ID: 1162412939

View in Genome Browser
Species Human (GRCh38)
Location 19:10517442-10517464
Sequence CGGAGCGGCGTCCGCTCACT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 20}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162412939_1162412951 0 Left 1162412939 19:10517442-10517464 CCGAGTGAGCGGACGCCGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 20
Right 1162412951 19:10517465-10517487 GGGGCGGGGCTGGAGCTGGCAGG 0: 2
1: 0
2: 21
3: 195
4: 1415
1162412939_1162412955 8 Left 1162412939 19:10517442-10517464 CCGAGTGAGCGGACGCCGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 20
Right 1162412955 19:10517473-10517495 GCTGGAGCTGGCAGGCGAGGGGG 0: 1
1: 0
2: 7
3: 61
4: 627
1162412939_1162412953 6 Left 1162412939 19:10517442-10517464 CCGAGTGAGCGGACGCCGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 20
Right 1162412953 19:10517471-10517493 GGGCTGGAGCTGGCAGGCGAGGG 0: 1
1: 0
2: 4
3: 70
4: 603
1162412939_1162412957 12 Left 1162412939 19:10517442-10517464 CCGAGTGAGCGGACGCCGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 20
Right 1162412957 19:10517477-10517499 GAGCTGGCAGGCGAGGGGGCGGG 0: 1
1: 1
2: 8
3: 76
4: 774
1162412939_1162412958 27 Left 1162412939 19:10517442-10517464 CCGAGTGAGCGGACGCCGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 20
Right 1162412958 19:10517492-10517514 GGGGCGGGCCAGCGACGCAAAGG 0: 1
1: 0
2: 0
3: 6
4: 81
1162412939_1162412954 7 Left 1162412939 19:10517442-10517464 CCGAGTGAGCGGACGCCGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 20
Right 1162412954 19:10517472-10517494 GGCTGGAGCTGGCAGGCGAGGGG 0: 1
1: 0
2: 11
3: 56
4: 549
1162412939_1162412947 -10 Left 1162412939 19:10517442-10517464 CCGAGTGAGCGGACGCCGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 20
Right 1162412947 19:10517455-10517477 CGCCGCTCCGGGGGCGGGGCTGG 0: 1
1: 0
2: 7
3: 93
4: 595
1162412939_1162412959 28 Left 1162412939 19:10517442-10517464 CCGAGTGAGCGGACGCCGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 20
Right 1162412959 19:10517493-10517515 GGGCGGGCCAGCGACGCAAAGGG 0: 1
1: 0
2: 0
3: 2
4: 41
1162412939_1162412952 5 Left 1162412939 19:10517442-10517464 CCGAGTGAGCGGACGCCGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 20
Right 1162412952 19:10517470-10517492 GGGGCTGGAGCTGGCAGGCGAGG 0: 1
1: 0
2: 12
3: 127
4: 879
1162412939_1162412956 11 Left 1162412939 19:10517442-10517464 CCGAGTGAGCGGACGCCGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 20
Right 1162412956 19:10517476-10517498 GGAGCTGGCAGGCGAGGGGGCGG 0: 1
1: 1
2: 6
3: 106
4: 1145
1162412939_1162412949 -4 Left 1162412939 19:10517442-10517464 CCGAGTGAGCGGACGCCGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 20
Right 1162412949 19:10517461-10517483 TCCGGGGGCGGGGCTGGAGCTGG 0: 1
1: 1
2: 15
3: 120
4: 1056

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162412939 Original CRISPR CGGAGCGGCGTCCGCTCACT CGG (reversed) Exonic