ID: 1162407815

View in Genome Browser
Species Human (GRCh38)
Location 19:10486246-10486268
Sequence CTCTGGAAATGTGGTTCCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162407815_1162407825 4 Left 1162407815 19:10486246-10486268 CCCTGGGAACCACATTTCCAGAG 0: 1
1: 0
2: 2
3: 18
4: 212
Right 1162407825 19:10486273-10486295 CCTCCCCCTGAGGCCCCCATTGG 0: 1
1: 0
2: 0
3: 18
4: 256
1162407815_1162407830 16 Left 1162407815 19:10486246-10486268 CCCTGGGAACCACATTTCCAGAG 0: 1
1: 0
2: 2
3: 18
4: 212
Right 1162407830 19:10486285-10486307 GCCCCCATTGGCCCCCTCCCAGG 0: 1
1: 0
2: 0
3: 30
4: 329
1162407815_1162407823 -6 Left 1162407815 19:10486246-10486268 CCCTGGGAACCACATTTCCAGAG 0: 1
1: 0
2: 2
3: 18
4: 212
Right 1162407823 19:10486263-10486285 CCAGAGGGGGCCTCCCCCTGAGG 0: 1
1: 0
2: 1
3: 28
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162407815 Original CRISPR CTCTGGAAATGTGGTTCCCA GGG (reversed) Exonic
900560823 1:3305280-3305302 CTCTGCACGTGTGGTTCCCGGGG - Intronic
902679648 1:18033983-18034005 CTTAGGAAACCTGGTTCCCAAGG + Intergenic
902802223 1:18837812-18837834 CTCTGACAATCTGGTCCCCAGGG + Intergenic
905226698 1:36483287-36483309 CTGTGAAGATGTGGTCCCCAAGG - Intergenic
907408474 1:54268535-54268557 TTCTGGATTTGTGGTTTCCAAGG - Intronic
909529985 1:76671281-76671303 ATCTTGAAATGTGATTCCCAAGG - Intergenic
909923620 1:81412217-81412239 CCCAGGAAATCTGGTTCCAAAGG + Intronic
910216355 1:84848389-84848411 CTCTGTGAATGTGGTCCACAGGG - Intronic
910783429 1:90967215-90967237 CTCTGTACATGTAGTTCCCTTGG + Intronic
910973861 1:92885207-92885229 CTCAGGGAATGTGGTCCCAAAGG + Intronic
912311447 1:108625279-108625301 GTCTGGAAATGTGGATCTCAAGG - Intronic
917111856 1:171556802-171556824 TTCTGAAAATTTGGTTCCAAAGG - Intronic
918735272 1:188054039-188054061 CTCTGGAAATGAGGCTCAGAAGG + Intergenic
918837731 1:189489199-189489221 CTCTAGACATTTTGTTCCCATGG - Intergenic
920009215 1:202855626-202855648 CTGTGGAGAAGTGGTGCCCAAGG - Intergenic
920219070 1:204382722-204382744 CTCTGGCAAGCTGGATCCCAGGG - Intergenic
920300031 1:204982934-204982956 CTCTGGGAAAGTGGGGCCCAGGG - Intronic
923067996 1:230537895-230537917 CACAGGAAATGTGTTTCCCTTGG - Intergenic
923307530 1:232701885-232701907 CTCCTGAAATGTAGTTCCCCAGG + Intergenic
923778370 1:236999624-236999646 CTATGGAGATGTGGTTGGCATGG + Intergenic
924219333 1:241856301-241856323 CTATGGGAAAATGGTTCCCAAGG - Intronic
1062791037 10:306892-306914 CTGCTGAAATGTGATTCCCAGGG + Intronic
1063393825 10:5667790-5667812 CCCTGGAAATGTGGAGCCCCAGG + Intergenic
1064909548 10:20385045-20385067 CTGTTGAAATGTAGTCCCCAAGG + Intergenic
1065771998 10:29086277-29086299 CTCTGGCAATGGGGCTCCCCAGG - Intergenic
1068102137 10:52568954-52568976 GTCAGGGAATTTGGTTCCCAGGG + Intergenic
1070007240 10:72436170-72436192 CTCTGGAAGTGTCGTTCCAGAGG - Intronic
1070068334 10:73060241-73060263 TTCTGAAAATTTGGTTCCTAAGG - Intronic
1071600768 10:86957785-86957807 CTCTGGGAATGTGGTAGACATGG + Exonic
1071986141 10:91052759-91052781 CTCTGAAAATCTGGATCCAATGG - Intergenic
1072298592 10:94037430-94037452 GTCTGGAAATTTGGTTGCCCTGG + Intronic
1075936921 10:126350867-126350889 CTCTGGATCTGAGGTACCCATGG - Intronic
1076703176 10:132284593-132284615 CTTTGGGCAGGTGGTTCCCAGGG - Intronic
1077803105 11:5561684-5561706 CTCAGCACCTGTGGTTCCCATGG + Intronic
1078420058 11:11203540-11203562 CTCTGGAAATATTGTTCTCACGG - Intergenic
1081328210 11:41771744-41771766 CACAGGAAATGTGGTTCAGAAGG + Intergenic
1086152169 11:83624005-83624027 TTCTGGAAATATGATTACCATGG + Intronic
1087328095 11:96747502-96747524 CTCTGGAAATGTTGTTCCCCAGG + Intergenic
1088598632 11:111457316-111457338 CTCTGGAGATGGGGGGCCCATGG + Intronic
1089481583 11:118809805-118809827 GTCTGGAACTGTTCTTCCCAAGG - Intergenic
1090163423 11:124519370-124519392 ATTTGGAAATGTAGTTGCCATGG - Intergenic
1090539287 11:127682721-127682743 CTCTGAAGATGTTGTTGCCAGGG + Intergenic
1090799917 11:130163967-130163989 GTCTGGTAGTCTGGTTCCCAGGG - Intronic
1091838340 12:3601775-3601797 CTCTGGCAATGTGGTTTCTGGGG + Intergenic
1092670325 12:10854463-10854485 CTCTGGGAATGTGCTTGCCATGG - Intronic
1098205271 12:68102421-68102443 CTCTGGACATGTGCTTCATAAGG + Intergenic
1098286773 12:68915106-68915128 CTATGGAAACATAGTTCCCATGG + Intronic
1102104975 12:110313613-110313635 CTTAGGAAAGGTGGTTCCCATGG - Intronic
1103034330 12:117644102-117644124 CTCTGCAAATGTGGATTCAAGGG + Intronic
1104058586 12:125249062-125249084 CTCTGGACTTGTGTTTCTCATGG + Intronic
1104331922 12:127855031-127855053 CTGAGCAAATGTGTTTCCCAGGG + Intergenic
1107010986 13:35670636-35670658 GGCTGGAAATGTGGTTCCGTGGG + Intronic
1107631221 13:42344495-42344517 CCCTCGAAATGTAGGTCCCAGGG - Intergenic
1108437660 13:50416752-50416774 TTCTGGAATTGTACTTCCCAGGG - Intronic
1112180050 13:97069548-97069570 CTCTGGAGAGGTGGTTATCATGG + Intergenic
1112885695 13:104168345-104168367 CTCTGGAAACTTCCTTCCCAGGG - Intergenic
1112973107 13:105285007-105285029 CCCTGGAGCTGTAGTTCCCAAGG + Intergenic
1117833579 14:59778999-59779021 CTCTGGAAGTGTGGTAGACAAGG + Intronic
1118101242 14:62605695-62605717 CTCGTGTAATGTGGTTGCCATGG - Intergenic
1118848341 14:69565226-69565248 CTCTGGAAAAATGGTTCCCCTGG - Intergenic
1119541530 14:75441661-75441683 CCCAGGAAATGACGTTCCCAGGG - Intronic
1121629858 14:95414119-95414141 CTCTGGGAATGGAGTTCCCTGGG - Intronic
1123671600 15:22664650-22664672 CTCTGGAACACTGCTTCCCACGG + Intergenic
1123996580 15:25722149-25722171 GTCTGGAAGTATGGTACCCATGG + Intronic
1124323639 15:28737875-28737897 CTCTGGAACACTGCTTCCCACGG + Intronic
1124629878 15:31330044-31330066 GGCTGGAAATGGGCTTCCCAGGG - Intronic
1126188549 15:45854748-45854770 CTATGGAAATCTCGTTCTCAAGG - Intergenic
1128299477 15:66556764-66556786 CTGTGGAATCGTGGTTGCCAGGG + Intronic
1131098843 15:89672619-89672641 ATCTGAAAATGTGGTCTCCAAGG - Intronic
1131656866 15:94470068-94470090 CTCTGGAACTATGGGTTCCAGGG + Intronic
1132779201 16:1613882-1613904 CTCTGGGAATCTTCTTCCCAGGG - Intronic
1141450529 16:84097528-84097550 CTCTGGAGATGGGATTCCCATGG - Intronic
1144487714 17:15681189-15681211 CTCTGAAAACGAGGTTCCCTGGG + Intronic
1144581344 17:16461166-16461188 CTCTGGAAAGGTGTTTCCTGGGG - Intronic
1144913310 17:18701099-18701121 CTCTGAAAACGAGGTTCCCTGGG - Intronic
1145937876 17:28725869-28725891 CTGTGGAAATGAGGTGGCCAGGG - Intronic
1146550623 17:33777467-33777489 CCCTGGAAATGAGGCTGCCAAGG + Intronic
1147349648 17:39830895-39830917 CCCTGAAAATGTGGTCACCATGG + Intronic
1149436708 17:56639545-56639567 ATCTGGAAATGGCTTTCCCAAGG + Intergenic
1151394676 17:73814740-73814762 CACTGGAAAGGAGGTTCCCCAGG - Intergenic
1151984703 17:77534801-77534823 CTCTGCCAAGGTGATTCCCAAGG + Intergenic
1153773855 18:8436007-8436029 CTCTTGAAGTGAGCTTCCCAGGG - Intergenic
1155861239 18:30902974-30902996 CTCAGGAAATGTCTTTCTCAAGG + Intergenic
1156494554 18:37517372-37517394 ATATGGTGATGTGGTTCCCAGGG + Intronic
1156563471 18:38156633-38156655 CTCTGGAAACAAGGTACCCAGGG - Intergenic
1156602399 18:38624722-38624744 TGCTGGAAATTTGGTTCTCATGG + Intergenic
1158789564 18:60761378-60761400 ATCTTGAATTGTAGTTCCCATGG + Intergenic
1162407815 19:10486246-10486268 CTCTGGAAATGTGGTTCCCAGGG - Exonic
1164579031 19:29422960-29422982 CTCAGGAAACATGGTCCCCAGGG - Intergenic
1164636009 19:29792014-29792036 CCATGTAAATGGGGTTCCCATGG + Intergenic
1165968614 19:39605784-39605806 CTCTGGTAATGTTTTTCCTATGG - Intronic
1166775317 19:45308573-45308595 GGCTGGGAATGGGGTTCCCACGG - Intronic
925035485 2:682077-682099 CTCTGGATTTCTGCTTCCCATGG - Intergenic
926122811 2:10254084-10254106 CCCTGGAAATGTGGGTCTCGGGG + Intergenic
926126360 2:10274591-10274613 CTCTGGCATTGTGGTGCCCGGGG - Intergenic
928370101 2:30734414-30734436 CTTTGGAGCTGTGGTGCCCAAGG - Intronic
930972760 2:57417296-57417318 CTCTGGGGAAGTGGTTCTCAGGG - Intergenic
931090589 2:58881987-58882009 ATTTGGTGATGTGGTTCCCAGGG - Intergenic
932094137 2:68831987-68832009 CTCTGGGAATGGGGTTGCCTTGG + Intergenic
932516966 2:72360992-72361014 CTCTGGGAATGGGGTTGCAATGG - Intronic
932758729 2:74426066-74426088 CTCTTAAATTGTGGTTGCCATGG - Exonic
933698106 2:85235431-85235453 TGCTGGGAATGTGGTTCCTAAGG + Intronic
937072080 2:119072226-119072248 GTTAGGAAATCTGGTTCCCAAGG + Intergenic
937858408 2:126689463-126689485 ATGTTGAAATTTGGTTCCCAAGG + Intronic
938687780 2:133757038-133757060 ATCTTTAATTGTGGTTCCCATGG - Intergenic
938712938 2:133991077-133991099 CTCTAGAACCGTGGTTCTCAAGG - Intergenic
939580222 2:143937829-143937851 CTCTGGATAGGTGGTGCCCGGGG + Intergenic
939941475 2:148356777-148356799 CTCTGGAAGAGCAGTTCCCAAGG - Intronic
940130564 2:150376764-150376786 CTGTGGAAATCTGGCCCCCAGGG + Intergenic
941230952 2:162912280-162912302 CTCTGCAAATGTTGATCCCAAGG + Intergenic
942413488 2:175735137-175735159 CTCAGAATATGAGGTTCCCATGG + Intergenic
943812034 2:192198671-192198693 ATATTGAAATGTGGATCCCAAGG - Intergenic
946366218 2:219250720-219250742 CCGTGGAGATGTGGTGCCCAAGG - Exonic
946369451 2:219271746-219271768 CCATGGAGATGTGGTGCCCAAGG + Intronic
947462389 2:230314638-230314660 GTCTGGAAAAGTGGGTCCCAAGG + Intergenic
947471504 2:230405164-230405186 GTCTGGAAAAGTGGGTCCCAAGG + Intergenic
948131171 2:235601642-235601664 ATCTTGAATTGTGGCTCCCAGGG - Intronic
948629253 2:239291534-239291556 CTCTGGAACTTTGGTTTTCATGG + Intronic
1169276566 20:4237088-4237110 GTCTGGAAATGTGGATCTGAAGG + Intronic
1169742864 20:8914297-8914319 TTCTGCAAAGGTGGTTTCCATGG - Intronic
1173401770 20:42732195-42732217 CACTTGAAATGTGGTTATCATGG - Intronic
1174314699 20:49689395-49689417 CTGTGAAATTGTAGTTCCCACGG - Intronic
1175580368 20:60094307-60094329 CTCAGGAAATGGGGTTTCCAAGG - Intergenic
1177910455 21:27024963-27024985 CTCTAAAAATGTTGTTTCCAAGG - Intergenic
1178742816 21:35218690-35218712 CTCTGGCAATATGGTACCAAAGG + Intronic
1179711535 21:43266324-43266346 ATCTGGAAATGAGGTCACCACGG - Intergenic
1180030659 21:45204642-45204664 CCCTGGAAAGGTGGTCCCCGTGG - Exonic
1180658839 22:17447852-17447874 CACTTGAAATGTGGCTACCATGG - Intronic
1182826474 22:33269648-33269670 TTCTGGGAAAGTGTTTCCCAAGG - Intronic
950803317 3:15573752-15573774 TTCTCTAAATGTGGTTCCCTGGG - Intronic
951184588 3:19698055-19698077 CTGTGGAATAGTGGTTTCCAGGG + Intergenic
951328002 3:21328582-21328604 CTCTGGAAATGGGTTTCCTATGG - Intergenic
951676356 3:25246685-25246707 CTCTGGAAGTTTGGTCCCAAAGG + Intronic
953474173 3:43192073-43192095 CTTTGGAAACGTGTTTACCATGG - Intergenic
954463546 3:50641292-50641314 CTCATGAAACGTGGATCCCAGGG + Intronic
954496866 3:50972572-50972594 CTCAGGGAATGTTGTTCCTAAGG - Intronic
955740768 3:62089176-62089198 CTTTGGGAATGTGGGTCACAGGG - Intronic
957262795 3:77922417-77922439 CTCTGGAGATGTAGGTCCCGAGG + Intergenic
957648048 3:82960158-82960180 CAGTGGAAAGGTGGTTGCCAGGG + Intergenic
959257186 3:104030803-104030825 CAGTGGAAATGTGGTACCCAGGG - Intergenic
959902007 3:111672018-111672040 CACTGGTAATTTGGTTTCCATGG + Intergenic
960261485 3:115573536-115573558 CTCTAGAATTCTGGTTCCAAGGG - Intergenic
960386141 3:117023948-117023970 CTGTTTAACTGTGGTTCCCATGG + Intronic
960915566 3:122690940-122690962 ATCTTTAAATGTGGTTTCCAAGG + Intronic
962683117 3:137820852-137820874 CACTGGAAACGTGGTACACATGG + Intergenic
964269582 3:154940480-154940502 ACCTGGAAATGTGTTTTCCAGGG - Intergenic
966869109 3:184278427-184278449 CTCGGGAATTCAGGTTCCCATGG + Intronic
968375151 4:34015-34037 CTCCTTAAATGTGGGTCCCATGG - Intergenic
968417677 4:454165-454187 CTCTGGATATGTGGATACTACGG + Intronic
969528615 4:7717213-7717235 CTTTGCACATGTTGTTCCCATGG + Intronic
974014459 4:56635962-56635984 TTTTGGGAACGTGGTTCCCATGG + Intergenic
974721641 4:65747227-65747249 CTCTGGAACTGAGGTTATCATGG + Intergenic
975148347 4:70993936-70993958 CTCCGGAAATGTGGGACGCAAGG + Intronic
976146939 4:82051318-82051340 CTCTTGAGCTGTGGTTCCTAAGG - Intergenic
978722062 4:111922258-111922280 TTCTGGAAGTATGGTTCTCAAGG + Intergenic
980001795 4:127497924-127497946 ATGTAGAAATGTGATTCCCAAGG - Intergenic
980883483 4:138738498-138738520 CTCAGGGACTGTGGTTCTCAGGG - Intergenic
982767984 4:159369522-159369544 CAATAGAAATGTTGTTCCCACGG + Intergenic
983195446 4:164801241-164801263 CTGTGGATAAGTAGTTCCCATGG - Intergenic
984748081 4:183242640-183242662 CTGTGAAAATTTGGTTCTCAAGG + Intronic
985219650 4:187690674-187690696 CTCTTAAAATGTGCTTCCAAAGG - Intergenic
985459892 4:190095029-190095051 CTCCTTAAATGTGGGTCCCATGG + Intergenic
986970806 5:13334150-13334172 CTCTGTAAATGAGATTGCCAGGG + Intergenic
987089408 5:14497954-14497976 CTCTGGAAATGAGTTTTCCGTGG + Intronic
987118948 5:14748444-14748466 CTCTGGAACTGCTGGTCCCAAGG - Intronic
990516875 5:56538702-56538724 AGCTGGAGATGTGGTTCGCAGGG - Intronic
992638914 5:78751821-78751843 TTCTGAAAGTGTGGCTCCCAGGG + Intronic
993916187 5:93744657-93744679 CTATGGAAATGGGGTTAGCAGGG + Intronic
995041786 5:107596306-107596328 CTCTGGAAATATGGTTGCCAGGG - Intronic
996353746 5:122574480-122574502 CTCTGTAACTGTTGTTGCCATGG - Intergenic
996417103 5:123222449-123222471 CCCTGGAATTGTGGCTTCCAAGG + Intergenic
996687299 5:126297032-126297054 ATAGGGGAATGTGGTTCCCAGGG - Intergenic
997850898 5:137331800-137331822 ATGTTGAAATGTGATTCCCAGGG - Intronic
1000116937 5:158162238-158162260 CTGTTGGAATGTGCTTCCCACGG - Intergenic
1001087594 5:168712326-168712348 CGCTGGAAATGTCATTGCCATGG + Exonic
1002897610 6:1388830-1388852 CTCTGGAAACCTGGATCTCATGG - Intergenic
1002925599 6:1604414-1604436 CTCTGGAGACCCGGTTCCCAGGG + Intergenic
1003351327 6:5320196-5320218 CACTGCAAAGGTGTTTCCCAAGG - Intronic
1004487801 6:16083813-16083835 CTTTGGAAATGTGGTTTCAAGGG - Intergenic
1005375057 6:25173476-25173498 ATCTAGAAATCTGATTCCCAAGG + Intergenic
1006957551 6:37887875-37887897 CTTTGTAAATGTGTTTGCCAAGG - Intronic
1007308201 6:40923555-40923577 CTCAGCAGCTGTGGTTCCCAGGG - Intergenic
1011151488 6:84278519-84278541 CTGTGGAAATGTACTTCACAGGG - Intergenic
1012929693 6:105304064-105304086 CTCTGCAGATGTGAATCCCATGG - Intronic
1013142645 6:107353910-107353932 TTTTGGAAATGTAGTTTCCATGG + Intronic
1014197420 6:118576142-118576164 TTCTGGAAACCTGGTTACCATGG + Intronic
1016664578 6:146621496-146621518 CTCTAGACCTGTGGTTTCCATGG - Intronic
1018593324 6:165452087-165452109 CCCTGTAAATGTGTTTCTCATGG - Intronic
1018745326 6:166757491-166757513 CGCAGGAAATGGGGGTCCCAGGG - Intronic
1020448139 7:8291820-8291842 CTCCAGAAATTTGCTTCCCAGGG - Intergenic
1020553270 7:9635294-9635316 ATCTTGAAATGTAGTCCCCATGG + Intergenic
1021845697 7:24760336-24760358 GTCTCCAAATGTGGTTCTCAAGG - Intergenic
1028634090 7:92967678-92967700 TTCTGGAAATGTGGCTCTGAAGG + Intergenic
1029653132 7:101907255-101907277 TTCTGGAAATGAGGTTTCCTAGG + Intronic
1030709750 7:112736217-112736239 CTCTGGTAGTGGGGGTCCCAAGG + Intergenic
1031083998 7:117284172-117284194 CTCTGGAAATGTTCTTTTCAGGG - Intronic
1031144589 7:117983780-117983802 AACTGGAAATGTGCTGCCCATGG - Intergenic
1031673751 7:124584239-124584261 CTCTGCAAATATGGTTGACATGG + Intergenic
1032125597 7:129190178-129190200 CTTTGGAAATTTGGTTACCGAGG + Intronic
1032794371 7:135265972-135265994 GTCTTGGAATGTGGTCCCCAAGG - Intergenic
1034443477 7:151099972-151099994 CCCTGGAAATGAGGTGCTCATGG + Intronic
1035064490 7:156095132-156095154 CCCAGGAGATGGGGTTCCCAGGG - Intergenic
1035255978 7:157627779-157627801 CTCAGGAAGTGGGTTTCCCAAGG + Intronic
1036123311 8:6040996-6041018 GTCTTGAATTGTGGTTCCCATGG - Intergenic
1036743930 8:11390774-11390796 CTCTGGACATGCGGTCCCCCTGG - Intronic
1037406233 8:18545770-18545792 CTCTGGGAATGTGCTTCTGAGGG - Intronic
1037837811 8:22224561-22224583 CTCTGGCAATGTGGTTGCAGAGG - Intronic
1038482986 8:27914478-27914500 ACCTCGAACTGTGGTTCCCAAGG + Intronic
1039099730 8:33928369-33928391 CAATGGAAATGTGTTTCTCATGG + Intergenic
1039831990 8:41222738-41222760 CTCTGGGCATGTGGTTTCCAAGG - Intergenic
1041127426 8:54658100-54658122 AAGTAGAAATGTGGTTCCCAAGG - Intergenic
1044571589 8:93724757-93724779 CACTTGAAATGTGGTTCACGTGG - Intronic
1049108311 8:140627165-140627187 GCCTGGGAATGTGGGTCCCACGG + Intronic
1053011954 9:34638530-34638552 CTCTGGAAATGGAGTTGGCAGGG + Intronic
1053344290 9:37366617-37366639 CTTTGGAAATGTGGCTTCAAGGG + Intergenic
1054836929 9:69685426-69685448 CTTTGGAAATTTGGTTAACATGG - Intergenic
1054936148 9:70690446-70690468 ATCTGGCAATGTGTTTACCAAGG + Intronic
1056941020 9:90956306-90956328 CTCTGGGCATGTTGTTCTCATGG - Intergenic
1056969296 9:91189137-91189159 ATGTTGAAATGTGATTCCCAAGG - Intergenic
1057030845 9:91774137-91774159 CTAAGGAAATGTGGTCCCCAAGG + Intronic
1061016306 9:127982700-127982722 GTCTGGACATGTGGTGACCAAGG + Intergenic
1061659635 9:132120374-132120396 GTCAGGAAATGGGCTTCCCAAGG + Intergenic
1062102820 9:134737432-134737454 CTTTGAAAATGTGGTCCCCCAGG + Intronic
1062222876 9:135427990-135428012 CTCTGGGAATGTGGCTTCCATGG + Intergenic
1203574073 Un_KI270744v1:160135-160157 CTCCTTAAATGTGGGTCCCATGG + Intergenic
1189059382 X:37736753-37736775 CTCTGGAGAACTGGTTCCGAAGG + Intronic
1189101218 X:38192264-38192286 CACTGATAATGTGGTTTCCAAGG - Intronic
1191795207 X:65014389-65014411 CCCTGGAGCTATGGTTCCCATGG + Intronic
1194890238 X:99370371-99370393 CTTAGGAAATATTGTTCCCAGGG - Intergenic
1195270895 X:103229601-103229623 ATCTGTAAATGTGATTTCCAAGG + Intergenic
1196358018 X:114817718-114817740 CTCTGGAAATGAGGCTCTGAAGG - Intronic
1197140682 X:123114521-123114543 CACTGCAAATGTGCTTCTCAAGG - Intergenic
1198112192 X:133511463-133511485 CTCTGGAAATGTATTTCAGATGG - Intergenic