ID: 1162412935

View in Genome Browser
Species Human (GRCh38)
Location 19:10517420-10517442
Sequence GTTCAAGGCAGCGCGACTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162412935_1162412941 1 Left 1162412935 19:10517420-10517442 CCCGCAGTCGCGCTGCCTTGAAC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1162412941 19:10517444-10517466 GAGTGAGCGGACGCCGCTCCGGG 0: 1
1: 0
2: 0
3: 3
4: 60
1162412935_1162412943 3 Left 1162412935 19:10517420-10517442 CCCGCAGTCGCGCTGCCTTGAAC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1162412943 19:10517446-10517468 GTGAGCGGACGCCGCTCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 45
1162412935_1162412953 28 Left 1162412935 19:10517420-10517442 CCCGCAGTCGCGCTGCCTTGAAC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1162412953 19:10517471-10517493 GGGCTGGAGCTGGCAGGCGAGGG 0: 1
1: 0
2: 4
3: 70
4: 603
1162412935_1162412946 8 Left 1162412935 19:10517420-10517442 CCCGCAGTCGCGCTGCCTTGAAC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1162412946 19:10517451-10517473 CGGACGCCGCTCCGGGGGCGGGG 0: 1
1: 1
2: 2
3: 14
4: 168
1162412935_1162412955 30 Left 1162412935 19:10517420-10517442 CCCGCAGTCGCGCTGCCTTGAAC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1162412955 19:10517473-10517495 GCTGGAGCTGGCAGGCGAGGGGG 0: 1
1: 0
2: 7
3: 61
4: 627
1162412935_1162412944 6 Left 1162412935 19:10517420-10517442 CCCGCAGTCGCGCTGCCTTGAAC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1162412944 19:10517449-10517471 AGCGGACGCCGCTCCGGGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 110
1162412935_1162412945 7 Left 1162412935 19:10517420-10517442 CCCGCAGTCGCGCTGCCTTGAAC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1162412945 19:10517450-10517472 GCGGACGCCGCTCCGGGGGCGGG 0: 1
1: 1
2: 3
3: 24
4: 193
1162412935_1162412952 27 Left 1162412935 19:10517420-10517442 CCCGCAGTCGCGCTGCCTTGAAC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1162412952 19:10517470-10517492 GGGGCTGGAGCTGGCAGGCGAGG 0: 1
1: 0
2: 12
3: 127
4: 879
1162412935_1162412947 12 Left 1162412935 19:10517420-10517442 CCCGCAGTCGCGCTGCCTTGAAC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1162412947 19:10517455-10517477 CGCCGCTCCGGGGGCGGGGCTGG 0: 1
1: 0
2: 7
3: 93
4: 595
1162412935_1162412949 18 Left 1162412935 19:10517420-10517442 CCCGCAGTCGCGCTGCCTTGAAC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1162412949 19:10517461-10517483 TCCGGGGGCGGGGCTGGAGCTGG 0: 1
1: 1
2: 15
3: 120
4: 1056
1162412935_1162412954 29 Left 1162412935 19:10517420-10517442 CCCGCAGTCGCGCTGCCTTGAAC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1162412954 19:10517472-10517494 GGCTGGAGCTGGCAGGCGAGGGG 0: 1
1: 0
2: 11
3: 56
4: 549
1162412935_1162412940 0 Left 1162412935 19:10517420-10517442 CCCGCAGTCGCGCTGCCTTGAAC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1162412940 19:10517443-10517465 CGAGTGAGCGGACGCCGCTCCGG 0: 1
1: 0
2: 0
3: 1
4: 26
1162412935_1162412942 2 Left 1162412935 19:10517420-10517442 CCCGCAGTCGCGCTGCCTTGAAC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1162412942 19:10517445-10517467 AGTGAGCGGACGCCGCTCCGGGG 0: 1
1: 0
2: 0
3: 3
4: 41
1162412935_1162412951 22 Left 1162412935 19:10517420-10517442 CCCGCAGTCGCGCTGCCTTGAAC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1162412951 19:10517465-10517487 GGGGCGGGGCTGGAGCTGGCAGG 0: 2
1: 0
2: 21
3: 195
4: 1415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162412935 Original CRISPR GTTCAAGGCAGCGCGACTGC GGG (reversed) Exonic