ID: 1162411459

View in Genome Browser
Species Human (GRCh38)
Location 19:10508514-10508536
Sequence AGACAGCTGTTTCACCGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162411457_1162411459 9 Left 1162411457 19:10508482-10508504 CCTAGCTAATTTTTTTTTTGTAT 0: 386
1: 1741
2: 7686
3: 23466
4: 93779
Right 1162411459 19:10508514-10508536 AGACAGCTGTTTCACCGTGTTGG No data
1162411455_1162411459 17 Left 1162411455 19:10508474-10508496 CCACCACGCCTAGCTAATTTTTT 0: 457
1: 30297
2: 135790
3: 251300
4: 208903
Right 1162411459 19:10508514-10508536 AGACAGCTGTTTCACCGTGTTGG No data
1162411454_1162411459 21 Left 1162411454 19:10508470-10508492 CCTGCCACCACGCCTAGCTAATT 0: 383
1: 22281
2: 72794
3: 92463
4: 58000
Right 1162411459 19:10508514-10508536 AGACAGCTGTTTCACCGTGTTGG No data
1162411456_1162411459 14 Left 1162411456 19:10508477-10508499 CCACGCCTAGCTAATTTTTTTTT 0: 91
1: 4299
2: 26962
3: 117018
4: 260462
Right 1162411459 19:10508514-10508536 AGACAGCTGTTTCACCGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162411459 Original CRISPR AGACAGCTGTTTCACCGTGT TGG Intergenic
No off target data available for this crispr