ID: 1162418999

View in Genome Browser
Species Human (GRCh38)
Location 19:10555198-10555220
Sequence GCCCCTGTGTTGGGTGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 271}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162418994_1162418999 0 Left 1162418994 19:10555175-10555197 CCTGCTCTGACCTGCAGACAGAT 0: 1
1: 0
2: 2
3: 23
4: 199
Right 1162418999 19:10555198-10555220 GCCCCTGTGTTGGGTGCTCTGGG 0: 1
1: 0
2: 1
3: 33
4: 271
1162418989_1162418999 21 Left 1162418989 19:10555154-10555176 CCCGCTTGTCCCGCAGCTCCTCC 0: 1
1: 0
2: 3
3: 64
4: 470
Right 1162418999 19:10555198-10555220 GCCCCTGTGTTGGGTGCTCTGGG 0: 1
1: 0
2: 1
3: 33
4: 271
1162418993_1162418999 3 Left 1162418993 19:10555172-10555194 CCTCCTGCTCTGACCTGCAGACA 0: 1
1: 0
2: 4
3: 28
4: 305
Right 1162418999 19:10555198-10555220 GCCCCTGTGTTGGGTGCTCTGGG 0: 1
1: 0
2: 1
3: 33
4: 271
1162418995_1162418999 -10 Left 1162418995 19:10555185-10555207 CCTGCAGACAGATGCCCCTGTGT 0: 1
1: 0
2: 2
3: 16
4: 175
Right 1162418999 19:10555198-10555220 GCCCCTGTGTTGGGTGCTCTGGG 0: 1
1: 0
2: 1
3: 33
4: 271
1162418992_1162418999 11 Left 1162418992 19:10555164-10555186 CCGCAGCTCCTCCTGCTCTGACC 0: 1
1: 0
2: 15
3: 104
4: 702
Right 1162418999 19:10555198-10555220 GCCCCTGTGTTGGGTGCTCTGGG 0: 1
1: 0
2: 1
3: 33
4: 271
1162418991_1162418999 12 Left 1162418991 19:10555163-10555185 CCCGCAGCTCCTCCTGCTCTGAC 0: 1
1: 0
2: 11
3: 77
4: 637
Right 1162418999 19:10555198-10555220 GCCCCTGTGTTGGGTGCTCTGGG 0: 1
1: 0
2: 1
3: 33
4: 271
1162418990_1162418999 20 Left 1162418990 19:10555155-10555177 CCGCTTGTCCCGCAGCTCCTCCT 0: 1
1: 0
2: 1
3: 31
4: 378
Right 1162418999 19:10555198-10555220 GCCCCTGTGTTGGGTGCTCTGGG 0: 1
1: 0
2: 1
3: 33
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162418999 Original CRISPR GCCCCTGTGTTGGGTGCTCT GGG Intronic
900040460 1:458216-458238 GCTTCTGTGTTGGCTCCTCTAGG - Intergenic
900575967 1:3382603-3382625 GCCCATGTCTTGGGTGCATTAGG + Intronic
902711616 1:18243765-18243787 GCCCTTGTGTTGGGTGCTGCTGG + Intronic
903022285 1:20402786-20402808 GCCACTGTGCTGTGTGATCTTGG + Intergenic
903179997 1:21600403-21600425 GCCTCTGTGTTGGGCTCTGTGGG - Intronic
903269255 1:22177522-22177544 AACCCTGTGTTGGGTCCTCAGGG - Intergenic
903328853 1:22586686-22586708 GCCCCTGTGTTTGGTCCTCCAGG + Intronic
903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG + Intergenic
903550958 1:24157160-24157182 GCCCCTGTCCTCGGTCCTCTGGG + Exonic
904445531 1:30570625-30570647 TCCCCTGTGTGGAGGGCTCTGGG + Intergenic
906573263 1:46862703-46862725 GCACCAGTGTTGGCTGCTCCAGG - Intergenic
906880199 1:49581775-49581797 GCATCTGTGTTGGGAGTTCTAGG + Intronic
907297676 1:53465745-53465767 GCCCCAGTGCTGGGTGGCCTGGG + Intronic
907487733 1:54788868-54788890 GGTCCTGTGCTGGGTGCTCTGGG + Intronic
907881704 1:58555557-58555579 CCCCCAGTGGTGTGTGCTCTAGG - Intergenic
913168386 1:116210336-116210358 ACCTCTGTGTGGGGTGCCCTTGG - Intergenic
913552296 1:119927421-119927443 GTCCATGTGGTGGCTGCTCTTGG - Intronic
915590416 1:156867264-156867286 ACCCCTGTGCAGGGTGCCCTGGG - Intronic
915622983 1:157097546-157097568 GCCCCAGTGTTGTGTCCTCTGGG + Intronic
917261601 1:173175342-173175364 GCCACTGTGTTAGGTGTTCTGGG - Intergenic
919858477 1:201721726-201721748 GGCCCAGTGCTGGGAGCTCTTGG - Intronic
921187376 1:212682273-212682295 GCCCCTGTGTTGTTTGAACTTGG - Intergenic
922877826 1:228954254-228954276 GCCACCATGTTGGGAGCTCTGGG + Intergenic
924328256 1:242917418-242917440 AGCCCTGAGTTGGGTGATCTGGG + Intergenic
1065813735 10:29465462-29465484 GCACATGTTCTGGGTGCTCTGGG + Intronic
1066298951 10:34079987-34080009 GCCCCAGTGTTGGGTGTTGGAGG + Intergenic
1067836721 10:49646115-49646137 GCCCCAGTGGAGGGTGCTGTTGG + Intronic
1068348728 10:55816634-55816656 GCACTTCTGTTGGGTGCCCTAGG - Intergenic
1071266452 10:83968861-83968883 TCCCATGTGTTGGGTGCCTTAGG - Intergenic
1071557049 10:86612401-86612423 GCCACCATGTTGGGAGCTCTGGG + Intergenic
1072734194 10:97868031-97868053 TCCCCTGGGTTGGGTCCTGTTGG + Exonic
1073436226 10:103517848-103517870 GCCCAAGTGTTGGGTCCTCCTGG - Intronic
1075339302 10:121632857-121632879 GGCACTGCGTTGGGTGCTCAAGG + Intergenic
1075727431 10:124617680-124617702 CCCTCTGGGGTGGGTGCTCTTGG + Exonic
1076918490 10:133439164-133439186 GCCACTGTGTTGGGAGGACTTGG + Intergenic
1076978711 11:193958-193980 GGTGCTGTGTTGGGTGGTCTTGG - Intronic
1077805842 11:5590301-5590323 GCCCCTGTGTGGGATCCACTAGG + Intronic
1079124637 11:17709813-17709835 ACCCCTGTCCTGGGTGCTATTGG + Intergenic
1079158171 11:17968138-17968160 GGCTCTGTGTTAGGTGCTGTGGG - Intronic
1080396877 11:31898323-31898345 GGCCCTGTGCTGGGTGCTGTGGG - Intronic
1080657331 11:34268175-34268197 CCACCTGTCTTGGGTTCTCTTGG + Intronic
1080693852 11:34583926-34583948 GCCCCTGAATTGTGTGGTCTTGG + Intergenic
1080798793 11:35590085-35590107 GCACCTGTGTGTGGTCCTCTGGG - Intergenic
1083290224 11:61685856-61685878 GCCCGTCTGTTGTGTGCTGTAGG + Intronic
1084261198 11:67979913-67979935 GCCCCTGTGTTGGAGGGCCTTGG - Intergenic
1084411944 11:69010592-69010614 GCCCCTTTGATGGGCGCTCCTGG + Intronic
1084811458 11:71614184-71614206 GCCCCTGTGTTTGGGGGCCTTGG + Intergenic
1088358457 11:108967330-108967352 GCCACTGTGCTGGATGCTTTTGG + Intergenic
1091728555 12:2863136-2863158 GCGCCTGTGGTGGGTGCTACTGG + Intronic
1093474227 12:19537080-19537102 AACCCTGTGTCGGGTGTTCTTGG + Intronic
1094828347 12:34288621-34288643 GCCCCTGTGTGGGGACCTCGAGG + Intergenic
1094828565 12:34289501-34289523 GCCCCTGTGTGGGGTCCGCAGGG - Intergenic
1095470761 12:42534420-42534442 GCCCCTGTGCTGGATGCCCAAGG - Intronic
1096365833 12:51027414-51027436 TCCCAGGTGTGGGGTGCTCTTGG - Intronic
1097579315 12:61434182-61434204 TCCTCTGTGTTGCTTGCTCTGGG - Intergenic
1098111637 12:67128095-67128117 GCAACTTAGTTGGGTGCTCTTGG - Intergenic
1098593502 12:72242514-72242536 CCCTCTGTTTTGGGTGCTGTAGG + Intronic
1101860793 12:108480877-108480899 GCCCCTGTATTGGGTATTCATGG - Intergenic
1102172883 12:110855461-110855483 GCCTGTGTGTGGGGTGCTGTTGG - Intronic
1102973828 12:117191760-117191782 AGCCCTGTGTTGTGTGCCCTGGG + Intergenic
1104964160 12:132501515-132501537 GCCCCAGTGGTTGGTGCGCTGGG + Intronic
1105442942 13:20430352-20430374 GTCTCTGTGTTGGCTGCTGTGGG - Intronic
1105628281 13:22135288-22135310 GCCTCTGTGGAGGCTGCTCTGGG + Intergenic
1108534761 13:51363358-51363380 GCCACTGTGTTGTGTGATGTAGG - Intronic
1110364122 13:74662210-74662232 GCCCCTCTGCTGGGTCCCCTTGG + Intergenic
1113546921 13:111159882-111159904 GCCTCTGTTTTCGGTGCTTTTGG + Intronic
1117747018 14:58879969-58879991 GGCCCTGTGTTAGGTGCTGTGGG - Intergenic
1118925528 14:70187782-70187804 GCCCCAGCGGTGGGTGCTCTGGG + Intronic
1120854910 14:89203820-89203842 TCCCTTCTGTGGGGTGCTCTGGG - Intronic
1121301549 14:92875526-92875548 GGCCCTGTCCTGGGTGCTCCAGG + Intergenic
1122141725 14:99666827-99666849 GCCCCTGGGTTGGGGGGTCAGGG + Intronic
1122374130 14:101247343-101247365 AACCCTGTGTTGTGTCCTCTTGG - Intergenic
1122638214 14:103140272-103140294 GCCCCTGTGGAGGGTGATTTGGG + Intergenic
1122639800 14:103152370-103152392 GCCCCTGTGGAGGGTGATTTGGG - Intergenic
1122962110 14:105099166-105099188 GCCACTGTGCTGGGGGCTTTGGG + Intergenic
1123477237 15:20598620-20598642 TCCTCTGTGTGGGGTGATCTGGG - Intergenic
1123640776 15:22401744-22401766 TCCTCTGTGTGGGGTGATCTGGG + Intergenic
1123704761 15:22943118-22943140 GCCACTGAGCTGGGTGCTCTCGG + Intronic
1124143129 15:27095215-27095237 GCCCCTGTGTGGCTGGCTCTTGG + Intronic
1126075376 15:44904043-44904065 GGCACTGTGCTGGGTGCTGTGGG + Intergenic
1126082994 15:44983744-44983766 GGCACTGTGCTGGGTGCTGTGGG - Intergenic
1126161200 15:45615128-45615150 GCCCGTGGGTTGGCTACTCTTGG - Intronic
1127187459 15:56494123-56494145 GCCACTGTGCTGGGTGCTGTAGG - Intergenic
1128270900 15:66308536-66308558 AGCCCTGGGCTGGGTGCTCTGGG - Intronic
1128455157 15:67827866-67827888 CCCCCTGCGCTGGGTGCGCTGGG - Exonic
1128523582 15:68391508-68391530 GATGCTGTGTTGGCTGCTCTTGG + Intronic
1128803155 15:70509992-70510014 GCCCATGTGTAGGTTGCTCAGGG - Intergenic
1132441446 15:101869407-101869429 GCTTCTGTGTTGGCTCCTCTAGG + Intergenic
1132512269 16:349625-349647 GACCTTGTGCTGGGTGCTGTGGG - Intronic
1132591011 16:726491-726513 GCCCCTGTGGGCGGTGCCCTGGG - Intronic
1132642480 16:984119-984141 GCCCCTGTTTTTGGTGCACGAGG + Intronic
1133639488 16:7702978-7703000 CCCCCTGGTTGGGGTGCTCTGGG - Intronic
1134174299 16:11993367-11993389 GCCTCTGTGTTTGCTGCCCTGGG - Intronic
1135285297 16:21187967-21187989 GTGCCTGTGTTGGGTGCTGCTGG + Intergenic
1135616407 16:23914545-23914567 ACCCCTTGGTTGGGTGATCTTGG + Intronic
1136290194 16:29267137-29267159 TCCCCTATGTTGAGGGCTCTGGG - Intergenic
1136609865 16:31359695-31359717 GCTCCTGTCTTGGGCACTCTGGG - Exonic
1137445545 16:48529695-48529717 GCTCCTGTGTTAGCTTCTCTTGG + Intergenic
1137501662 16:49016202-49016224 GCCCGTGTGTGGTGTGCACTTGG + Intergenic
1139383233 16:66547765-66547787 GCTCCTGTGTGGGATGCACTGGG - Intronic
1139706566 16:68745014-68745036 GCCACTGTGCAGGGTGCTCAGGG + Intronic
1139846060 16:69922437-69922459 GTCCCTGGGTTGGGAGATCTGGG - Intronic
1139916364 16:70430762-70430784 CCACCTCTCTTGGGTGCTCTAGG - Intronic
1140248199 16:73270477-73270499 GACCCTGGGCTGGGTGCTGTGGG - Intergenic
1140374585 16:74434498-74434520 GCCCCTGTCATGGTTTCTCTCGG - Intergenic
1141812062 16:86382502-86382524 GTTCCTGAGTTGGGTGCTGTGGG + Intergenic
1142195515 16:88737615-88737637 GCCTCGGTGTCGGGTGCTGTGGG + Exonic
1142466140 17:138449-138471 GGTGCTGTGTTGGGTGGTCTTGG - Intronic
1145262743 17:21364595-21364617 GCCCCTCTCCTGGGTGCTTTGGG + Intergenic
1145262943 17:21365521-21365543 GCCCCTCTCCTGGGTGCTTTGGG + Intergenic
1146276733 17:31521135-31521157 TCCTCTGACTTGGGTGCTCTCGG + Intronic
1146516223 17:33491657-33491679 GCCCCTGTGTTAGAAGCTGTTGG + Intronic
1148145963 17:45365012-45365034 GGCCCTGTGCTTGGTGCTGTGGG + Intergenic
1148565392 17:48629598-48629620 GCCTCACTGTTGGCTGCTCTGGG - Intronic
1148987620 17:51637418-51637440 GCCACAGTGATGGGTGCTCATGG - Intronic
1149344968 17:55725529-55725551 CCCCCTGTCTGGGTTGCTCTTGG - Intronic
1149489025 17:57068619-57068641 GCCCCTGTCTTAGGTTCTGTTGG - Intergenic
1150855253 17:68746067-68746089 TCCCCTGTGTTTGTGGCTCTTGG + Intergenic
1151654040 17:75487241-75487263 GAGCCTGTGTTGGAGGCTCTGGG - Intronic
1152225941 17:79092842-79092864 GGGCCAGTGTGGGGTGCTCTGGG + Intronic
1153555856 18:6312534-6312556 GCCCCTTGGCTTGGTGCTCTTGG - Intronic
1154093535 18:11387896-11387918 AGTCCTGTGTTGTGTGCTCTTGG - Intergenic
1154201400 18:12303000-12303022 CCCTCAGCGTTGGGTGCTCTGGG + Intergenic
1154208722 18:12360651-12360673 GTCCCTGTGCTGGGCCCTCTGGG - Intronic
1157059439 18:44270652-44270674 GCCTTTATGTTGTGTGCTCTGGG + Intergenic
1157327309 18:46678496-46678518 TCCCACGTGCTGGGTGCTCTGGG - Intronic
1157943398 18:51953638-51953660 GACCCTGTGGTTGGGGCTCTAGG + Intergenic
1159431682 18:68360655-68360677 GCCTCTGTTTTGTATGCTCTAGG - Intergenic
1160294720 18:77627562-77627584 GCCCCTGTGGGGGGTGCTTCAGG - Intergenic
1160760065 19:779349-779371 GCCGCTGTGTTCGGTTATCTGGG - Intergenic
1161031264 19:2058752-2058774 GGCCCTGTGCTGGGTGGTCGGGG - Intergenic
1161592236 19:5134085-5134107 GCCCCTGCCTGGGGTTCTCTGGG - Intronic
1161619689 19:5291535-5291557 GCTCCTGTGCTCGCTGCTCTGGG + Intronic
1162418999 19:10555198-10555220 GCCCCTGTGTTGGGTGCTCTGGG + Intronic
1163484039 19:17576129-17576151 GCCCCTGTGTTGGGCACTAGGGG + Intronic
1163521378 19:17794025-17794047 GACCCAGCGTTGGGAGCTCTGGG - Intergenic
1164700451 19:30280802-30280824 GCTCCTGTGTAGGCAGCTCTGGG + Intronic
1164714130 19:30379271-30379293 GCCTCTGTGTTGGGAGCTCCCGG + Intronic
1164720794 19:30430369-30430391 GGCTCTGTGTTGGGTGCTGGGGG + Intronic
1165015041 19:32874715-32874737 GCGTCTGTGCTGGGTGCTCTGGG - Intergenic
1165072075 19:33261422-33261444 GCCCCTGGCTTGGCTGCTCTGGG + Intergenic
1166688195 19:44808536-44808558 TCCCCTGTGGTCAGTGCTCTGGG - Intergenic
1168258269 19:55179014-55179036 GCCCCGGGGTTGGGGGCTCCGGG + Exonic
925308418 2:2865720-2865742 GCCCCTGTCTGGGGTGGTGTGGG + Intergenic
925308446 2:2865795-2865817 GCCCCTGTCTGGGGTGGTGTGGG + Intergenic
925308474 2:2865874-2865896 GCCCCTGTCTGGGGTGGTGTGGG + Intergenic
925308525 2:2866006-2866028 GCCCCTGTCTGGGGTGGTGTGGG + Intergenic
925797529 2:7563116-7563138 GGCTCTGTGTTAGGTGCTATGGG - Intergenic
925925961 2:8670806-8670828 GCCCATGTGTTGGCTGCTTTGGG - Intergenic
926801543 2:16664823-16664845 GACCCTGTCTTGGGTTCCCTGGG + Intronic
930420806 2:51151552-51151574 GCCCCAGTGTGGGGTCCACTAGG - Intergenic
933701628 2:85259125-85259147 GCCACTGTGTGTGGTGCTGTGGG - Intronic
933854565 2:86400673-86400695 GACCCTGCAGTGGGTGCTCTGGG + Intergenic
934898568 2:98139425-98139447 GCCCCTGTGTGGGATCCACTGGG + Intronic
937115989 2:119405302-119405324 GCTCCTGGCTTGGCTGCTCTTGG - Intergenic
937303658 2:120858050-120858072 GCCTCTGTGTAGGGTGGTCGAGG + Intronic
938071488 2:128310688-128310710 CACCCTGGGTTGGGTGGTCTGGG + Intronic
940460544 2:153958566-153958588 ACCCCAGTGGTGGGTCCTCTGGG + Intronic
942317598 2:174709789-174709811 GCCCCTGCGGAGGGTGCCCTGGG - Intergenic
946176759 2:217927080-217927102 GCCCATGTGCTGCCTGCTCTCGG - Intronic
947443499 2:230143714-230143736 GGCCCCGTGTTGGGTCCCCTGGG - Intergenic
948050738 2:234977536-234977558 GCCCCAGAGCTGGGTGCTCTGGG - Intronic
948287307 2:236795840-236795862 TCCCCTGTCTTGTCTGCTCTTGG - Intergenic
949077331 2:242069219-242069241 GCCCCAGTGTTGGGTGCAGATGG - Intergenic
1172098104 20:32470434-32470456 GGCCCTGTGCTGGGTGCTGGAGG + Intronic
1172183501 20:33017642-33017664 GCCCCAGTGGTGTGTGCTCTTGG + Intronic
1174077775 20:47950500-47950522 GCCGGAGTGTTGGCTGCTCTAGG - Intergenic
1174140140 20:48406968-48406990 GCCAGAGTGTTGGCTGCTCTGGG + Intergenic
1174453002 20:50631203-50631225 TCACCTGTGTTAGGTGCTCAGGG - Intronic
1174773495 20:53322884-53322906 GCCTCTGTGTTTGGTGCTCATGG + Intronic
1176123371 20:63464231-63464253 GGCCCTGGGCTGGGAGCTCTGGG + Intronic
1178064330 21:28887317-28887339 GACCCTGTATTGGGTGCAATGGG - Intergenic
1179935353 21:44600539-44600561 GTCCGTGTGTTAGGTGCTCAGGG - Intronic
1180173959 21:46078547-46078569 GCGCCTGCGGTGGCTGCTCTGGG - Intergenic
1180708279 22:17822905-17822927 GCCCCTGTGGTGGGAGCTCAGGG - Intronic
1181007804 22:20022306-20022328 GCGTCTGTGTTGGGTGGGCTGGG + Intronic
1181100745 22:20537273-20537295 ACCCCTCTGTTGGGTGTCCTAGG + Intronic
1181173165 22:21021646-21021668 GCCCCTGAGCTGAGTGCCCTGGG + Intronic
1181800891 22:25347143-25347165 GCACCTGTGGAGGGTGCACTGGG - Intergenic
1182036495 22:27202752-27202774 GCCCCGGGGAGGGGTGCTCTCGG - Intergenic
1182401004 22:30078022-30078044 GCCCCTGTGCTAGGAGCTGTTGG - Intergenic
1183771340 22:39928554-39928576 CCTACTGTGTTGGGTGCTATGGG + Intronic
1184045668 22:41970994-41971016 GCTCCTATGTTGGCTGCTGTGGG + Intergenic
1184532734 22:45066699-45066721 TACCCTGTGTTGGGTGCTAATGG + Intergenic
949375622 3:3386338-3386360 TGCCCTGTGTTGAGTTCTCTGGG - Intergenic
949811614 3:8012620-8012642 GCCACTATCTTGGGAGCTCTGGG - Intergenic
950432364 3:12958224-12958246 GCCCCTGTGCTGGGTGCTGTGGG - Intronic
950839747 3:15956153-15956175 GCCCCTCAGCTGGGTGCTCTTGG - Intergenic
951574780 3:24102479-24102501 GGCACTGTGTTAGGTGCTGTAGG - Intergenic
951837707 3:27001500-27001522 GCCACTATCTTGGGAGCTCTGGG + Intergenic
952990049 3:38823931-38823953 GCCCCTGAGGTGGGGGCTGTGGG + Intergenic
953902307 3:46850222-46850244 GGCCCTGGGCTGGGAGCTCTGGG - Intergenic
954610965 3:51944303-51944325 GGCCCTGTGCTGAGTGCCCTGGG - Intronic
954646728 3:52136128-52136150 GCCCCTCTGTGGGGTACTCCAGG - Intronic
957687102 3:83515656-83515678 GCCACCGTCTTGGGAGCTCTGGG + Intergenic
958758863 3:98282977-98282999 GCCCCTGTTCTTGGTGTTCTTGG + Exonic
959531951 3:107443014-107443036 GTCCCTGTATTGGATGCTGTTGG + Intergenic
959912023 3:111774179-111774201 CCACCTCTGTTGTGTGCTCTTGG + Intronic
961115214 3:124323448-124323470 GGCTCTGTGTTGGGGGCTGTAGG - Intronic
961680094 3:128594199-128594221 GGCCCTGTGATGGTTCCTCTCGG - Intergenic
962961007 3:140310902-140310924 GCCTCTGTGTTAGGTGCTGCAGG + Intronic
964751935 3:160060951-160060973 GCCCCTGTGCAGGGTCCACTGGG + Intergenic
966863332 3:184242526-184242548 CTTGCTGTGTTGGGTGCTCTTGG + Exonic
967205204 3:187113190-187113212 GACACCGTGTTGTGTGCTCTTGG + Intergenic
967873654 3:194251915-194251937 GCCCTTGTTCTGGGTGCTGTGGG + Intergenic
967955011 3:194871340-194871362 GACACTGTGTTGGGTGCCTTGGG - Intergenic
968629244 4:1641713-1641735 GCCCCTGCTTTGTGTGGTCTTGG - Intronic
969485031 4:7467396-7467418 GCCTCTGGGTTGGGTGATCAAGG + Intronic
969721523 4:8895079-8895101 CCCCCTGCGTTGGGGACTCTAGG + Intergenic
969854769 4:9990365-9990387 GCTGCTGTGTTGGGTGCTAGGGG + Intronic
972661549 4:41121598-41121620 GCCACCGTGTTGTGTGTTCTGGG + Intronic
974279366 4:59772256-59772278 TCCTTGGTGTTGGGTGCTCTAGG + Intergenic
980893780 4:138841560-138841582 GCCTCTGTGTTAGGTGCCCCAGG - Intergenic
981832366 4:149017058-149017080 ACCCCTTTCTTTGGTGCTCTTGG + Intergenic
985542379 5:492889-492911 GCCCCTGGGTGGGGTGTTCTAGG + Intronic
985589419 5:756941-756963 GCCTCTGTCTTGGGCCCTCTGGG + Intronic
985718862 5:1478514-1478536 GTCCCTGTGTTCTGTGCTCGAGG + Intronic
986625723 5:9722196-9722218 TCCCCTGTGGGGGGTCCTCTTGG - Intergenic
988684661 5:33515325-33515347 GCCCCTGTGTGGGATCCACTGGG - Intergenic
992165538 5:74046956-74046978 TCCCCTTTGTTTGGTGCTCTGGG + Intergenic
993450128 5:88062516-88062538 GCCCCTGTGTTGGCAGCAGTGGG - Intergenic
995700474 5:114929331-114929353 GCCCCGGTGTGGGATCCTCTAGG + Intergenic
996765925 5:127033829-127033851 GCTGCTGTGGTGGGTGCTCCTGG + Intergenic
998117543 5:139549492-139549514 GCCGCTGTGGAGGGTGCACTGGG + Intronic
998474032 5:142406106-142406128 GCCCCTGCGTTTTGTCCTCTGGG + Intergenic
999393959 5:151214723-151214745 GCCCCTGACTTGTGTGCTCTGGG - Intronic
1000274371 5:159720189-159720211 AGCCCTGTGTTGGATGCTCTGGG + Intergenic
1001855818 5:175009752-175009774 GCCCCTGCCTAGGGTGCTATTGG + Intergenic
1002021699 5:176367770-176367792 GGCCCTGGATTGGGTGGTCTGGG - Intronic
1002187642 5:177462004-177462026 GCCCCGGTGATGGCTGCTCCGGG - Intronic
1002484091 5:179523038-179523060 GCCTCTGTGTGAGGTGCTCTGGG + Intergenic
1002500474 5:179644443-179644465 GCCTCTGTGTGAGGTGCTCTGGG - Intronic
1004503113 6:16226805-16226827 GCCCCAGTGCGGGATGCTCTGGG - Intergenic
1004959268 6:20768128-20768150 AGCGCTGTGTTGGGTGCTGTTGG + Intronic
1005976932 6:30807378-30807400 GCCCCAGTGTGGGGTCCACTAGG - Intergenic
1006803050 6:36771612-36771634 GGCACTGTGTTGGGTGCTGTGGG - Intronic
1007762401 6:44140707-44140729 GCCACTGTGCTGGGTTCTCAGGG + Intronic
1012189265 6:96260882-96260904 GCCCCTGTGTGGGATCCACTGGG - Intergenic
1015216514 6:130756211-130756233 GCTTCTGTCTTGGGTGGTCTTGG + Intergenic
1016246271 6:141984873-141984895 GCCCCTGTTTAGGGAGATCTTGG - Intergenic
1016364039 6:143296589-143296611 GTGCCTCTGTTGGGTGCTGTGGG - Intronic
1018909932 6:168096072-168096094 GCCCCGGAGATGGGAGCTCTTGG - Intergenic
1018941734 6:168312983-168313005 GCCCCTGAGTTGGGTCCTGGAGG - Intronic
1019170424 6:170130515-170130537 GACCCTGTGTGGGGTACTCCAGG + Intergenic
1019237637 6:170633051-170633073 GCTTCTGTGTTGGCTCCTCTAGG + Intergenic
1019412179 7:911458-911480 GCCCCTGTGTGGGGGCCTCAGGG - Intronic
1019489160 7:1303149-1303171 GCTCCCGAGTTGGCTGCTCTTGG + Intergenic
1020099093 7:5384602-5384624 GCACCTTTGTTGGGGGCTCACGG - Intronic
1021359331 7:19692187-19692209 GCCCCTGTGTGGGATCCACTAGG - Intergenic
1022075085 7:26960553-26960575 TCCCCTGTGTTTGCTGCTCTGGG - Intronic
1022334147 7:29406720-29406742 GCCACTGTGTGGGGGACTCTGGG + Intronic
1022480832 7:30741995-30742017 GCCGTTGTGCTGGGGGCTCTGGG - Intronic
1022952694 7:35353651-35353673 GCTCCTGCGTGGGCTGCTCTAGG + Intergenic
1026020201 7:66700007-66700029 TCCCCTGAGTTGGGGTCTCTGGG - Intronic
1031869428 7:127075931-127075953 GGCCTTCTGCTGGGTGCTCTTGG - Intronic
1033425448 7:141239633-141239655 CCCCCTGTGGTGGGTGCCGTGGG - Intronic
1034385441 7:150737154-150737176 GCCCCGGTGATGGGTGCTGAGGG + Intronic
1034576727 7:152006171-152006193 GCCACTGTGTTGGATGCTGCTGG - Intronic
1035307903 7:157945161-157945183 GCCCCAGTGCTGGGTGTTCAGGG + Intronic
1035510131 8:173560-173582 GCTTCTGTGTTGGCTCCTCTAGG - Intergenic
1035535884 8:391103-391125 GCCCCAGTGTTGGGTGCAGATGG - Intergenic
1036260538 8:7236074-7236096 GCTCCTGTGCTGGGTCCACTGGG + Intergenic
1036306075 8:7603448-7603470 GCTCCTGTGCTGGGTCCACTGGG - Intergenic
1036312575 8:7694630-7694652 GCTCCTGTGCTGGGTCCACTGGG + Intergenic
1036356921 8:8051433-8051455 GCTCCTGTGCTGGGTCCACTGGG - Intergenic
1036599713 8:10249069-10249091 GCCACTCTCTTGGGTGTTCTGGG + Intronic
1039862841 8:41473927-41473949 GCTCCCTTGTAGGGTGCTCTAGG - Intergenic
1039907608 8:41798103-41798125 GCCCCTGGGTTGGGAGCAGTCGG + Intronic
1040276934 8:46018610-46018632 GCCTCTGTGTGGGGTCCACTGGG - Intergenic
1041653987 8:60330452-60330474 GGCCCTGGGTGGGGTGCTCATGG + Intergenic
1042159877 8:65881927-65881949 GCCCTTGTGTTTGGTGGTGTTGG + Intergenic
1042499465 8:69492535-69492557 GCTACTGTGTCGGGTGCTCAGGG + Intronic
1045269960 8:100653187-100653209 TGGTCTGTGTTGGGTGCTCTAGG + Intronic
1046183732 8:110686276-110686298 GCCACTGTGCTAGGTGCTGTGGG + Intergenic
1046521321 8:115330503-115330525 GCCCCTGTGTGGGATCCACTAGG - Intergenic
1049005729 8:139854478-139854500 GGTCCTGTGCTGGGTGCTCCAGG - Intronic
1049378526 8:142300924-142300946 TCCCCTCTGCTGGGTGCTCCCGG - Intronic
1049749290 8:144275810-144275832 GCCCCTGTCGTGTGTGCTGTGGG - Intronic
1049760188 8:144328660-144328682 GCCCATGTGTGAGGGGCTCTTGG - Intergenic
1052504346 9:29332870-29332892 TCCCCTGCTTTGGGTGATCTTGG + Intergenic
1053062954 9:35045595-35045617 GCCCCTGTGTTGAGACCTTTGGG - Exonic
1053215253 9:36265350-36265372 GCCACCATGTTGGGAGCTCTGGG + Intronic
1053575713 9:39356283-39356305 TCCCCTGTGTGGGGTGATCTGGG + Intronic
1053840233 9:42184240-42184262 TCCCCTGTGTGGGGTGATCTGGG + Intronic
1054097283 9:60914988-60915010 TCCCCTGTGTGGGGTGATCTGGG + Intergenic
1054118689 9:61190617-61190639 TCCCCTGTGTGGGGTGATCTGGG + Intronic
1054589068 9:66991947-66991969 TCCCCTGTGTGGGGTGATCTGGG - Intergenic
1055461388 9:76523665-76523687 GCCCCTGTGTGGGATCCACTGGG - Intergenic
1056349782 9:85738699-85738721 GACCCTGAGCTGGGTGCCCTGGG - Intronic
1057858023 9:98617233-98617255 GGCTCTGGGTTGGGTGCTCAGGG + Intronic
1058447286 9:105065243-105065265 GCCATTGTTTTGAGTGCTCTAGG - Intergenic
1060483925 9:124035358-124035380 CTCCCTGTGTGGGGTGGTCTGGG - Intergenic
1061093135 9:128438466-128438488 ACCTCTGTGCTGGGTGATCTTGG + Intergenic
1061549139 9:131323009-131323031 GTGCCTGTTTTGGGTTCTCTTGG + Intergenic
1062009340 9:134258859-134258881 CAGCCTGGGTTGGGTGCTCTGGG + Intergenic
1187143478 X:16616540-16616562 GCCTCTAGGTTAGGTGCTCTGGG - Intronic
1187398400 X:18937919-18937941 GCCCTAGTTTGGGGTGCTCTTGG - Intronic
1191047144 X:56150599-56150621 CCTGCTGTGTTGGATGCTCTTGG + Intergenic
1191249958 X:58255542-58255564 GCCCCTGTGCTGGGCCCTCTGGG - Intergenic
1192182584 X:68925598-68925620 GCCATTGTGTTGGGTGCTGAGGG - Intergenic
1194173479 X:90617969-90617991 GCAGCTGTGAAGGGTGCTCTGGG - Intergenic
1198387178 X:136140465-136140487 GGCCCTGTGCTTGGTGCACTAGG - Intergenic
1199875104 X:151922468-151922490 ACCCCTGTGTGGGGTGCCCAGGG - Intronic
1200519699 Y:4195661-4195683 GCAGCTGTGGAGGGTGCTCTGGG - Intergenic
1200746953 Y:6911308-6911330 GCCCCTTTGTTTGCCGCTCTTGG + Intronic
1201077714 Y:10199727-10199749 ACCCGTGGGTTGGGTGCTGTGGG + Intergenic