6:98743154-98743176 TAATAAGCCCATTTTAGAGGTGG + Intergenic
1012702651 6:102481130-102481152 TATTAGGACAATTTCAGAAAGGG - Intergenic
1016389070 6:143557289-143557311 TATTTGCCCCATTTCACAGATGG + Intronic
1019046630 6:169154620-169154642 TACTCGCACCATTTCAGACATGG - Intergenic
1019363965 7:621776-621798 TACTGTGCCCATTTTACAGATGG - Intronic
1019709120 7:2510325-2510347 TCCAAGTCCCATTTCACAGATGG - Intergenic
1021413169 7:20351409-20351431 TGCTATGCCCATTTTACAGATGG - Intronic
1022421672 7:30229467-30229489 TATTATTCCCATTTCACAGATGG + Intergenic
1022465900 7:30653145-30653167 TACTGGGCCCAGAGCAGAGAAGG - Intronic
1024724641 7:52178482-52178504 TACTATTCCCATTCTAGAGATGG + Intergenic
1025245089 7:57310911-57310933 TGTTAGCCCCATTTCACAGAGGG - Intergenic
1027651438 7:80873511-80873533 TACTAGGCCCATTTCTATGTGGG + Intronic
1029254521 7:99260587-99260609 TATTACACCCATTTCACAGATGG + Intergenic
1030694230 7:112567623-112567645 TGATAGCACCATTTCAGAGATGG + Intergenic
1032863010 7:135899314-135899336 TATTATTCCCATTTCACAGATGG + Intergenic
1034377247 7:150656910-150656932 TAATAGGACCAGTCCAGAGAAGG - Intergenic
1034862489 7:154611094-154611116 AATTAGGCCCTTTGCAGAGATGG - Intronic
1040384549 8:46905372-46905394 TATTATTCCCATTTCACAGATGG - Intergenic
1042971483 8:74413872-74413894 TACTGGAGCAATTTCAGAGAGGG + Intronic
1043123245 8:76358520-76358542 TACTATGCCCATTTCAAGGCTGG - Intergenic
1044407242 8:91842134-91842156 TATTATCCCCATTTCACAGATGG - Intergenic
1044513336 8:93109560-93109582 TAATGGGCCCATTTGAGAGATGG + Intergenic
1044694582 8:94909977-94909999 AACTAGGCCCCTTTCTGACATGG + Intronic
1047439539 8:124864810-124864832 CAATAGGCACATTGCAGAGAAGG - Intergenic
1048273896 8:133051246-133051268 TATTAGTCCCATTTTAAAGATGG - Intronic
1051144320 9:14010444-14010466 TACTATTCCCATTTTAAAGATGG + Intergenic
1052039908 9:23726573-23726595 TCCTAGGCCCATTGTAGAGGAGG + Intronic
1052295614 9:26893598-26893620 TACAAGGCCAATTTAAGAGTGGG - Intergenic
1052516917 9:29493736-29493758 TACTACACACATTTCACAGATGG - Intergenic
1054730565 9:68698772-68698794 TCCTGGGGCCATTTCAGGGAGGG - Intergenic
1057276279 9:93677452-93677474 TCATAGGCCCATTTTACAGATGG + Intronic
1059425512 9:114218501-114218523 TATCAGTCCCATTTCACAGATGG - Intronic
1060190711 9:121590577-121590599 TACTAGAACCTTTTCAGAGGCGG + Intronic
1061216146 9:129223077-129223099 GACAAGTCCCAGTTCAGAGACGG - Intergenic
1061276491 9:129571835-129571857 CACTATGCCCATTTTACAGATGG - Intergenic
1061292215 9:129657206-129657228 GACTAGGCCCGTTTCACAGATGG - Intergenic
1061547890 9:131315315-131315337 TATCAGCCCCATTTCACAGACGG - Intergenic
1062055891 9:134469620-134469642 CACTAAACCCATTTCACAGATGG + Intergenic
1186039531 X:5460823-5460845 TAGTACTCCCATTCCAGAGAGGG + Intergenic
1186935230 X:14442601-14442623 TACCAGTCCCATTTCAGTGGGGG - Intergenic
1187241979 X:17522131-17522153 TACAAGGGCCACTTGAGAGATGG + Intronic
1188224469 X:27580208-27580230 TACAAGGCCCTTGTCACAGAAGG + Intergenic
1188383578 X:29528884-29528906 TCATAGGCCCAATTCAAAGAGGG - Intronic
1188501640 X:30833269-30833291 TACTATGCCATTTTCAGAAAAGG + Intronic
1192594042 X:72387620-72387642 TATTATCCCCATTTCATAGATGG - Intronic
1193476058 X:81967294-81967316 TAATAGTCCCATTCCACAGATGG - Intergenic
1195305231 X:103575594-103575616 TTATATGCCCATTTCACAGATGG + Intergenic
1195308857 X:103610476-103610498 TATTATCCCCATTTCACAGATGG - Intronic
1195432803 X:104808335-104808357 TATTATGCCCATTTCATAAATGG + Intronic
1195986841 X:110639616-110639638 AAGGAGGCCCATTTTAGAGATGG + Intergenic
1197298544 X:124750673-124750695 TGCTGTGCCCATTTTAGAGATGG + Intronic
1197496159 X:127184257-127184279 TATCATTCCCATTTCAGAGATGG - Intergenic
1198152296 X:133922933-133922955 TATTAGCCCCATTTTAAAGACGG + Intronic
1200867770 Y:8063477-8063499 TACTAAGCCCATTATAGAAAGGG - Intergenic
1201586217 Y:15564017-15564039 TAGTAGTACCATTCCAGAGAAGG + Intergenic