ID: 1162416878

View in Genome Browser
Species Human (GRCh38)
Location 19:10543809-10543831
Sequence CCCGATCCCGGGTCGCCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 62}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162416878_1162416891 0 Left 1162416878 19:10543809-10543831 CCGCCTGGCGACCCGGGATCGGG 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1162416891 19:10543832-10543854 GCAGGAAAGGCGGCTGGGCGGGG 0: 1
1: 0
2: 3
3: 56
4: 719
1162416878_1162416888 -5 Left 1162416878 19:10543809-10543831 CCGCCTGGCGACCCGGGATCGGG 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1162416888 19:10543827-10543849 TCGGGGCAGGAAAGGCGGCTGGG 0: 1
1: 0
2: 1
3: 18
4: 169
1162416878_1162416894 9 Left 1162416878 19:10543809-10543831 CCGCCTGGCGACCCGGGATCGGG 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1162416894 19:10543841-10543863 GCGGCTGGGCGGGGAGAGGGCGG 0: 1
1: 2
2: 15
3: 173
4: 1528
1162416878_1162416886 -10 Left 1162416878 19:10543809-10543831 CCGCCTGGCGACCCGGGATCGGG 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1162416886 19:10543822-10543844 CGGGATCGGGGCAGGAAAGGCGG 0: 1
1: 0
2: 2
3: 20
4: 276
1162416878_1162416889 -2 Left 1162416878 19:10543809-10543831 CCGCCTGGCGACCCGGGATCGGG 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1162416889 19:10543830-10543852 GGGCAGGAAAGGCGGCTGGGCGG 0: 1
1: 0
2: 6
3: 91
4: 2092
1162416878_1162416896 11 Left 1162416878 19:10543809-10543831 CCGCCTGGCGACCCGGGATCGGG 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1162416896 19:10543843-10543865 GGCTGGGCGGGGAGAGGGCGGGG 0: 1
1: 1
2: 25
3: 237
4: 1784
1162416878_1162416890 -1 Left 1162416878 19:10543809-10543831 CCGCCTGGCGACCCGGGATCGGG 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1162416890 19:10543831-10543853 GGCAGGAAAGGCGGCTGGGCGGG 0: 1
1: 0
2: 3
3: 81
4: 663
1162416878_1162416901 28 Left 1162416878 19:10543809-10543831 CCGCCTGGCGACCCGGGATCGGG 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1162416901 19:10543860-10543882 GCGGGGCGGGGCGTCTGGCTTGG 0: 1
1: 3
2: 1
3: 49
4: 761
1162416878_1162416895 10 Left 1162416878 19:10543809-10543831 CCGCCTGGCGACCCGGGATCGGG 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1162416895 19:10543842-10543864 CGGCTGGGCGGGGAGAGGGCGGG 0: 1
1: 1
2: 15
3: 131
4: 1022
1162416878_1162416893 6 Left 1162416878 19:10543809-10543831 CCGCCTGGCGACCCGGGATCGGG 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1162416893 19:10543838-10543860 AAGGCGGCTGGGCGGGGAGAGGG 0: 1
1: 0
2: 2
3: 117
4: 2218
1162416878_1162416897 14 Left 1162416878 19:10543809-10543831 CCGCCTGGCGACCCGGGATCGGG 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1162416897 19:10543846-10543868 TGGGCGGGGAGAGGGCGGGGCGG 0: 1
1: 2
2: 28
3: 266
4: 2285
1162416878_1162416898 15 Left 1162416878 19:10543809-10543831 CCGCCTGGCGACCCGGGATCGGG 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1162416898 19:10543847-10543869 GGGCGGGGAGAGGGCGGGGCGGG 0: 1
1: 13
2: 71
3: 603
4: 3735
1162416878_1162416899 16 Left 1162416878 19:10543809-10543831 CCGCCTGGCGACCCGGGATCGGG 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1162416899 19:10543848-10543870 GGCGGGGAGAGGGCGGGGCGGGG 0: 1
1: 11
2: 68
3: 474
4: 3062
1162416878_1162416892 5 Left 1162416878 19:10543809-10543831 CCGCCTGGCGACCCGGGATCGGG 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1162416892 19:10543837-10543859 AAAGGCGGCTGGGCGGGGAGAGG 0: 1
1: 0
2: 3
3: 72
4: 763
1162416878_1162416887 -6 Left 1162416878 19:10543809-10543831 CCGCCTGGCGACCCGGGATCGGG 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1162416887 19:10543826-10543848 ATCGGGGCAGGAAAGGCGGCTGG 0: 1
1: 0
2: 0
3: 21
4: 188
1162416878_1162416900 23 Left 1162416878 19:10543809-10543831 CCGCCTGGCGACCCGGGATCGGG 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1162416900 19:10543855-10543877 AGAGGGCGGGGCGGGGCGTCTGG 0: 1
1: 0
2: 5
3: 77
4: 596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162416878 Original CRISPR CCCGATCCCGGGTCGCCAGG CGG (reversed) Intergenic