ID: 1162412949

View in Genome Browser
Species Human (GRCh38)
Location 19:10517461-10517483
Sequence TCCGGGGGCGGGGCTGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1193
Summary {0: 1, 1: 1, 2: 15, 3: 120, 4: 1056}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162412934_1162412949 21 Left 1162412934 19:10517417-10517439 CCACCCGCAGTCGCGCTGCCTTG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1162412949 19:10517461-10517483 TCCGGGGGCGGGGCTGGAGCTGG 0: 1
1: 1
2: 15
3: 120
4: 1056
1162412938_1162412949 3 Left 1162412938 19:10517435-10517457 CCTTGAACCGAGTGAGCGGACGC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1162412949 19:10517461-10517483 TCCGGGGGCGGGGCTGGAGCTGG 0: 1
1: 1
2: 15
3: 120
4: 1056
1162412939_1162412949 -4 Left 1162412939 19:10517442-10517464 CCGAGTGAGCGGACGCCGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 20
Right 1162412949 19:10517461-10517483 TCCGGGGGCGGGGCTGGAGCTGG 0: 1
1: 1
2: 15
3: 120
4: 1056
1162412936_1162412949 17 Left 1162412936 19:10517421-10517443 CCGCAGTCGCGCTGCCTTGAACC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1162412949 19:10517461-10517483 TCCGGGGGCGGGGCTGGAGCTGG 0: 1
1: 1
2: 15
3: 120
4: 1056
1162412935_1162412949 18 Left 1162412935 19:10517420-10517442 CCCGCAGTCGCGCTGCCTTGAAC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1162412949 19:10517461-10517483 TCCGGGGGCGGGGCTGGAGCTGG 0: 1
1: 1
2: 15
3: 120
4: 1056

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162412949 Original CRISPR TCCGGGGGCGGGGCTGGAGC TGG Intronic