ID: 1162412934

View in Genome Browser
Species Human (GRCh38)
Location 19:10517417-10517439
Sequence CAAGGCAGCGCGACTGCGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162412934_1162412945 10 Left 1162412934 19:10517417-10517439 CCACCCGCAGTCGCGCTGCCTTG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1162412945 19:10517450-10517472 GCGGACGCCGCTCCGGGGGCGGG 0: 1
1: 1
2: 3
3: 24
4: 193
1162412934_1162412937 -9 Left 1162412934 19:10517417-10517439 CCACCCGCAGTCGCGCTGCCTTG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1162412937 19:10517431-10517453 GCTGCCTTGAACCGAGTGAGCGG 0: 1
1: 0
2: 1
3: 2
4: 90
1162412934_1162412949 21 Left 1162412934 19:10517417-10517439 CCACCCGCAGTCGCGCTGCCTTG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1162412949 19:10517461-10517483 TCCGGGGGCGGGGCTGGAGCTGG 0: 1
1: 1
2: 15
3: 120
4: 1056
1162412934_1162412951 25 Left 1162412934 19:10517417-10517439 CCACCCGCAGTCGCGCTGCCTTG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1162412951 19:10517465-10517487 GGGGCGGGGCTGGAGCTGGCAGG 0: 2
1: 0
2: 21
3: 195
4: 1415
1162412934_1162412940 3 Left 1162412934 19:10517417-10517439 CCACCCGCAGTCGCGCTGCCTTG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1162412940 19:10517443-10517465 CGAGTGAGCGGACGCCGCTCCGG 0: 1
1: 0
2: 0
3: 1
4: 26
1162412934_1162412943 6 Left 1162412934 19:10517417-10517439 CCACCCGCAGTCGCGCTGCCTTG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1162412943 19:10517446-10517468 GTGAGCGGACGCCGCTCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 45
1162412934_1162412947 15 Left 1162412934 19:10517417-10517439 CCACCCGCAGTCGCGCTGCCTTG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1162412947 19:10517455-10517477 CGCCGCTCCGGGGGCGGGGCTGG 0: 1
1: 0
2: 7
3: 93
4: 595
1162412934_1162412942 5 Left 1162412934 19:10517417-10517439 CCACCCGCAGTCGCGCTGCCTTG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1162412942 19:10517445-10517467 AGTGAGCGGACGCCGCTCCGGGG 0: 1
1: 0
2: 0
3: 3
4: 41
1162412934_1162412944 9 Left 1162412934 19:10517417-10517439 CCACCCGCAGTCGCGCTGCCTTG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1162412944 19:10517449-10517471 AGCGGACGCCGCTCCGGGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 110
1162412934_1162412952 30 Left 1162412934 19:10517417-10517439 CCACCCGCAGTCGCGCTGCCTTG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1162412952 19:10517470-10517492 GGGGCTGGAGCTGGCAGGCGAGG 0: 1
1: 0
2: 12
3: 127
4: 879
1162412934_1162412941 4 Left 1162412934 19:10517417-10517439 CCACCCGCAGTCGCGCTGCCTTG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1162412941 19:10517444-10517466 GAGTGAGCGGACGCCGCTCCGGG 0: 1
1: 0
2: 0
3: 3
4: 60
1162412934_1162412946 11 Left 1162412934 19:10517417-10517439 CCACCCGCAGTCGCGCTGCCTTG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1162412946 19:10517451-10517473 CGGACGCCGCTCCGGGGGCGGGG 0: 1
1: 1
2: 2
3: 14
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162412934 Original CRISPR CAAGGCAGCGCGACTGCGGG TGG (reversed) Exonic