ID: 1162399170

View in Genome Browser
Species Human (GRCh38)
Location 19:10434358-10434380
Sequence CAAAAAAATTAGCTGGGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2530
Summary {0: 1, 1: 7, 2: 92, 3: 479, 4: 1951}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162399170_1162399177 11 Left 1162399170 19:10434358-10434380 CCATAGCCCAGCTAATTTTTTTG 0: 1
1: 7
2: 92
3: 479
4: 1951
Right 1162399177 19:10434392-10434414 TAGATGGGGTTTCTCTATGGTGG 0: 1
1: 6
2: 422
3: 13225
4: 74301
1162399170_1162399178 16 Left 1162399170 19:10434358-10434380 CCATAGCCCAGCTAATTTTTTTG 0: 1
1: 7
2: 92
3: 479
4: 1951
Right 1162399178 19:10434397-10434419 GGGGTTTCTCTATGGTGGCCAGG 0: 1
1: 144
2: 9897
3: 109271
4: 213899
1162399170_1162399173 -5 Left 1162399170 19:10434358-10434380 CCATAGCCCAGCTAATTTTTTTG 0: 1
1: 7
2: 92
3: 479
4: 1951
Right 1162399173 19:10434376-10434398 TTTTGTATTTTTAGTTTAGATGG 0: 10
1: 1956
2: 211831
3: 138453
4: 66630
1162399170_1162399174 -4 Left 1162399170 19:10434358-10434380 CCATAGCCCAGCTAATTTTTTTG 0: 1
1: 7
2: 92
3: 479
4: 1951
Right 1162399174 19:10434377-10434399 TTTGTATTTTTAGTTTAGATGGG 0: 5
1: 955
2: 96393
3: 252330
4: 150367
1162399170_1162399175 -3 Left 1162399170 19:10434358-10434380 CCATAGCCCAGCTAATTTTTTTG 0: 1
1: 7
2: 92
3: 479
4: 1951
Right 1162399175 19:10434378-10434400 TTGTATTTTTAGTTTAGATGGGG 0: 6
1: 918
2: 90607
3: 178730
4: 173873
1162399170_1162399176 8 Left 1162399170 19:10434358-10434380 CCATAGCCCAGCTAATTTTTTTG 0: 1
1: 7
2: 92
3: 479
4: 1951
Right 1162399176 19:10434389-10434411 GTTTAGATGGGGTTTCTCTATGG 0: 1
1: 0
2: 7
3: 114
4: 1005

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162399170 Original CRISPR CAAAAAAATTAGCTGGGCTA TGG (reversed) Intronic
Too many off-targets to display for this crispr