ID: 1162420992

View in Genome Browser
Species Human (GRCh38)
Location 19:10565993-10566015
Sequence GGGCCACAGAACCGCCATGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 77}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162420992_1162421000 15 Left 1162420992 19:10565993-10566015 CCGGCATGGCGGTTCTGTGGCCC 0: 1
1: 0
2: 0
3: 13
4: 77
Right 1162421000 19:10566031-10566053 TGAGGAAGCCCTGGACGGGGCGG 0: 1
1: 0
2: 2
3: 25
4: 312
1162420992_1162420997 10 Left 1162420992 19:10565993-10566015 CCGGCATGGCGGTTCTGTGGCCC 0: 1
1: 0
2: 0
3: 13
4: 77
Right 1162420997 19:10566026-10566048 CGCATTGAGGAAGCCCTGGACGG 0: 1
1: 0
2: 0
3: 16
4: 122
1162420992_1162421002 17 Left 1162420992 19:10565993-10566015 CCGGCATGGCGGTTCTGTGGCCC 0: 1
1: 0
2: 0
3: 13
4: 77
Right 1162421002 19:10566033-10566055 AGGAAGCCCTGGACGGGGCGGGG 0: 1
1: 0
2: 2
3: 24
4: 332
1162420992_1162420999 12 Left 1162420992 19:10565993-10566015 CCGGCATGGCGGTTCTGTGGCCC 0: 1
1: 0
2: 0
3: 13
4: 77
Right 1162420999 19:10566028-10566050 CATTGAGGAAGCCCTGGACGGGG 0: 1
1: 0
2: 1
3: 11
4: 163
1162420992_1162420996 6 Left 1162420992 19:10565993-10566015 CCGGCATGGCGGTTCTGTGGCCC 0: 1
1: 0
2: 0
3: 13
4: 77
Right 1162420996 19:10566022-10566044 CACGCGCATTGAGGAAGCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 57
1162420992_1162420998 11 Left 1162420992 19:10565993-10566015 CCGGCATGGCGGTTCTGTGGCCC 0: 1
1: 0
2: 0
3: 13
4: 77
Right 1162420998 19:10566027-10566049 GCATTGAGGAAGCCCTGGACGGG 0: 1
1: 0
2: 1
3: 26
4: 324
1162420992_1162421001 16 Left 1162420992 19:10565993-10566015 CCGGCATGGCGGTTCTGTGGCCC 0: 1
1: 0
2: 0
3: 13
4: 77
Right 1162421001 19:10566032-10566054 GAGGAAGCCCTGGACGGGGCGGG 0: 1
1: 0
2: 3
3: 44
4: 377
1162420992_1162420994 -3 Left 1162420992 19:10565993-10566015 CCGGCATGGCGGTTCTGTGGCCC 0: 1
1: 0
2: 0
3: 13
4: 77
Right 1162420994 19:10566013-10566035 CCCATTGCGCACGCGCATTGAGG 0: 1
1: 0
2: 0
3: 1
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162420992 Original CRISPR GGGCCACAGAACCGCCATGC CGG (reversed) Exonic
900329782 1:2128255-2128277 GTGCCACAGGACGGCCCTGCGGG - Intronic
902892525 1:19454623-19454645 GGGCCACAGAGCTGCCAAGCAGG + Intronic
904006666 1:27366580-27366602 GGGACACGGCCCCGCCATGCGGG + Exonic
904433107 1:30477821-30477843 GGGCCAGAGCATCGCCATGGTGG - Intergenic
905642039 1:39596721-39596743 GGGTCCCAGAAGAGCCATGCGGG + Intergenic
913197808 1:116472535-116472557 GGGCCACAGATCCTACATGCTGG - Intergenic
915169473 1:153967947-153967969 GGGCTACAGAACAGGCATTCAGG + Exonic
919788789 1:201276904-201276926 GGGCCACAGAACAGCACTGCTGG + Intergenic
1076579733 10:131499289-131499311 GGGCCACACACCGGCCATGCTGG - Intergenic
1083618527 11:64037730-64037752 GGGCTACGGAGCCTCCATGCTGG - Intronic
1085043403 11:73340040-73340062 GGGCCACGGTACCCCTATGCAGG - Intronic
1085126623 11:74006474-74006496 GGGCCTGAGAACAACCATGCTGG + Intronic
1086773260 11:90796029-90796051 GGCCCACAGAAACGAAATGCAGG - Intergenic
1102052629 12:109873975-109873997 GTGCCACAGACCAGACATGCAGG - Intronic
1102219970 12:111187721-111187743 GGGCCACAGAAACCCCAGGCTGG - Intronic
1107605068 13:42048734-42048756 GGGACACAGCACCGCCCGGCGGG - Exonic
1117424622 14:55580833-55580855 GGGCCACACTTACGCCATGCTGG + Intronic
1122257455 14:100489280-100489302 GAGCCACAGCACCGCAAAGCTGG - Intronic
1122548344 14:102537303-102537325 GGGCCCCAGAAGTGCCTTGCCGG - Intergenic
1123119786 14:105911307-105911329 GGGCCACTGCACCACCAGGCAGG - Intergenic
1125732791 15:41903168-41903190 GGGCCAAAGAGAGGCCATGCAGG + Intronic
1129065462 15:72900320-72900342 GCTCCAGAGAACAGCCATGCAGG + Intergenic
1133118522 16:3592091-3592113 GGGCCACAGAGCCTTCAAGCAGG - Intronic
1137607071 16:49793926-49793948 GGGCTACAGAACCCCACTGCTGG - Intronic
1142743778 17:1944955-1944977 GGGCCACAGAACAGACTTGGAGG - Intronic
1143870450 17:9954334-9954356 GGGCCACAGAAGCACCCTGCAGG + Intronic
1148086530 17:44996947-44996969 GGGCAACAGAACCAACTTGCAGG + Intergenic
1148209647 17:45800446-45800468 GGGGCCCAGAACAGCCAAGCTGG + Intronic
1159619415 18:70620168-70620190 GGTCCACAGACCCACCCTGCTGG - Intergenic
1160818982 19:1049384-1049406 GGGCCACATCACCGCCTTCCTGG + Exonic
1161392895 19:4030710-4030732 AGGCCACACAGCCGCCAGGCAGG - Intronic
1162420992 19:10565993-10566015 GGGCCACAGAACCGCCATGCCGG - Exonic
1162447204 19:10730824-10730846 GGGCCACTGAGCAGCCAGGCAGG - Intronic
1163699165 19:18778581-18778603 GGGCCACAGAACAGACTTCCGGG + Exonic
1165937022 19:39395557-39395579 GGGCCACAGGACCGGTGTGCTGG + Intronic
1166958028 19:46478817-46478839 GAGTCACAGAACCACCATGATGG - Intergenic
1167624051 19:50575222-50575244 AGGCCACAGCAGTGCCATGCAGG + Intergenic
1168116277 19:54222750-54222772 GGGCCCCAGGACCCGCATGCAGG - Exonic
1168181079 19:54663542-54663564 GGGCCCCAGGACCCACATGCAGG + Exonic
1168185311 19:54696614-54696636 GGGCCCCAGGACCCGCATGCAGG + Intronic
926937253 2:18098467-18098489 GGGCTACAGAACAGCGGTGCAGG - Intronic
927213125 2:20650870-20650892 GGGCCCCTGCACCGCCCTGCAGG - Intronic
928210056 2:29317137-29317159 TGGCCACAGAACCACCACCCTGG + Intronic
937263611 2:120601969-120601991 GGGCCACAGAATCCCCAAGGGGG - Intergenic
938096589 2:128467883-128467905 GGGCCACAGGACTGGCTTGCAGG - Intergenic
938293093 2:130160706-130160728 GGGTCACAGCACCTCCAGGCTGG + Intronic
938463461 2:131512259-131512281 GGGTCACAGCACCTCCAGGCTGG - Intergenic
1169818976 20:9688126-9688148 TGGCCAGAGAACAGCCATGGTGG + Intronic
1171978012 20:31607585-31607607 GGGCCACAGAACCACACTGTGGG + Intergenic
1172630502 20:36375161-36375183 GGGCCACAGAAGGGACAGGCGGG - Intronic
1176114201 20:63424010-63424032 GGCCCACATCACCGCCAGGCGGG + Intronic
1180241468 21:46509857-46509879 GGGCCACAGGGGCCCCATGCTGG + Intronic
1181277578 22:21696280-21696302 GGGGCACAGAGACGCCAGGCAGG - Intronic
1182462131 22:30490566-30490588 GGGCCACAGCTCCTCCCTGCAGG - Intronic
1182718544 22:32378786-32378808 GGGCCACAGAACCCCAGTGCAGG + Intronic
1183401860 22:37609334-37609356 GGGCTCCAGGAACGCCATGCAGG - Intronic
950277407 3:11674334-11674356 GGGACACACAAGTGCCATGCTGG - Intronic
953920353 3:46947352-46947374 GGGCCACTGCAGCCCCATGCCGG + Intronic
954753152 3:52824826-52824848 GGGCCACAGGACCTACCTGCTGG + Exonic
959117284 3:102193298-102193320 GGGCCACAGAACCACTAGACAGG + Intronic
963964452 3:151349962-151349984 TGACCACAGCACCTCCATGCTGG - Intronic
986066938 5:4243569-4243591 AGACCACAGAACAGCCCTGCAGG - Intergenic
997200892 5:132009645-132009667 GGGCCTCAGAACCGTCAAGCAGG - Intronic
1002174738 5:177395427-177395449 GTGCCACGGACCTGCCATGCTGG - Intronic
1002424129 5:179165804-179165826 GGGCCCCAGAAGAGCCAGGCGGG + Intronic
1003312380 6:4980830-4980852 GGGCCACAGAACTGGCTGGCAGG + Intergenic
1013633900 6:112010432-112010454 AGGCCCCAGAACCCCCATCCAGG - Intergenic
1016704278 6:147088827-147088849 GGGCCACAGAACCAACTGGCAGG - Intergenic
1018812311 6:167306989-167307011 AGGCCACAGACCCCCCAGGCAGG - Intronic
1019576271 7:1739161-1739183 GGGCCGCAGGACCGCCTTGGTGG + Intronic
1019650498 7:2155087-2155109 AGGCCACAGAAGCCCCAAGCCGG - Intronic
1019701824 7:2477860-2477882 GGGCCCCAGGACGGCCAGGCAGG - Intergenic
1019727736 7:2612365-2612387 GGACCACAGAACAGCCAGGCAGG - Exonic
1019930625 7:4220673-4220695 GGGCTGCAGAACCGGCATTCAGG + Intronic
1024952552 7:54879791-54879813 GGGCCACGGAACTGACATGGGGG + Intergenic
1035282935 7:157788695-157788717 GGGCCACCCAACTGCCATGCAGG + Intronic
1035616077 8:1002857-1002879 GGGCCCCACTAGCGCCATGCTGG - Intergenic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1039785945 8:40834242-40834264 GGACCAGAGAACCGCCCTGCAGG - Intronic
1039892374 8:41694221-41694243 GGACCACAGAACCGACACGGTGG + Intronic
1048104183 8:131389297-131389319 GGGCCACAGCATCTCCATGAGGG + Intergenic
1048286757 8:133147532-133147554 TGGCCACAGAGCCGCCAGCCAGG + Intergenic
1048767263 8:137858609-137858631 GGGCCACAGACCTGAAATGCAGG + Intergenic
1049775277 8:144401135-144401157 GGGCCACAGAACCCAGCTGCAGG + Intronic
1049846928 8:144807324-144807346 CGTCCTCAGGACCGCCATGCGGG - Exonic
1053447428 9:38163825-38163847 GGGCCAAAGAATTGCCATGCTGG - Intergenic
1054758774 9:68985634-68985656 GGGCCAGAGCACCTCCATCCTGG - Intronic
1061619009 9:131798824-131798846 TAGCCACAGCACCGCCTTGCAGG + Intergenic
1190486271 X:50928047-50928069 GGGCCACATATCAGCCATGGGGG + Intergenic
1193224123 X:78961471-78961493 GGGTCACAGAACTGCCATGGCGG - Exonic
1200223652 X:154404728-154404750 GGGCCACAGGCCCCCCATCCTGG - Intronic