ID: 1162399412

View in Genome Browser
Species Human (GRCh38)
Location 19:10435831-10435853
Sequence ATCTGATTCTGGGGCATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162399397_1162399412 29 Left 1162399397 19:10435779-10435801 CCCTGAGCAGTCAGTGGCAAGCC 0: 1
1: 0
2: 0
3: 20
4: 163
Right 1162399412 19:10435831-10435853 ATCTGATTCTGGGGCATCACTGG 0: 1
1: 0
2: 0
3: 11
4: 120
1162399398_1162399412 28 Left 1162399398 19:10435780-10435802 CCTGAGCAGTCAGTGGCAAGCCA 0: 1
1: 0
2: 0
3: 21
4: 333
Right 1162399412 19:10435831-10435853 ATCTGATTCTGGGGCATCACTGG 0: 1
1: 0
2: 0
3: 11
4: 120
1162399408_1162399412 -10 Left 1162399408 19:10435818-10435840 CCATGGCTCAGGGATCTGATTCT 0: 1
1: 0
2: 0
3: 21
4: 244
Right 1162399412 19:10435831-10435853 ATCTGATTCTGGGGCATCACTGG 0: 1
1: 0
2: 0
3: 11
4: 120
1162399404_1162399412 8 Left 1162399404 19:10435800-10435822 CCAGGGAGGGGTGACTCTCCATG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1162399412 19:10435831-10435853 ATCTGATTCTGGGGCATCACTGG 0: 1
1: 0
2: 0
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162399412 Original CRISPR ATCTGATTCTGGGGCATCAC TGG Intronic
900292336 1:1928833-1928855 ATCAGCTTCTCGGGCAGCACTGG + Exonic
900698561 1:4028306-4028328 ATTTGCTTCTGCGGCATCCCAGG + Intergenic
905455344 1:38084431-38084453 AGCTGATTCCTGGGCATCATTGG - Intergenic
908890735 1:68844640-68844662 ATCTGCTTCTGGGGCTTCTGTGG - Intergenic
909180319 1:72415746-72415768 ATCTGCTTCTGGGGAACCTCAGG - Intergenic
909894529 1:81050706-81050728 ATTTTTTTCGGGGGCATCACAGG - Intergenic
912558796 1:110535472-110535494 ATCAGATCCTGGGGCCTCTCAGG + Intergenic
913347760 1:117825391-117825413 ATCTAATCCTGGGGCAGCTCTGG + Intergenic
915994144 1:160547123-160547145 ATCTGTTTGTGGGGCATGCCAGG + Intronic
916244811 1:162676901-162676923 AACTGAGCATGGGGCATCACAGG - Intronic
918902348 1:190439600-190439622 ATCTAATTAAGGGGCATGACTGG + Intronic
1064315567 10:14252532-14252554 ATCTAATTCTGAGGAAACACTGG - Intronic
1074128071 10:110546181-110546203 TTCTGATTCTGGAGGAACACAGG - Intergenic
1077262612 11:1630782-1630804 ATCTGCCTCTGGGGCCTCAGTGG - Intergenic
1080420274 11:32103772-32103794 AGCTGATCCTAGGGCAACACGGG - Intronic
1080426959 11:32163885-32163907 ATTTGGTCCTGGGGCAGCACAGG - Intergenic
1080773066 11:35360606-35360628 ATCAGAAGCTGGGGCATCTCTGG - Intronic
1085249742 11:75135131-75135153 GTCTGATTCTGCAGCAGCACTGG - Intronic
1088760087 11:112921216-112921238 AGCTGATTCTGGGGTGTCTCTGG - Intergenic
1090487375 11:127125979-127126001 ATCTGTTTTTGAGGCATCCCTGG - Intergenic
1091796407 12:3299781-3299803 ATCTGATGCTGGGGGAGGACAGG + Intergenic
1095839118 12:46672504-46672526 ATATGATTCTGAGGCCTCCCAGG + Intergenic
1098571116 12:71988414-71988436 ATCTGTTTCTGGGGGACCTCAGG + Intronic
1102251670 12:111391554-111391576 TTATGAGTCTGGGGCTTCACCGG - Intergenic
1104544151 12:129696022-129696044 ATCCTATTCTGGGCCAACACAGG + Intronic
1111351768 13:87040767-87040789 GTCTGCATCTGGGGAATCACAGG + Intergenic
1114405080 14:22449036-22449058 ATCTGGTTCTGGGGATTCTCAGG + Intergenic
1117209503 14:53481165-53481187 TTCTGCTTCTGTGGCTTCACAGG + Intergenic
1121430900 14:93887707-93887729 AACTGGTTCTGGGCCATCAAGGG - Intergenic
1125664627 15:41420496-41420518 ATCTGGTTCTGAGTCTTCACTGG + Intronic
1126714758 15:51502834-51502856 AACTGATTCTGGGAGATCAAGGG + Exonic
1126777943 15:52115423-52115445 ATCTAAAAATGGGGCATCACGGG + Exonic
1127107969 15:55637246-55637268 AACTGTTTCTGGGCCATCAGGGG + Exonic
1130209992 15:81914157-81914179 ATCTTCTTCTGGGACATAACTGG + Intergenic
1132299191 15:100766008-100766030 ATCGGGGTCTGGGGCAACACGGG + Intergenic
1133407764 16:5539222-5539244 ATGTGAGGCTGGGGCTTCACAGG + Intergenic
1135503066 16:23013841-23013863 ATCTGCTTCTGGGGAACCTCAGG - Intergenic
1136634554 16:31511598-31511620 ATAGGACTCTGGGGCATCAGAGG + Intergenic
1138240158 16:55421114-55421136 ATCTGAGTCAGGGGCATCTGGGG + Intronic
1139953238 16:70681811-70681833 ATCTGATTTTGGGGCTTTTCTGG + Intronic
1142550226 17:733496-733518 TTCTCACTCTGGAGCATCACTGG + Intronic
1142664267 17:1453490-1453512 ATCTGGTTCAGGGCCAACACAGG + Intronic
1144599496 17:16599829-16599851 AACTGATTTTAGGGCAACACAGG + Intergenic
1146794041 17:35768971-35768993 CTCTGATTCCTGGGCAACACAGG + Intronic
1147347583 17:39812557-39812579 AGCTGATTCTGGCACACCACTGG + Intronic
1151069257 17:71189644-71189666 TTCTGCTTCTGGGGCATCCCAGG + Intergenic
1152240295 17:79157399-79157421 ATCAGATTCCGGGGCCTTACGGG - Intronic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1155188410 18:23408048-23408070 ATCTGATTCTGTGGGAGAACAGG - Intronic
1162399412 19:10435831-10435853 ATCTGATTCTGGGGCATCACTGG + Intronic
1168312751 19:55469304-55469326 ATCTGAATCTGGGGGGACACAGG - Intergenic
1168465902 19:56600971-56600993 AGGTGGTTCTGGGGCATCTCAGG + Intronic
927286689 2:21364028-21364050 CTCATATTCTGGAGCATCACTGG + Intergenic
927629304 2:24758088-24758110 ATCTGCATCTGGGCCATCATTGG - Exonic
932104251 2:68928329-68928351 ATTTGACTCTGGGGATTCACTGG - Intergenic
932844892 2:75124941-75124963 ATCTGATTCTTGGTCATGACTGG - Intronic
935146179 2:100397103-100397125 ATCGGATTTTGGGGCACCATGGG - Intronic
935156637 2:100488948-100488970 TTCTGATTCTGGGGAATAACAGG - Intergenic
942717208 2:178906806-178906828 AGCTGGTGCTGGGGCAACACAGG + Intronic
943277573 2:185887167-185887189 ATCTGCTTCTGGTGGATCTCAGG - Intergenic
945337839 2:208614282-208614304 ATCTGATCCTGAGTGATCACTGG - Intronic
945657002 2:212636508-212636530 TTCTGATTCTAAGACATCACTGG + Intergenic
1169090947 20:2861093-2861115 GTATGATCCTGGGGCAACACAGG + Intronic
1170436222 20:16332294-16332316 ATGTGGTTCTCGGACATCACTGG - Intronic
1170757266 20:19214980-19215002 ATGTCATTCGGGGGCAACACAGG - Intronic
1173058282 20:39637118-39637140 ATCTGAGCCTGGGGAAGCACTGG - Intergenic
1174667658 20:52274978-52275000 ATCTGACTCTGGTCTATCACTGG - Intergenic
1175761760 20:61566096-61566118 GTCTCCTGCTGGGGCATCACTGG + Intronic
1176093810 20:63330437-63330459 ACCTGATTCTTGGGCATCTCAGG - Intronic
1178025117 21:28457246-28457268 ATCTAAATCTGGGGAATCAGTGG + Intergenic
1180610964 22:17097729-17097751 ACCTGCTGCTGGGGCATCTCAGG + Intronic
1181373812 22:22440366-22440388 GTCTGAGACTGGGGCAGCACTGG + Intergenic
1181661271 22:24350942-24350964 AGGTGATCCTGGGGCATCAGAGG + Intronic
1181996204 22:26884786-26884808 AGCTTATTCTGGGCCACCACTGG + Intergenic
1185083068 22:48720453-48720475 CTCTGAGTCTGGCACATCACTGG + Intronic
950930278 3:16782353-16782375 ATAAGATTCTGGGTCATCACTGG - Intergenic
952064164 3:29547601-29547623 TTCTGATTCAGGGGATTCACTGG + Intronic
952917596 3:38260848-38260870 ATCTGATTGTGGGTCATAAAAGG + Intergenic
956796845 3:72725429-72725451 TTCTCATCCTGGGGCCTCACAGG + Intergenic
957262983 3:77923671-77923693 ATGGGATTCTTGGGCATTACTGG + Intergenic
957693034 3:83596584-83596606 TTCTGACTCTGTGGCTTCACAGG - Intergenic
965865829 3:173203138-173203160 ATCTGCTTCTGTGGCATTGCAGG + Intergenic
969055633 4:4400802-4400824 ATCTGATACTGTGGCTTCAAAGG - Intronic
969072399 4:4549958-4549980 ATCTGGTTTTGGGGCAACATCGG + Intergenic
970144812 4:13024336-13024358 TTCTGACTATGGGGCATCCCTGG - Intergenic
971462767 4:26919976-26919998 TCCTGATTCTGTGGGATCACTGG + Intronic
973617682 4:52695640-52695662 AAATGATTCTGGGGGATGACTGG - Intergenic
978609319 4:110520046-110520068 TTCTGATTTTTGGGCAGCACTGG + Exonic
994255286 5:97586365-97586387 ATGTTATTCTTGGGTATCACTGG - Intergenic
995772330 5:115684952-115684974 CTCTGAGACTGGGGCATCTCAGG + Intergenic
996105411 5:119496271-119496293 ATCTGATTCTAAGGCGGCACTGG - Intronic
996835159 5:127783378-127783400 ATCTGATCCTGAGTGATCACTGG - Intergenic
997711630 5:136009365-136009387 TTCTGATTATGGGGCACCAGAGG + Intergenic
998405029 5:141869406-141869428 TCCTGATTCTGGGGCCTCCCAGG - Exonic
1000206618 5:159066493-159066515 AACTGATTCTGGGGAAGGACAGG - Intronic
1002800356 6:516279-516301 CTCTGGTTCTGGGGCGGCACTGG + Intronic
1009771335 6:68145947-68145969 CTCTGCTTCTGGGGCATGAAAGG + Intergenic
1023940663 7:44766635-44766657 AGCTGGTTCTGGGGCCTCCCCGG - Exonic
1027509025 7:79055418-79055440 ATCTGATACTTGGGCATCATTGG - Intronic
1027829253 7:83156082-83156104 ATCAGACTCTGAGGCATCCCAGG - Exonic
1028328449 7:89557936-89557958 AGCTGATGCAGGAGCATCACTGG + Intergenic
1034292757 7:149945757-149945779 ATCGGGTTCTGGGGAAGCACTGG + Intergenic
1034813310 7:154151115-154151137 ATCGGGTTCTGGGGAAGCACTGG - Intronic
1034878143 7:154743365-154743387 ATCTGAATCAGAGGCAGCACAGG - Intronic
1035246819 7:157567931-157567953 GTCTGCTCCTTGGGCATCACAGG - Intronic
1038127394 8:24690049-24690071 ACTAGATTCTGAGGCATCACGGG + Intergenic
1038444343 8:27593031-27593053 ATCTCACTCTGGGCCTTCACAGG + Intergenic
1039536433 8:38318613-38318635 ATAAGATTCTGGGGTTTCACTGG - Intronic
1041013889 8:53571567-53571589 CTCTGCTTCTGCGGCTTCACAGG - Intergenic
1041205898 8:55497920-55497942 ATCTGAGTCTGGGAGATCCCGGG - Intronic
1041966068 8:63678567-63678589 ATCTCATAGTGGGTCATCACTGG - Intergenic
1046088250 8:109465632-109465654 ATATGTTTCTGGAGCATGACTGG - Intronic
1049229173 8:141473237-141473259 ATGTGTTTCTGGGACACCACTGG - Intergenic
1052240785 9:26270973-26270995 AACTGATTATGATGCATCACTGG + Intergenic
1053913293 9:42926602-42926624 TTCTGCTTCTGGGACATCTCAGG - Intergenic
1055105578 9:72509107-72509129 AGCTGATTTTGGGCCATCATCGG + Intergenic
1055396572 9:75882021-75882043 ATCTGTTTTTGAGACATCACAGG + Intergenic
1057214580 9:93220796-93220818 GTCTGATGCTGGGGCAGCACGGG - Intronic
1059448738 9:114356774-114356796 CTCTTATTCTGGGCCATCACAGG + Intronic
1187234279 X:17452398-17452420 ATCTAAATCTGGGGCCTCCCCGG + Intronic
1189167864 X:38879354-38879376 GTATGACTCTGTGGCATCACAGG - Intergenic
1189374262 X:40454385-40454407 TTCTTTTTCTGAGGCATCACCGG + Intergenic
1192789574 X:74368203-74368225 ATCGGATCCTGGGGCAGCAGGGG - Intergenic
1197345246 X:125321392-125321414 ACCATCTTCTGGGGCATCACTGG - Intergenic
1197345316 X:125321707-125321729 ACCATCTTCTGGGGCATCACTGG - Intergenic
1197345330 X:125321770-125321792 ATCATGTTCTGGGGCATCACTGG - Intergenic
1197345342 X:125321833-125321855 ATCATGTTCTGGGGCATCACTGG - Intergenic
1197345394 X:125322079-125322101 ACCATGTTCTGGGGCATCACTGG - Intergenic
1197345461 X:125322388-125322410 ACCATGTTCTGGGGCATCACTGG - Intergenic
1197355760 X:125436249-125436271 AAATGATTTTGGGGCATTACAGG - Intergenic
1200235170 X:154464577-154464599 AGCTGTTTCTGGGGCATCAGGGG + Intronic
1201240391 Y:11952998-11953020 ACCTGCTTCAGGGGCATCTCAGG + Intergenic