ID: 1162401018

View in Genome Browser
Species Human (GRCh38)
Location 19:10446560-10446582
Sequence GGAACTGAGCCCTTTATAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162401018_1162401021 14 Left 1162401018 19:10446560-10446582 CCTCCTATAAAGGGCTCAGTTCC 0: 1
1: 0
2: 2
3: 15
4: 174
Right 1162401021 19:10446597-10446619 TCTTTTTTTCTTTTTTGAGACGG 0: 162
1: 6135
2: 95272
3: 80038
4: 84413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162401018 Original CRISPR GGAACTGAGCCCTTTATAGG AGG (reversed) Intronic
902492428 1:16794197-16794219 AGAACTGAGCTCTTTAAAGATGG + Intronic
905898241 1:41562992-41563014 GAAACTGAGCCCTTTTGAGGGGG + Intronic
908381021 1:63596714-63596736 GGAAAGGAGCACTTAATAGGTGG - Intronic
911496971 1:98643846-98643868 GGAACTGAGCCCTTAATCTGGGG - Intergenic
911889123 1:103344722-103344744 GGGACTGATCCCTTAATATGTGG - Intergenic
915294797 1:154912362-154912384 GAACCTGTGCCCTTTATCGGAGG - Intergenic
915639133 1:157208485-157208507 GGAACTGATGGCTTTATATGAGG + Intergenic
916301026 1:163274664-163274686 GGGACTGAGCCCTTTAAGTGAGG + Intronic
916793024 1:168140639-168140661 GGGACTGAGCCCTTAATCTGTGG + Intergenic
917571100 1:176266274-176266296 GGAGCTGAGCCCTTAATCTGTGG + Intergenic
919841104 1:201610009-201610031 GGAACTGAGGCCTATGTAGCAGG + Intergenic
922807217 1:228396636-228396658 GGGACTGAGCCCTTAATCTGTGG + Intronic
923528021 1:234788339-234788361 AGAACTGAGCTCTTTAAAGATGG - Intergenic
1064351114 10:14577953-14577975 GGAAGGGAGCCATTTTTAGGTGG - Intronic
1065665240 10:28052042-28052064 GAAACTGAGTCCTTTTTTGGTGG - Exonic
1068824028 10:61412712-61412734 GCAACTGAGCACTTGAAAGGTGG + Intronic
1070645544 10:78199763-78199785 GTAAATATGCCCTTTATAGGTGG + Intergenic
1071517285 10:86306559-86306581 GGAACTGAGCCCAGTATAGGAGG - Intronic
1075620485 10:123924233-123924255 GGGACTGAGCCCTTCATCTGTGG - Intronic
1077504974 11:2925867-2925889 GGAACTGAGGCCTTCCTAGATGG + Intergenic
1079383107 11:19956315-19956337 GGAACTGAGCCCTTAACCTGTGG - Intronic
1080954672 11:37079424-37079446 AGAACTGAGCCCTCTTTGGGTGG + Intergenic
1083039956 11:59676188-59676210 GGGACTGAGCCCTTTACCTGTGG + Intergenic
1083161984 11:60859982-60860004 GGGACTGATCGCTTTATAGTAGG + Intergenic
1083444834 11:62701000-62701022 GGGACTGGGCCCTCTATAGTAGG - Intronic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1087222411 11:95560556-95560578 AGAACTGATGCCTTCATAGGAGG + Intergenic
1087965883 11:104414388-104414410 GGGACTGAGCCCTTAACTGGTGG + Intergenic
1093942204 12:25067442-25067464 GGAACTGAGCCCTTAACCTGTGG - Intronic
1094809031 12:34120045-34120067 GGAAATAGGCCCTTTATAGGAGG + Intergenic
1096869334 12:54583618-54583640 AGAACTAAGCCCTGCATAGGAGG + Intronic
1097325673 12:58273593-58273615 GAAACTGAGCCTTGTACAGGAGG - Intergenic
1099103404 12:78471392-78471414 GGGACTGAGCCCTTAATCTGTGG - Intergenic
1102310926 12:111843748-111843770 GAAACTTAACCCTTTAAAGGAGG + Intronic
1102553432 12:113709924-113709946 GGAAGTGAGCCCTTTGTCGGGGG + Intergenic
1102619948 12:114186464-114186486 TGCACTGAGCACTTTCTAGGAGG - Intergenic
1106119649 13:26849501-26849523 GGGTCTGAGCCTTTTAGAGGAGG + Intergenic
1107694533 13:42987227-42987249 GGGACTGAGCCCTTAATTTGTGG + Intronic
1107888874 13:44896631-44896653 GGAACTGAGCTTTATTTAGGTGG + Intergenic
1107976309 13:45691922-45691944 GGAACTGAGCTTTTGACAGGTGG + Intergenic
1109097255 13:58134136-58134158 GGGACTGAGCCCCTGATGGGAGG - Intergenic
1111802510 13:92997781-92997803 GGAATTGAGGCCTTTAGATGGGG - Intergenic
1114235896 14:20823478-20823500 GTAAATGACCCCTTTATAGGAGG - Intergenic
1117850563 14:59964693-59964715 GCAAATGATCCCTCTATAGGAGG + Intronic
1118512252 14:66488286-66488308 GGAATTGAGCCCTATTCAGGAGG - Intergenic
1121164227 14:91776264-91776286 GGAACTGGGCCCTTAATTTGTGG + Intronic
1121242032 14:92438102-92438124 GGGACTGAGCCCTTGGTGGGTGG - Intronic
1121258847 14:92552055-92552077 GGAGTGGAGCCCTTTGTAGGGGG + Intronic
1123005040 14:105316989-105317011 GGAACAGGGCCCCTCATAGGCGG + Intronic
1123174664 14:106405129-106405151 GTAACTGAGCCCTTAATATGTGG - Intergenic
1123182883 14:106486078-106486100 GTAACTGAGCCCTTAATATGTGG - Intergenic
1202944024 14_KI270726v1_random:10650-10672 GTAACTGAGCCCTTAATATGTGG + Intergenic
1125273526 15:37966931-37966953 GGCACTGAGCCCCTTTTAGTGGG - Intronic
1126659178 15:51014855-51014877 GGAACTGAGCACTTGAAATGTGG + Intergenic
1129313018 15:74725543-74725565 GGCACTGCCACCTTTATAGGCGG + Exonic
1129518677 15:76172070-76172092 GGAACAGAGCCACTCATAGGGGG + Intronic
1130740216 15:86591377-86591399 GGGACTGAGCCCTTGATCTGTGG - Intronic
1133251172 16:4482524-4482546 GGGACTGAGCCCTCAATTGGTGG - Intronic
1135228185 16:20679900-20679922 GGAAATAGGCCCTTTACAGGAGG - Intronic
1135270503 16:21065686-21065708 GCCACTGAGCACTTTATATGTGG - Intronic
1136501224 16:30670445-30670467 GGGACTGAGCCATTAAGAGGTGG - Exonic
1137836997 16:51601767-51601789 GGAACTGAGCCCTTAAATTGGGG + Intergenic
1139108815 16:63863698-63863720 GGAACAGTGACCTTTATATGAGG - Intergenic
1140634688 16:76898353-76898375 GGAAACAAGCCCTTTATTGGAGG - Intergenic
1141748770 16:85944395-85944417 GACACTCAGCCCTTTAAAGGTGG - Intergenic
1143285974 17:5789608-5789630 GCATTTGAGCCCTTTGTAGGAGG + Intronic
1143694229 17:8599209-8599231 GGAACTGAGATTTTTATTGGTGG + Intronic
1143930379 17:10416951-10416973 GAAACTGAGACCTGTAAAGGAGG + Intronic
1146373556 17:32280141-32280163 GGCACTGAGCCCTATTCAGGAGG + Intronic
1152803417 17:82342755-82342777 GAAACCGAGCCCCTTAAAGGAGG + Intergenic
1154084524 18:11290105-11290127 GGGACTGAGCCCTCAATATGTGG - Intergenic
1154343955 18:13527346-13527368 TGAACTGTGCCTTGTATAGGAGG + Intronic
1154365027 18:13700106-13700128 GGGACTGAGCCCTTGATCTGTGG - Intronic
1154406532 18:14096835-14096857 GGAACTCAGCCCTTGATACCTGG - Intronic
1156046402 18:32882402-32882424 GGAACTCAGCCATTTATAAAAGG - Intergenic
1160625372 18:80200877-80200899 GGCACTGTGCCCTTTGGAGGTGG - Intronic
1162401018 19:10446560-10446582 GGAACTGAGCCCTTTATAGGAGG - Intronic
1162674432 19:12288107-12288129 GGAACTGAGCCCTCAATTTGTGG - Intronic
1164010536 19:21199797-21199819 GGAAATAGGCTCTTTATAGGAGG + Intergenic
1165653224 19:37509673-37509695 GGCACTGAGCACAGTATAGGTGG - Intronic
1166613270 19:44219620-44219642 GGAACTGAGTCCTATTTAGCCGG + Intronic
1167818140 19:51902318-51902340 TGAACTGAGCCCTTAATCTGTGG - Intronic
926169128 2:10539994-10540016 GGAACTGAGCCCTTCAACTGTGG + Intergenic
927563274 2:24088831-24088853 GGGACTGAGCCCTTAATCTGTGG + Intronic
930637153 2:53819386-53819408 GCAACTGAGCCCTTTACTTGTGG - Intergenic
931839090 2:66129868-66129890 GGAACTGAGCATTTTAAAGCAGG + Intergenic
932058785 2:68473914-68473936 GGAACTGAGCCCTCAACATGTGG - Intronic
933304701 2:80582650-80582672 GAAACTGAGCCCTTAAGGGGAGG - Intronic
933464594 2:82636404-82636426 GGAACTGAACCCACTATAGAGGG - Intergenic
934856241 2:97732129-97732151 GGAATTGAGCCCCTCAAAGGTGG - Intronic
935737428 2:106117582-106117604 GGAACAGAGCCCTGCATAGTGGG + Intronic
936258397 2:110936183-110936205 GGAACTGAGGCCTTAATCTGTGG - Intronic
939202990 2:139062644-139062666 GGGACTGAGCCCTTAACATGTGG - Intergenic
939506589 2:143053893-143053915 GGAACTGAGCCCTTAACCTGTGG + Exonic
941061770 2:160855767-160855789 GGAACTGCGTCCTTTGGAGGAGG + Intergenic
941572348 2:167187277-167187299 GGAACTGAGCTCTGTATAGGTGG - Intronic
944907334 2:204275656-204275678 GGAACTGAGCCCTTAACCTGTGG - Intergenic
945762073 2:213926166-213926188 GGAACTGAACACAGTATAGGTGG - Intronic
1173967276 20:47122147-47122169 ACACCTGAGCCATTTATAGGGGG - Intronic
1181408702 22:22703171-22703193 GGAGCTGAGCCCTCTATCGTGGG + Intergenic
1181489531 22:23252934-23252956 GGAGCTGAGCCCTTAACAGTGGG - Intronic
1181947780 22:26531725-26531747 GGAACTGGGCCCTTAATCTGTGG - Intronic
1182575424 22:31269837-31269859 GGAATGGAGCCCTGCATAGGGGG + Intronic
1183577957 22:38704191-38704213 GGGACTGAGCCCTTAATCAGTGG - Intergenic
951110185 3:18794127-18794149 GCAACTGAGCACTTGAAAGGTGG - Intergenic
952401905 3:32970928-32970950 GGAAATAGGCCCTTTATAGGAGG - Intergenic
952492275 3:33884088-33884110 GGAAATGAGAGCTTTAGAGGTGG + Intergenic
952572322 3:34732018-34732040 GGGACTGAGCCCCTTGGAGGAGG + Intergenic
953051785 3:39350845-39350867 GGAAATAGGCCTTTTATAGGAGG - Intergenic
956708098 3:72016670-72016692 GGAACTGAGCCCTCAATATGTGG + Intergenic
956787773 3:72656452-72656474 TGAGCTGAGCCCTCTAAAGGTGG + Intergenic
959129863 3:102340988-102341010 GGAACTGAGAGCTTGATGGGTGG + Intronic
959388579 3:105744186-105744208 GGAACTGAGGCCTTTATTTTTGG - Intronic
960443819 3:117722620-117722642 GAAGCTGAGCACTTTATACGTGG - Intergenic
964392755 3:156214339-156214361 GGGACTGAGCCCTTAATCTGGGG + Intronic
965287649 3:166837763-166837785 GGAACTGAGCTCTTAATCTGTGG + Intergenic
967822398 3:193850160-193850182 AGAACTGAGGCCTGAATAGGTGG + Intergenic
970525694 4:16929536-16929558 GGGACTGAGCCCTTGATTTGTGG + Intergenic
971248655 4:24953054-24953076 GGGAATGAGCACTTTATTGGAGG - Intronic
972758855 4:42081501-42081523 GGTCCTGAGACCTTTTTAGGGGG - Intronic
973318326 4:48783851-48783873 AAAACTGTGCCCCTTATAGGTGG - Intergenic
973746227 4:53965931-53965953 GGAACTGTGGCCTGTGTAGGTGG + Intronic
976305542 4:83555784-83555806 AGAACTGAGCCCTTCATTTGTGG + Intronic
976757975 4:88518498-88518520 GGAATTGAGCACTTGATATGTGG - Intergenic
977481232 4:97578463-97578485 GGAACTGAGCCCTTAATCCATGG + Intronic
977561533 4:98537981-98538003 GGGGCTGAGCCCCTCATAGGTGG - Intronic
978807530 4:112816103-112816125 GGAACTGAGCCCTTAACCTGTGG + Intergenic
979958199 4:126981733-126981755 GGAACTGAGCCCTTAACCTGTGG - Intergenic
980210526 4:129781687-129781709 GGAACTGAGCCCTTAACCTGAGG - Intergenic
985507959 5:295337-295359 GGTACTGAGCCCTTCAATGGAGG - Intronic
985740076 5:1610331-1610353 GGTACTGAGCCCTTCAATGGAGG + Intergenic
987139382 5:14929749-14929771 GGGACTGAGCCCTTAATCTGTGG + Intergenic
988601004 5:32639436-32639458 GGAACTGAGACATAAATAGGAGG - Intergenic
992153518 5:73930589-73930611 AGAACTAAGCTCTTTCTAGGTGG + Intronic
992433275 5:76730698-76730720 GAAACTGAGCCCTTAATCTGTGG - Intronic
997985554 5:138498794-138498816 GGAACTGAACCCTTAATCTGTGG - Intergenic
999188199 5:149728533-149728555 GGAAGGGAGCCCTTGTTAGGTGG + Intergenic
1002261316 5:177995624-177995646 GGAACTGAGCCCTTGGCAGGAGG - Intronic
1004594774 6:17088719-17088741 CGGCCTGAGCCCTTTAAAGGAGG + Intergenic
1004906513 6:20241504-20241526 GGGACTGAGTCCTTTATCTGTGG - Intergenic
1005999905 6:30956546-30956568 GGGACAGAGGCCTTTGTAGGAGG - Intergenic
1006098986 6:31673993-31674015 GGATGTGTGCCCTTTACAGGAGG - Intergenic
1007374784 6:41449147-41449169 GGAACTGAGCCCTAGAGATGGGG + Intergenic
1008405704 6:51116452-51116474 TGAACTGGGCCCTTTATATGTGG + Intergenic
1008415156 6:51231097-51231119 GCTACTGAGCCCTTTAAATGTGG - Intergenic
1012841480 6:104333842-104333864 GGAACTGTGTCCTTTCTGGGAGG + Intergenic
1013825399 6:114205149-114205171 GGAACTGAGCCCTTAACGTGTGG - Intronic
1014473576 6:121845935-121845957 CAAACTTAGCCCTTTACAGGTGG + Intergenic
1015394337 6:132718060-132718082 GGGACTGAGCCCTTAACATGTGG - Intergenic
1017038186 6:150285859-150285881 GGAACTGAGCCCTTAACCTGTGG + Intergenic
1017358075 6:153533927-153533949 GGAACTGAGCCCTTAACCTGTGG - Intergenic
1019527671 7:1487989-1488011 GGGAGTGAGCCCTTCATGGGGGG - Intronic
1020893140 7:13904690-13904712 GGAACTGAGCACTTTCTACAGGG - Intronic
1022645897 7:32228405-32228427 GGATCTGGGCTCTTTAGAGGTGG + Intronic
1023860041 7:44213028-44213050 GGAACTGAGCCCAGGAAAGGGGG + Exonic
1024445305 7:49470735-49470757 GGGACTGAGCCCTTAACATGTGG + Intergenic
1025928945 7:65980071-65980093 GGGGCTGTGCCCTGTATAGGGGG - Intronic
1026376798 7:69759786-69759808 TGAAATGAGTCCTTTATATGGGG - Intronic
1027338815 7:77183347-77183369 AGAACTGAGCAATTAATAGGTGG + Intronic
1029123448 7:98282567-98282589 TGACCAGAGCCCTTTATGGGAGG + Intronic
1029690243 7:102176364-102176386 GAAACTGAGCACTTCAGAGGGGG + Intronic
1033855532 7:145556910-145556932 GGAACTGAGGCATTTTTATGTGG + Intergenic
1034507860 7:151509309-151509331 GGAACTGTGCCCTGTGTGGGTGG + Intronic
1035294071 7:157857979-157858001 GGAAGGGAGCCCTTTGTCGGGGG + Intronic
1037065856 8:14576328-14576350 TGAAGTGAGCCCTCTAAAGGAGG + Intronic
1037264771 8:17046207-17046229 GGAACTGAGCCCTTAACCTGTGG + Intronic
1037667370 8:20981650-20981672 GGAACTGAGCCCTTAACTTGTGG + Intergenic
1041869414 8:62616238-62616260 GGAACTGAGCCCTTAACCTGTGG - Intronic
1042149650 8:65767989-65768011 GGAACTGAGCCCTTAACCTGTGG + Intronic
1048131601 8:131703797-131703819 GAAACTGGGGCATTTATAGGTGG - Intergenic
1048188132 8:132263303-132263325 GGAAGTCAGCCCTTAAGAGGGGG - Intronic
1048803372 8:138215787-138215809 GGATCTGAGCCATTCATGGGTGG - Intronic
1054711467 9:68515292-68515314 GGAAATGAGCCCTGTAAACGAGG - Intronic
1054912067 9:70464213-70464235 GGGACTGAGCCCTTCATCTGTGG - Intergenic
1054961788 9:70977582-70977604 GGGACTGAGCCCTTAATGTGTGG - Intronic
1055326771 9:75138456-75138478 ACAACTGAGCCCTTTAAATGGGG + Intronic
1055531127 9:77185109-77185131 GGAACTGAGCCCTTACCATGTGG + Intronic
1058495282 9:105552643-105552665 GCTACTGAGCACTTTATATGTGG + Intergenic
1060608591 9:124940724-124940746 GAAACTGAGCCCTAGAGAGGAGG + Intronic
1189965957 X:46373432-46373454 GGAAAAGAGACCATTATAGGTGG + Intergenic
1196498744 X:116352056-116352078 AGAACTTAGTACTTTATAGGGGG + Intergenic
1196867340 X:120082199-120082221 GGAACTACGCCTTTTATAGGAGG + Intergenic
1196875759 X:120154083-120154105 GGAACTACGCCTTTTATAGGAGG - Intergenic
1197019132 X:121665296-121665318 GGAGCTGTGGCCTTTATAGCTGG - Intergenic
1199212000 X:145223612-145223634 GGAACTGAGCCCTTAACTGGTGG - Intergenic
1199715008 X:150501509-150501531 GGCACTGAGCCCTCTATGGTTGG + Intronic
1199931399 X:152526756-152526778 GGAACTTAGCCTTTTAGGGGTGG - Intergenic
1199936196 X:152575960-152575982 GGAAATGAGGTCTTTAAAGGGGG - Intergenic
1199983912 X:152936896-152936918 GGAACTGAGCCCTCTAATGCTGG - Intronic
1201755182 Y:17479478-17479500 GGAAATAGGCCCCTTATAGGAGG + Intergenic
1201846370 Y:18426507-18426529 GGAAATAGGCCCCTTATAGGAGG - Intergenic
1202071363 Y:20995022-20995044 GGAAATAGGTCCTTTATAGGAGG - Intergenic