ID: 1162410687

View in Genome Browser
Species Human (GRCh38)
Location 19:10503266-10503288
Sequence CCGAGGCCCCCCGACGGCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 116}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162410687_1162410705 26 Left 1162410687 19:10503266-10503288 CCTCCGCCGTCGGGGGGCCTCGG 0: 1
1: 0
2: 2
3: 9
4: 116
Right 1162410705 19:10503315-10503337 CTTGGTTGTCGGTTGGGGAGCGG 0: 1
1: 0
2: 0
3: 15
4: 186
1162410687_1162410693 -7 Left 1162410687 19:10503266-10503288 CCTCCGCCGTCGGGGGGCCTCGG 0: 1
1: 0
2: 2
3: 9
4: 116
Right 1162410693 19:10503282-10503304 GCCTCGGCTCCAGGGCTGCGTGG 0: 1
1: 0
2: 3
3: 29
4: 297
1162410687_1162410703 20 Left 1162410687 19:10503266-10503288 CCTCCGCCGTCGGGGGGCCTCGG 0: 1
1: 0
2: 2
3: 9
4: 116
Right 1162410703 19:10503309-10503331 CGGGGTCTTGGTTGTCGGTTGGG 0: 1
1: 0
2: 0
3: 2
4: 45
1162410687_1162410698 2 Left 1162410687 19:10503266-10503288 CCTCCGCCGTCGGGGGGCCTCGG 0: 1
1: 0
2: 2
3: 9
4: 116
Right 1162410698 19:10503291-10503313 CCAGGGCTGCGTGGCCTGCGGGG 0: 1
1: 0
2: 3
3: 35
4: 316
1162410687_1162410695 0 Left 1162410687 19:10503266-10503288 CCTCCGCCGTCGGGGGGCCTCGG 0: 1
1: 0
2: 2
3: 9
4: 116
Right 1162410695 19:10503289-10503311 CTCCAGGGCTGCGTGGCCTGCGG 0: 1
1: 0
2: 3
3: 35
4: 392
1162410687_1162410699 8 Left 1162410687 19:10503266-10503288 CCTCCGCCGTCGGGGGGCCTCGG 0: 1
1: 0
2: 2
3: 9
4: 116
Right 1162410699 19:10503297-10503319 CTGCGTGGCCTGCGGGGTCTTGG 0: 1
1: 0
2: 3
3: 18
4: 186
1162410687_1162410696 1 Left 1162410687 19:10503266-10503288 CCTCCGCCGTCGGGGGGCCTCGG 0: 1
1: 0
2: 2
3: 9
4: 116
Right 1162410696 19:10503290-10503312 TCCAGGGCTGCGTGGCCTGCGGG 0: 1
1: 0
2: 5
3: 47
4: 319
1162410687_1162410704 21 Left 1162410687 19:10503266-10503288 CCTCCGCCGTCGGGGGGCCTCGG 0: 1
1: 0
2: 2
3: 9
4: 116
Right 1162410704 19:10503310-10503332 GGGGTCTTGGTTGTCGGTTGGGG 0: 1
1: 0
2: 0
3: 7
4: 105
1162410687_1162410700 15 Left 1162410687 19:10503266-10503288 CCTCCGCCGTCGGGGGGCCTCGG 0: 1
1: 0
2: 2
3: 9
4: 116
Right 1162410700 19:10503304-10503326 GCCTGCGGGGTCTTGGTTGTCGG 0: 1
1: 0
2: 0
3: 9
4: 91
1162410687_1162410702 19 Left 1162410687 19:10503266-10503288 CCTCCGCCGTCGGGGGGCCTCGG 0: 1
1: 0
2: 2
3: 9
4: 116
Right 1162410702 19:10503308-10503330 GCGGGGTCTTGGTTGTCGGTTGG 0: 1
1: 0
2: 0
3: 1
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162410687 Original CRISPR CCGAGGCCCCCCGACGGCGG AGG (reversed) Exonic
901196970 1:7445608-7445630 CCAAGGCCACCTGACGCCGGAGG + Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
903813062 1:26045626-26045648 CCCAGGCCCCCCGCGGGCAGGGG + Intronic
906292986 1:44632008-44632030 CCGTGGCTGCCCGGCGGCGGCGG - Intronic
906960914 1:50419091-50419113 CCCAGGCCCCCCGGCGGCGGCGG + Exonic
908534636 1:65066702-65066724 CGGAGTCCCCGCGGCGGCGGCGG - Intergenic
921850411 1:219927928-219927950 CTGAGGCCCCCCGAAAGCGCCGG + Exonic
922250464 1:223845445-223845467 CCGCGCCCCCACGACGGCTGTGG + Intronic
1064274202 10:13891779-13891801 CCGAGGGCCCGCGGCGGGGGCGG - Intronic
1065188817 10:23192777-23192799 CCGAGGCCCCCCGAGGACGGCGG - Exonic
1065390083 10:25174584-25174606 CCGAGGCGGCCCGCGGGCGGCGG - Intergenic
1068690267 10:59906731-59906753 CCGTGGTCACCAGACGGCGGCGG - Intergenic
1070609984 10:77926558-77926580 CCCGGGCCCCCCGAGGCCGGCGG + Intergenic
1070768169 10:79068242-79068264 GCGCGGCCCCCCGACAGCTGTGG - Intergenic
1076374232 10:129972833-129972855 CCGCGGCCCCCAGGCGGCCGCGG - Intergenic
1076874090 10:133207542-133207564 CCCAGGCCCACAGGCGGCGGAGG - Intronic
1078345092 11:10540971-10540993 CCGAGGCCCGGGGAGGGCGGCGG + Intronic
1081793531 11:45804975-45804997 CCGAGGTCCCCCGCCAGCAGCGG + Exonic
1082928991 11:58579502-58579524 CCGAGTATCCCCGCCGGCGGAGG + Exonic
1083592767 11:63904981-63905003 CAGAGGCCCCCCGCCGGCCCTGG - Exonic
1084296043 11:68213827-68213849 CCGGGCGCTCCCGACGGCGGAGG + Intronic
1084452720 11:69249689-69249711 CTGAGGCCTCCAGACGGCGTGGG + Intergenic
1085666338 11:78418053-78418075 CCGGGGCGCGCCGGCGGCGGTGG - Intronic
1087138110 11:94740504-94740526 CCGAGGGCGCGCGGCGGCGGCGG - Intronic
1089432682 11:118436636-118436658 CCCGGGCCCCCGGTCGGCGGTGG + Exonic
1106087607 13:26557646-26557668 CCGAGCCCCCCCGCCGGGAGGGG + Intergenic
1106264894 13:28100794-28100816 CCGGGGCTCCCCGACTGCGGCGG + Intergenic
1107468023 13:40666644-40666666 CCGCCGCCCCCCGCCCGCGGCGG + Intergenic
1112402200 13:99086716-99086738 GCGGGGCGCCCGGACGGCGGAGG + Intergenic
1113779681 13:112969032-112969054 CCGGGGCTCCCCGACGACCGCGG + Intronic
1114553924 14:23550886-23550908 CGGCGGCCCCCCGCCGGCTGTGG - Intronic
1114612519 14:24052094-24052116 CCGCGGCTCCCCGGCGGCGGCGG + Exonic
1117251863 14:53946870-53946892 CCCAGGCCCGGCGGCGGCGGGGG - Intergenic
1122645094 14:103189055-103189077 CAGAGGCCTCCCGACCGCCGAGG + Intergenic
1122694132 14:103544583-103544605 CTGAGGCCCCCCGACTGGGATGG - Intergenic
1125519130 15:40338561-40338583 CCGAAGCCCCCCCACGCAGGTGG - Exonic
1125674250 15:41494070-41494092 CCGGGGCTCCCCCGCGGCGGCGG - Exonic
1127342711 15:58065111-58065133 CCGAGGGGCCCGGAAGGCGGAGG + Intronic
1132320163 15:100919529-100919551 CCGAGGCTCCCCGCGGGCGCCGG - Intronic
1132585786 16:705338-705360 CCGAGGCCCAGCGGCCGCGGGGG + Intronic
1136626357 16:31464558-31464580 CCAAGGCTCCTCGATGGCGGCGG - Exonic
1137261120 16:46830955-46830977 CTGGGGCCCGCCGGCGGCGGCGG - Intronic
1137617414 16:49855969-49855991 CCGAGGCCGCTCGAAGGCGGGGG + Intronic
1137624014 16:49896105-49896127 CCGAGGCCAACCGAGGGAGGAGG - Intergenic
1139570252 16:67807044-67807066 CAGAGGCCCCCCCGCGGCGGGGG - Intronic
1141164478 16:81651301-81651323 CGGAGGCCCTCGGAAGGCGGAGG - Intronic
1142284767 16:89167250-89167272 CCGAGCCTCCCCGATGGCTGAGG - Intergenic
1144840735 17:18184148-18184170 CCGGGGCCCCCGGAGGGAGGGGG - Intronic
1145765570 17:27456435-27456457 CCGCGGCGACCCGACGGCTGCGG - Intergenic
1146445263 17:32928026-32928048 GCCAGGCCCCCCGGCGGCCGGGG - Exonic
1147445628 17:40473729-40473751 CCGTGCCCCACCGAGGGCGGAGG - Intergenic
1147971820 17:44222257-44222279 GCGCTGCCCCCCGGCGGCGGCGG + Intergenic
1148323579 17:46771347-46771369 CCGAGGCGCCCCCAGGGCTGGGG - Intronic
1151755760 17:76074554-76074576 CCCAGAACCCCCGACTGCGGGGG + Intronic
1152069372 17:78127436-78127458 CCTTGGCGCCCTGACGGCGGTGG - Intronic
1152237894 17:79147997-79148019 CCGGGGCCCCACGGCAGCGGCGG - Intronic
1157570560 18:48709567-48709589 CCGAGGCTCCCTACCGGCGGCGG - Intronic
1158954163 18:62523605-62523627 CCGAGTCCCCGGGGCGGCGGCGG - Exonic
1160594476 18:79964455-79964477 CCGAGGCCCCGGGACGGCCTGGG - Intergenic
1161018734 19:1997587-1997609 ACCAGGCCCCCCGATGGCAGAGG + Intronic
1161128813 19:2576212-2576234 CCGAGGCCGCCCCACTGCGGTGG - Intronic
1161203810 19:3029736-3029758 CTGAGGCCCCCAGAGGGCGAGGG - Intronic
1161393439 19:4032857-4032879 CCGAAGCCCCCACACGGAGGTGG - Intronic
1161802681 19:6424643-6424665 CCGCCGCCGCCCGCCGGCGGGGG - Exonic
1162410687 19:10503266-10503288 CCGAGGCCCCCCGACGGCGGAGG - Exonic
1162532374 19:11243341-11243363 CCTGGGGCCCCCGACGGCGGCGG + Exonic
1163020650 19:14479417-14479439 CCGGGGCCCCGCCACGGTGGAGG - Exonic
1163606974 19:18280975-18280997 CGAGGGCCCCCCGGCGGCGGCGG + Exonic
1166043865 19:40218218-40218240 CCCAGGCTCCCCGACGGCTCTGG + Exonic
1167539132 19:50074270-50074292 CAGAGGCCCCCAGATGGCAGGGG + Intergenic
1168277046 19:55284272-55284294 CCGCGGCCCGCCGACTGGGGGGG + Exonic
925119841 2:1409693-1409715 CTGATGACCCCCGACGGCCGTGG - Intronic
925191819 2:1891358-1891380 CCGAGGCCACCAGGCGGCTGGGG - Intronic
925683658 2:6449060-6449082 CAGAGGCCACCCGAGGGCTGGGG - Intergenic
932773459 2:74514192-74514214 CGGAGGCCGCCCAAAGGCGGAGG + Intronic
935592733 2:104856222-104856244 CCGGGGCCCGGCGGCGGCGGCGG + Exonic
936865376 2:117071672-117071694 CCCAAGCCCCCCCACCGCGGTGG - Intergenic
937991363 2:127664199-127664221 CCGGGGCCCTCCGACGCCGTGGG - Intronic
938817533 2:134919099-134919121 CCGAGGCCCAGCGAAGGCCGAGG - Intronic
942246420 2:174012929-174012951 CCGAGGGGACCCCACGGCGGAGG - Intergenic
942947472 2:181685313-181685335 CCGAGACACACCGACGGCGCCGG + Intergenic
946322084 2:218960145-218960167 CGGGATCCCCCCGACGGCGGCGG + Exonic
946395567 2:219442205-219442227 CCGAGCCCCGCCGAGGGCGGCGG + Intronic
1171011509 20:21511869-21511891 CCCAGGCCCCACCCCGGCGGCGG - Exonic
1176550031 21:8217039-8217061 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1176568958 21:8400074-8400096 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1176576872 21:8444309-8444331 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1179511817 21:41878806-41878828 ACGACGCCGCCCGGCGGCGGGGG + Exonic
1181006532 22:20016353-20016375 CCGAGACCCCGGGCCGGCGGGGG - Intronic
1184731817 22:46374882-46374904 CCGAGGCCCCGGGCTGGCGGGGG - Intronic
1203254921 22_KI270733v1_random:133365-133387 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1203262977 22_KI270733v1_random:178444-178466 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
959530732 3:107431540-107431562 CCGAGCCCCGGCGGCGGCGGCGG - Intergenic
966849432 3:184155561-184155583 CCGAGCCTCCCAGACGGCGGCGG - Exonic
968462049 4:731117-731139 CCCACGCCCCCCGACCCCGGGGG + Intronic
970202882 4:13627490-13627512 CCGGGGCCCGGCGGCGGCGGCGG + Exonic
972532861 4:39976946-39976968 CCAAGGCCCCCGCTCGGCGGTGG + Intronic
972543310 4:40057271-40057293 CCGAGGCCGGGCGAAGGCGGGGG + Intronic
981782826 4:148445367-148445389 TCGGCGCCCCCCCACGGCGGGGG - Intergenic
982712209 4:158768950-158768972 CCGCAGCCCCACGGCGGCGGCGG - Intergenic
997282442 5:132657204-132657226 TTGAGGCCCCCAGACGGCAGGGG + Intronic
998119002 5:139561242-139561264 CCGAGCCGCGCCGGCGGCGGAGG - Exonic
1000319023 5:160119153-160119175 GCGAGCTCCCCCGGCGGCGGCGG + Exonic
1002576162 5:180175301-180175323 CAGAGGCCCCCAGACGCCAGAGG + Intronic
1003624097 6:7727062-7727084 CAGCTGCCCCCCGGCGGCGGCGG - Exonic
1017672513 6:156779623-156779645 CCGGGGCGCCCCGACCGCGGCGG - Intronic
1018191738 6:161315021-161315043 CTGAGGCCCCCACAAGGCGGCGG + Intergenic
1029437309 7:100570449-100570471 CCGAGGCCCCCGGAAGCCCGGGG - Intergenic
1030049037 7:105522012-105522034 CCGAGGAGCCCCGGCGGCCGCGG + Intronic
1032174434 7:129611968-129611990 CCGGGGCCCCCCGCCCGAGGCGG - Intronic
1032174483 7:129612105-129612127 CCGAGAGCCCCAGGCGGCGGAGG - Intronic
1033794946 7:144835800-144835822 CCGGGGGCCCCCGCCCGCGGCGG - Intronic
1035676977 8:1462808-1462830 CTCAGGCCCCCACACGGCGGCGG + Intergenic
1035717213 8:1763675-1763697 CCTAGGCGCTACGACGGCGGCGG - Intronic
1042785096 8:72537387-72537409 CCGAGGCGCAGCGGCGGCGGCGG - Exonic
1043502960 8:80874331-80874353 CCGCGGCTCCCGGGCGGCGGCGG - Intronic
1048072873 8:131040254-131040276 CCGACGCCCCCGGCCGGCGACGG - Exonic
1049891365 9:73424-73446 CGGAGGCCCCCGGCCGGCTGCGG - Intergenic
1057786004 9:98087748-98087770 CCGAGGCCCCGCGGCGCCGAAGG + Exonic
1059414798 9:114155977-114155999 CCGAGGCACAGCGGCGGCGGCGG + Exonic
1061276237 9:129570620-129570642 CAGAGGCTCCCCGATGGAGGTGG + Intergenic
1061321712 9:129835176-129835198 CCGAGTCGCCCCGGCGGCGACGG + Exonic
1061907608 9:133706866-133706888 CCGAGGCCCCAAGAAGGAGGAGG + Intronic
1062425681 9:136505130-136505152 GCGAGGCCCCCCGAGGAAGGCGG - Intronic
1203471323 Un_GL000220v1:116511-116533 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1203479144 Un_GL000220v1:160483-160505 CCGCGGGGCCCCGGCGGCGGGGG + Intergenic
1193655065 X:84188284-84188306 CCTGGACCCCCCCACGGCGGCGG + Intergenic
1200239390 X:154486013-154486035 CCGGGCCACCCCCACGGCGGTGG - Intronic