ID: 1162421028

View in Genome Browser
Species Human (GRCh38)
Location 19:10566144-10566166
Sequence ATCACCGCAGTCACCGCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 79}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162421015_1162421028 23 Left 1162421015 19:10566098-10566120 CCGCTGCTAACCCCGCCCCTGGC 0: 1
1: 0
2: 0
3: 34
4: 371
Right 1162421028 19:10566144-10566166 ATCACCGCAGTCACCGCCCACGG 0: 1
1: 0
2: 1
3: 8
4: 79
1162421022_1162421028 7 Left 1162421022 19:10566114-10566136 CCCTGGCTTTTCCGGGATCCCTT 0: 1
1: 0
2: 0
3: 6
4: 119
Right 1162421028 19:10566144-10566166 ATCACCGCAGTCACCGCCCACGG 0: 1
1: 0
2: 1
3: 8
4: 79
1162421018_1162421028 13 Left 1162421018 19:10566108-10566130 CCCCGCCCCTGGCTTTTCCGGGA 0: 1
1: 0
2: 2
3: 19
4: 130
Right 1162421028 19:10566144-10566166 ATCACCGCAGTCACCGCCCACGG 0: 1
1: 0
2: 1
3: 8
4: 79
1162421024_1162421028 -4 Left 1162421024 19:10566125-10566147 CCGGGATCCCTTTCGCCTCATCA 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1162421028 19:10566144-10566166 ATCACCGCAGTCACCGCCCACGG 0: 1
1: 0
2: 1
3: 8
4: 79
1162421021_1162421028 8 Left 1162421021 19:10566113-10566135 CCCCTGGCTTTTCCGGGATCCCT 0: 1
1: 0
2: 1
3: 7
4: 168
Right 1162421028 19:10566144-10566166 ATCACCGCAGTCACCGCCCACGG 0: 1
1: 0
2: 1
3: 8
4: 79
1162421020_1162421028 11 Left 1162421020 19:10566110-10566132 CCGCCCCTGGCTTTTCCGGGATC 0: 1
1: 0
2: 1
3: 4
4: 118
Right 1162421028 19:10566144-10566166 ATCACCGCAGTCACCGCCCACGG 0: 1
1: 0
2: 1
3: 8
4: 79
1162421023_1162421028 6 Left 1162421023 19:10566115-10566137 CCTGGCTTTTCCGGGATCCCTTT 0: 1
1: 0
2: 1
3: 10
4: 107
Right 1162421028 19:10566144-10566166 ATCACCGCAGTCACCGCCCACGG 0: 1
1: 0
2: 1
3: 8
4: 79
1162421019_1162421028 12 Left 1162421019 19:10566109-10566131 CCCGCCCCTGGCTTTTCCGGGAT 0: 1
1: 0
2: 0
3: 12
4: 174
Right 1162421028 19:10566144-10566166 ATCACCGCAGTCACCGCCCACGG 0: 1
1: 0
2: 1
3: 8
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162421028 Original CRISPR ATCACCGCAGTCACCGCCCA CGG Intergenic