ID: 1162419055

View in Genome Browser
Species Human (GRCh38)
Location 19:10555443-10555465
Sequence GCAACCCTGCTGGGTGGTAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162419055_1162419062 11 Left 1162419055 19:10555443-10555465 CCGCTACCACCCAGCAGGGTTGC 0: 1
1: 0
2: 0
3: 17
4: 163
Right 1162419062 19:10555477-10555499 GAGACAGCTGATCTCTACAGAGG 0: 1
1: 0
2: 3
3: 14
4: 138
1162419055_1162419063 30 Left 1162419055 19:10555443-10555465 CCGCTACCACCCAGCAGGGTTGC 0: 1
1: 0
2: 0
3: 17
4: 163
Right 1162419063 19:10555496-10555518 GAGGCCAATGATTTTTGTAGAGG 0: 1
1: 0
2: 1
3: 14
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162419055 Original CRISPR GCAACCCTGCTGGGTGGTAG CGG (reversed) Intronic
900743461 1:4344366-4344388 GCATCCCTGCAGGCTGGCAGGGG + Intergenic
901827972 1:11874909-11874931 GCAACCCTGGAGGCTGGGAGAGG + Intergenic
901837102 1:11931285-11931307 GGATCCCAGCTGGGAGGTAGGGG + Intergenic
903439515 1:23377089-23377111 GAAGCCCTCCTGGGTGGCAGAGG + Intergenic
905303755 1:37003813-37003835 GCCACCCTGCTGGGCTGAAGGGG + Intronic
906075010 1:43045727-43045749 GCAACCATGATGGGTGGCATGGG - Intergenic
908424225 1:63990088-63990110 TCATGCCTGCTGGGTGCTAGTGG - Intronic
909487205 1:76187597-76187619 GCAATCCTGCTGGAAGGCAGGGG + Intronic
918099993 1:181364906-181364928 GCAGCCCTGCTGGCAGGAAGGGG - Intergenic
919131759 1:193459882-193459904 GGGACCCTGCTGAGTGGCAGAGG + Intergenic
919900731 1:202042568-202042590 GCCACTCTGCAGGGTGGCAGGGG + Intergenic
921148679 1:212382939-212382961 GGAACCCTGCAGGGTGGGACCGG - Intronic
922623168 1:227006999-227007021 GCAATTCTGCTTGGTGGTGGGGG + Intronic
923261270 1:232270024-232270046 GCAATCCTGCAGTGGGGTAGAGG - Intergenic
1062896379 10:1106333-1106355 GCAGCACTGGTGGGAGGTAGGGG - Intronic
1063452895 10:6163507-6163529 GGGACCCAGCTGGGAGGTAGGGG + Intronic
1066015954 10:31243679-31243701 GCAAACCTGCTGGGTGTTCAAGG - Intergenic
1067087773 10:43251974-43251996 GAGGCCCTGCTGGATGGTAGCGG + Intronic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1069944113 10:71974287-71974309 ACAACCTTGCCGGGTTGTAGGGG - Intronic
1071482965 10:86078831-86078853 GCATCCATGCTGGGTGCTGGGGG - Intronic
1074728963 10:116348174-116348196 GCAACTCTTCTTGGTGGTGGTGG + Intronic
1075392292 10:122101005-122101027 GCTACTCTGGTGGGAGGTAGGGG - Intronic
1076790705 10:132775332-132775354 GCATACCTGCTGGGTGGGGGGGG - Intronic
1077908562 11:6555044-6555066 GCTAGTCTGCTGGGTGGGAGAGG - Intronic
1078103870 11:8346298-8346320 GTGACCCTGCGGGGTGGGAGAGG + Intergenic
1078334822 11:10455320-10455342 TCAACCCTGCTTGGTTTTAGAGG + Intronic
1078570272 11:12452046-12452068 GTAGCCCTGCAGGGTGGTGGTGG - Intronic
1080255135 11:30282111-30282133 GCATCCATGCTGGGCGGTGGAGG - Intergenic
1081797192 11:45828845-45828867 TCTAGCCTGCTGGGTGGGAGAGG + Intergenic
1082050110 11:47764003-47764025 GCAACAGTGTTGGGAGGTAGGGG + Intronic
1084647198 11:70465382-70465404 GCAAGCATGCTGGGTGTTAAAGG + Intergenic
1084918560 11:72450328-72450350 GCCACCATGTTGGGTGCTAGGGG + Intergenic
1090485554 11:127109095-127109117 GCAGCCCTGAGGGGTGGGAGTGG + Intergenic
1091316156 11:134615443-134615465 GCAGCCCTGTTGTGTGGTAGAGG - Intergenic
1096536897 12:52280643-52280665 GCCACCCTCCTGAGGGGTAGGGG + Intronic
1096648932 12:53052611-53052633 GAACCCCTCCTGGGTGGGAGGGG + Intronic
1097177618 12:57152430-57152452 GCCACCCTGCTGGCTGCCAGGGG + Intronic
1097678825 12:62630532-62630554 GCAATCCTGCCGGGTGGAATTGG - Intergenic
1102587539 12:113933588-113933610 GCAGCCCCTCTGGGAGGTAGGGG + Intronic
1102960423 12:117089334-117089356 GGAATCCTGTGGGGTGGTAGGGG + Intronic
1104871592 12:132002483-132002505 GCAGCCTTGCTGGGTGGTTGTGG + Intronic
1105069576 12:133226510-133226532 GCAGCCCTGCTGGCTGGAAAAGG + Intronic
1106720207 13:32428227-32428249 GGAACCGTGCTGCGTGGGAGGGG + Intergenic
1111195377 13:84869698-84869720 GGATACCTGCTGGGTGGTATGGG + Intergenic
1112274660 13:98005235-98005257 TCAACCCAGCTGGGATGTAGTGG + Intronic
1117224380 14:53639508-53639530 GCAACCCCGCTTGGTGGAAGAGG - Intergenic
1118974607 14:70665920-70665942 ACAACCCGGCTGGGTGGCTGGGG - Intronic
1120171331 14:81249335-81249357 GCAAGCCTGCTGGTTCCTAGAGG + Intergenic
1122271338 14:100569601-100569623 CCAAGCCTGCTGGGTGCTGGGGG - Intronic
1122327523 14:100891443-100891465 CCCACCCTGCTGGGTGGTTTGGG - Intergenic
1128178021 15:65574166-65574188 GCAGCCTGGCTGGGTGGTACTGG + Intronic
1131066000 15:89435514-89435536 GCCCCCCTGGTGGGTGGTGGGGG + Intergenic
1133979447 16:10622441-10622463 GCAGCCTTGCTGGGTGGGGGTGG + Intergenic
1136268765 16:29136174-29136196 CCAGCCCTGCTGTGTGGGAGGGG - Intergenic
1136619172 16:31416598-31416620 ACAGCCCTGCTGGATAGTAGAGG - Exonic
1138444979 16:57058072-57058094 GCAAACCTGCTGGGCGACAGCGG + Exonic
1139091789 16:63657585-63657607 GAACCCCTGGTGGGTGGTGGGGG - Intergenic
1139747587 16:69087112-69087134 GAAAGGCTGCTGGGTGGTGGAGG - Intergenic
1141392843 16:83678911-83678933 GCAGCCCAGCTTGGTGGTAGAGG + Intronic
1142072070 16:88096540-88096562 CCAGCCCTGCTGTGTGGGAGGGG - Intronic
1142229431 16:88892910-88892932 GCACCCCTGCTGGGTGTGAAGGG - Intronic
1143848407 17:9791019-9791041 GCAAACCTGCTCGGTGGGAGGGG - Intronic
1143879553 17:10019604-10019626 CCCACTGTGCTGGGTGGTAGGGG - Intronic
1144444550 17:15314873-15314895 GCCACCCTGCTGGAAGGAAGAGG + Intronic
1144520133 17:15947658-15947680 CCAACCCTGGTGGGTGGGAGAGG + Intronic
1144608773 17:16690356-16690378 GCTATCCTGCTGGGAGGTTGTGG + Exonic
1144786894 17:17837001-17837023 GCAGCTCTGCTGGGCGGTCGAGG + Intronic
1144904043 17:18625470-18625492 GCTATCCTGCTGGGAGGTTGTGG - Intergenic
1145128541 17:20321272-20321294 GCTATCCTGCTGGGAGGTTGTGG + Intergenic
1145190411 17:20837315-20837337 GCAACTTTGCTGCATGGTAGTGG - Intronic
1145196083 17:20896043-20896065 GCTATCCTGCTGGGAGGTTGTGG - Exonic
1146782125 17:35683725-35683747 GCAACCCTGGAGGTTGCTAGCGG + Intronic
1148035340 17:44656071-44656093 GCAGCCCTACCGGGTGGGAGAGG - Intergenic
1151554372 17:74839203-74839225 GAAGCACTGCTGGGTGGTGGAGG + Exonic
1152076732 17:78164552-78164574 GCAACCCTCCTGGGAGGGGGCGG - Intronic
1152230586 17:79112332-79112354 GCATCCCACCTGGGTGGTGGAGG + Intronic
1154215901 18:12415907-12415929 CCATCCATGCTGGGTGGCAGCGG + Intronic
1156419226 18:36933277-36933299 GCAGCCCTGCTCTGTGGTGGTGG + Intronic
1157950676 18:52033526-52033548 GGTACCCTGCTGGTTTGTAGTGG + Intergenic
1159479202 18:68966013-68966035 GCAATCCTGCTGAGAGGTCGAGG + Intronic
1160947430 19:1650282-1650304 GAAACCCTGCTTGGTGGATGTGG + Exonic
1162419055 19:10555443-10555465 GCAACCCTGCTGGGTGGTAGCGG - Intronic
1168303116 19:55418281-55418303 GGAACTCTCCTGGGTGGGAGAGG + Intergenic
927116123 2:19903588-19903610 GAATCCCTTCTGGGTGGAAGTGG + Intergenic
927886477 2:26721614-26721636 GCTCCCCTGCTGGATGGCAGAGG - Intronic
928363444 2:30683941-30683963 GGAACCATTCTGGGTGGTAACGG - Intergenic
929359830 2:41074376-41074398 TCATTCCTGCTGGGTGGTGGTGG + Intergenic
930994502 2:57700098-57700120 GCATTCCTTCTGGGTGGCAGAGG - Intergenic
932875239 2:75444309-75444331 CCAACTCAGCTGGGTGGTATTGG + Intergenic
935121216 2:100185182-100185204 GCAACACTGCTGCCTGGTAGAGG - Intergenic
938062320 2:128263163-128263185 GCCACGAGGCTGGGTGGTAGAGG + Intronic
938945846 2:136211358-136211380 GCAACCCTACTTGGGGATAGAGG + Intergenic
944363410 2:198886581-198886603 GCAGCCCTCCTGGTTGGTATTGG - Intergenic
948064842 2:235069932-235069954 GCAATCCTGCAGACTGGTAGAGG - Intergenic
948838402 2:240637189-240637211 GAAACCGGGCTGGGTGGTGGGGG - Intergenic
1168805380 20:669597-669619 TGGGCCCTGCTGGGTGGTAGGGG + Intronic
1173080043 20:39857309-39857331 GCAACTTTGCTGGGTGGTTCTGG - Intergenic
1174295151 20:49540407-49540429 GCAACCGTGCCTGGTGGGAGAGG + Intronic
1176069902 20:63220782-63220804 GCAACCCAGATGGGAGGCAGAGG + Intergenic
1177051588 21:16241742-16241764 GCCACCCTGCTGGCTAGTAATGG - Intergenic
1178865033 21:36320206-36320228 GCAACCCGACTGGGAGGTGGCGG - Exonic
1178927492 21:36787908-36787930 GCAGCCCTGCTGGTGGGTAGGGG - Intronic
1179931615 21:44574546-44574568 GCAAGCCTGCTGGCAGGGAGAGG - Exonic
1181643065 22:24214958-24214980 GCACCCCTGCTGGGGGGAACAGG + Intergenic
1181713295 22:24705356-24705378 GCCATCCTCCTGGGTGGGAGAGG + Intergenic
1183203813 22:36404668-36404690 GCAGCCCAGCTGGGTGCTAATGG + Intergenic
1183986376 22:41572613-41572635 CTAACCCTGCTGGGTGGTAATGG - Intronic
1185148403 22:49151314-49151336 GGATCTCTGCTGGGTGATAGGGG + Intergenic
950549282 3:13656406-13656428 GCAAACCAGCTAGGTGGCAGGGG + Intergenic
950581799 3:13867160-13867182 CCCACCTTGCTAGGTGGTAGTGG - Intronic
950743874 3:15071501-15071523 CCAACCCTGCTGGTTGTTATGGG - Exonic
952944488 3:38468539-38468561 GCAACCATGATGAGTGGTGGTGG + Intronic
953754392 3:45634006-45634028 GCTACCTTGCTGGGTGCTAGGGG + Intronic
954214456 3:49116720-49116742 GCAACCTTGGTGGATGGTAAAGG - Exonic
959051584 3:101529461-101529483 GCATCACTTGTGGGTGGTAGAGG - Intergenic
961012365 3:123444959-123444981 CAAACCCTGCTGGCTGGTGGGGG - Intronic
961368372 3:126415324-126415346 GAGACCCTGCTGGGTGGGGGAGG - Intronic
961741905 3:129038412-129038434 GCCACCCAGCTGGGAGGTGGAGG - Intronic
962343118 3:134601786-134601808 GCCACCGTGCTGGGTGGCAGTGG + Intronic
963756003 3:149235570-149235592 GCAACTGTGCTGTGTTGTAGGGG - Intergenic
965676179 3:171199279-171199301 GGATCCCTGCTGTGTGGTGGCGG - Intronic
966634832 3:182120927-182120949 ACAGCCCTGCAGGGAGGTAGAGG + Intergenic
967993576 3:195150146-195150168 GCAGCACTCCTGGGTGGTGGTGG - Intronic
968753459 4:2402235-2402257 ACAGCCCTGCTGGGTGGGCGGGG + Intronic
972705396 4:41537987-41538009 GCAAACCTACTGTGTGCTAGTGG + Intronic
976256875 4:83108969-83108991 CGGACCCTGCTGTGTGGTAGGGG + Intronic
980944137 4:139302191-139302213 GGAACCCTGCTGGCAGGTCGGGG + Intronic
985475422 5:76303-76325 CCAACTCTGCTGAGAGGTAGAGG + Intergenic
985846473 5:2353516-2353538 GCCACCCTGCATGGTGGAAGAGG + Intergenic
986380818 5:7183891-7183913 TCAACTCTCCTGCGTGGTAGAGG + Intergenic
986610512 5:9562276-9562298 GCCACCCTGCTGGGGGTGAGTGG - Intergenic
986997863 5:13627854-13627876 GCAGCCCATGTGGGTGGTAGGGG - Intergenic
987236644 5:15949420-15949442 GCTACCCTGTTGGGTGGCACAGG - Intergenic
988976547 5:36521935-36521957 GGAATCCTGCTGCGTTGTAGTGG - Intergenic
996412227 5:123170844-123170866 GGAGCGCTGCTGGGTGGTAGGGG - Exonic
1001637366 5:173220874-173220896 GCACTCCAGCTGGGTGATAGAGG - Intergenic
1002070094 5:176674015-176674037 GCAACCCCACTGGGTGGGGGTGG + Intergenic
1003094250 6:3130248-3130270 GCAGCAATGCTGGGTGGTAAAGG - Intronic
1003420435 6:5952913-5952935 GAAGCCTTGCTGGGTCGTAGGGG - Intergenic
1005240959 6:23825693-23825715 GCACCCTTGCTTGGTGGTGGTGG - Intergenic
1006272246 6:32973295-32973317 GCAACCCTACAGGGCGCTAGAGG - Intronic
1010275472 6:73963714-73963736 GCAACCCAGCTAGGTGGCATTGG + Intergenic
1010321444 6:74514898-74514920 ACCACCCTGTTGGGTGGTAGGGG - Intergenic
1010686876 6:78863752-78863774 GCAACCTTGGTGGGTGGCATGGG - Intergenic
1012623338 6:101376351-101376373 GAAACACTGCTGACTGGTAGTGG + Intergenic
1015905655 6:138114039-138114061 CCCACCCTGTTGGGTGATAGAGG + Intergenic
1016282658 6:142436104-142436126 GGAATCCTGGTGGGGGGTAGGGG + Intronic
1016641199 6:146351516-146351538 GCAAACCTGCTTGGCAGTAGGGG + Intronic
1022088124 7:27088347-27088369 GCGACCCTGCGGGGTTGTAGAGG - Intergenic
1022120399 7:27302773-27302795 ACAACCCTGGTGGCTGGCAGAGG - Intergenic
1022636441 7:32140726-32140748 GGCACCCTGCTGGCTGGTAAGGG - Intronic
1022872646 7:34495392-34495414 GCAATCCTGCTGGGAGGTGAAGG - Intergenic
1023316939 7:38947747-38947769 GCATTCCTTCTGGGTGGCAGAGG + Intergenic
1023967499 7:44970542-44970564 GCAAAGCTGCTGGGTGTCAGAGG + Intronic
1024134940 7:46397147-46397169 GCCACCCTGCTGGATGGTGGTGG + Intergenic
1024788417 7:52934474-52934496 GCAACCATTCAGGCTGGTAGTGG + Intergenic
1025262349 7:57427271-57427293 TCAACCCTCCTGGGTGGGAAAGG + Intergenic
1026230011 7:68474569-68474591 GCCACCCTGGTGAGTGGCAGGGG + Intergenic
1028422358 7:90648124-90648146 GCAACCTAGCTGGGTGGTTTAGG + Intronic
1029364462 7:100107920-100107942 GCATACCTGCTGGGTGGATGGGG + Exonic
1030590635 7:111477228-111477250 CCAGCCCTGGTGGTTGGTAGAGG - Intronic
1034941622 7:155234323-155234345 GCCACCTTGCTGGATGGTTGAGG - Intergenic
1037645032 8:20785270-20785292 CCAACCCTGTTGGGTGATCGTGG + Intergenic
1039260586 8:35766978-35767000 GCAGGACAGCTGGGTGGTAGTGG - Exonic
1044732290 8:95238956-95238978 GCAACAGTGGGGGGTGGTAGGGG - Intergenic
1044866428 8:96575349-96575371 GCAAACCTGCGGGGTGGTGGGGG + Intronic
1047298240 8:123589772-123589794 GACACCCTTCTGGGTGCTAGAGG - Intergenic
1048469949 8:134696753-134696775 GGACCCCTGCTGGGTGGGGGCGG - Intronic
1048472240 8:134713511-134713533 GCCACCCGGCTGGGTTTTAGGGG + Intergenic
1049131588 8:140849454-140849476 GCAATTCTGCTGGGAGTTAGTGG - Intronic
1049596165 8:143484304-143484326 GCAGCCTGGCTGGGTGGCAGGGG + Intronic
1053059416 9:35018692-35018714 GCACCCCTGCTGGAGTGTAGTGG - Intergenic
1055945147 9:81687265-81687287 GCCACCCGGCTGGGTGCAAGGGG + Intronic
1060817243 9:126641563-126641585 GGAACCCAGCTGGGTGGGGGTGG - Intronic
1062029455 9:134355681-134355703 GCACCCCCGCTGGGTGGGGGAGG + Intronic
1189025029 X:37385638-37385660 GCAACTCAGCTGGGTGGTTTTGG + Intronic
1190491783 X:50989880-50989902 GCATCGCTGCTGGGTAGGAGGGG - Intergenic
1190836298 X:54104133-54104155 GCAGCCCTGCTGAATGGGAGAGG - Intronic
1195062140 X:101206676-101206698 TGCACCCTGCTGGTTGGTAGGGG + Intergenic
1199596678 X:149511447-149511469 GCAACCTTGCTGGGTGGGTGAGG + Intronic